X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=test%2Fjalview%2Fdatamodel%2Fxdb%2Fembl%2FEmblTestHelper.java;h=0c7624f4b583a75b446176ed5cfd093328de63fa;hb=7d67fb613ec026dc9a265e351e7fab542e3f1d61;hp=8f631dffa9a39cae0d514acff5c2c5edc339ae04;hpb=884952b9d0bf7e07ff8c8f70ed1601bfe20ac554;p=jalview.git
diff --git a/test/jalview/datamodel/xdb/embl/EmblTestHelper.java b/test/jalview/datamodel/xdb/embl/EmblTestHelper.java
index 8f631df..0c7624f 100644
--- a/test/jalview/datamodel/xdb/embl/EmblTestHelper.java
+++ b/test/jalview/datamodel/xdb/embl/EmblTestHelper.java
@@ -1,23 +1,78 @@
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see .
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.datamodel.xdb.embl;
import java.io.StringReader;
public class EmblTestHelper
{
- // adapted from http://www.ebi.ac.uk/ena/data/view/x53828&display=xml
+ // adapted from http://www.ebi.ac.uk/ena/data/view/X07547&display=xml
+ // dna and translations truncated for convenience
private static final String TESTDATA = ""
+ ""
- + ""
- + "Chicken LDH-A mRNA for lactate dehydrogenase A chain (EC 1.1.1.27)"
- + "L-lactate dehydrogenasechutney"
- + ""
- + ""
- + ""
- + ""
- + "L-lactate dehydrogenase A-chainpickle"
- + "MSLKDHLIHNKeith"
- + "" + "GTGACG";
+ + ""
+ + "X07574"
+ + "C. trachomatis plasmid"
+ + "plasmidunidentified reading frame"
+ + ""
+ + ""
+ /*
+ * first CDS (range and translation changed to keep test data manageable)
+ */
+ + ""
+ // test the case of >1 cross-ref to the same database (JAL-2029)
+ + ""
+ + ""
+ + "ORF 8 (AA 1-330)pickle"
+ + "CAA30420.1"
+ + "MLCFKeith"
+ + ""
+ /*
+ * second CDS (range and translation changed to keep test data manageable)
+ */
+ + ""
+ + ""
+ + "CAA30421.1"
+ + "MSSS"
+ + ""
+ /*
+ * third CDS is made up - has no xref - code should synthesize
+ * one to an assumed EMBLCDSPROTEIN accession
+ */
+ + ""
+ + "CAA12345.6"
+ + "MSS"
+ + ""
+ /*
+ * sequence (modified for test purposes)
+ * emulates EMBL XML 1.2 which splits sequence data every 60 characters
+ * see EmblSequence.setSequence
+ */
+ + "GGTATGTCCTCTAGTACAAAC\n"
+ + "ACCCCCAATATTGTGATATAATTAAAAACATAGCAT"
+ + "";
static EmblFile getEmblFile()
{