X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=test%2Fjalview%2Fdatamodel%2Fxdb%2Fembl%2FEmblTestHelper.java;h=0c7624f4b583a75b446176ed5cfd093328de63fa;hb=db93a1adcbe0a4eaaf06e0a70ade0d6c5c1961c3;hp=a79bdb8d707625ba29b6eaa8e62e178d7ed6af7b;hpb=30b2b47cbdfa35b127b0fb09e911815cddd9ed7b;p=jalview.git

diff --git a/test/jalview/datamodel/xdb/embl/EmblTestHelper.java b/test/jalview/datamodel/xdb/embl/EmblTestHelper.java
index a79bdb8..0c7624f 100644
--- a/test/jalview/datamodel/xdb/embl/EmblTestHelper.java
+++ b/test/jalview/datamodel/xdb/embl/EmblTestHelper.java
@@ -1,3 +1,23 @@
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ * 
+ * This file is part of Jalview.
+ * 
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License 
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *  
+ * Jalview is distributed in the hope that it will be useful, but 
+ * WITHOUT ANY WARRANTY; without even the implied warranty 
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR 
+ * PURPOSE.  See the GNU General Public License for more details.
+ * 
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview.  If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
 package jalview.datamodel.xdb.embl;
 
 import java.io.StringReader;
@@ -7,7 +27,7 @@ public class EmblTestHelper
   // adapted from http://www.ebi.ac.uk/ena/data/view/X07547&display=xml
   // dna and translations truncated for convenience
   private static final String TESTDATA = "<?xml version=\"1.0\" encoding=\"UTF-8\" ?>"
-          // + "<ROOT>"
+          + "<ROOT>"
           + "<entry accession=\"X07547\" version=\"1\" entryVersion=\"8\""
           + " dataClass=\"STD\" taxonomicDivision=\"PRO\""
           + " moleculeType=\"genomic DNA\" sequenceLength=\"7499\" topology=\"linear\""
@@ -52,10 +72,10 @@ public class EmblTestHelper
            */
           + "<sequence>GGTATGTCCTCTAGTACAAAC\n"
           + "ACCCCCAATATTGTGATATAATTAAAAACATAGCAT"
- + "</sequence></entry>";
+          + "</sequence></entry></ROOT>";
 
-  static EmblEntry getEmblFile()
+  static EmblFile getEmblFile()
   {
-    return EmblFile.getEntry(new StringReader(TESTDATA));
+    return EmblFile.getEmblFile(new StringReader(TESTDATA));
   }
 }