X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=test%2Fjalview%2Fdatamodel%2Fxdb%2Fembl%2FEmblTestHelper.java;h=0c7624f4b583a75b446176ed5cfd093328de63fa;hb=refs%2Fheads%2Fbug%2FJAL-3184restoreGroupVisibility;hp=a79bdb8d707625ba29b6eaa8e62e178d7ed6af7b;hpb=30b2b47cbdfa35b127b0fb09e911815cddd9ed7b;p=jalview.git
diff --git a/test/jalview/datamodel/xdb/embl/EmblTestHelper.java b/test/jalview/datamodel/xdb/embl/EmblTestHelper.java
index a79bdb8..0c7624f 100644
--- a/test/jalview/datamodel/xdb/embl/EmblTestHelper.java
+++ b/test/jalview/datamodel/xdb/embl/EmblTestHelper.java
@@ -1,3 +1,23 @@
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see .
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.datamodel.xdb.embl;
import java.io.StringReader;
@@ -7,7 +27,7 @@ public class EmblTestHelper
// adapted from http://www.ebi.ac.uk/ena/data/view/X07547&display=xml
// dna and translations truncated for convenience
private static final String TESTDATA = ""
- // + ""
+ + ""
+ "GGTATGTCCTCTAGTACAAAC\n"
+ "ACCCCCAATATTGTGATATAATTAAAAACATAGCAT"
- + "";
+ + "";
- static EmblEntry getEmblFile()
+ static EmblFile getEmblFile()
{
- return EmblFile.getEntry(new StringReader(TESTDATA));
+ return EmblFile.getEmblFile(new StringReader(TESTDATA));
}
}