X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=test%2Fjalview%2Fio%2Fgff%2FGff3HelperTest.java;h=cd5a0d8853e8571d75a9992a241f39790e1aa20f;hb=7428d315297907b3bb52ddb099a348acffb87636;hp=420b0320128800f1b72ee5676c0e069a75c028b7;hpb=8f920d337154e092f5f9056ffde3cdf2735eca43;p=jalview.git
diff --git a/test/jalview/io/gff/Gff3HelperTest.java b/test/jalview/io/gff/Gff3HelperTest.java
index 420b032..cd5a0d8 100644
--- a/test/jalview/io/gff/Gff3HelperTest.java
+++ b/test/jalview/io/gff/Gff3HelperTest.java
@@ -1,3 +1,23 @@
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see .
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.io.gff;
import static org.testng.AssertJUnit.assertEquals;
@@ -13,16 +33,27 @@ import jalview.datamodel.Sequence;
import jalview.datamodel.SequenceDummy;
import jalview.datamodel.SequenceFeature;
import jalview.datamodel.SequenceI;
+import jalview.gui.JvOptionPane;
import java.io.IOException;
import java.util.ArrayList;
+import java.util.HashMap;
import java.util.List;
+import java.util.Map;
+import org.testng.annotations.BeforeClass;
import org.testng.annotations.Test;
public class Gff3HelperTest
{
+ @BeforeClass(alwaysRun = true)
+ public void setUpJvOptionPane()
+ {
+ JvOptionPane.setInteractiveMode(false);
+ JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
+ }
+
/**
* Test processing one PASA GFF line giving a match from forward strand to
* forward strand
@@ -161,7 +192,7 @@ public class Gff3HelperTest
"GAATTCGTTCATGTAGGTTGATTTTTATT");
seq.createDatasetSequence();
AlignmentI align = new Alignment(new SequenceI[] {});
-
+
// mapping from gi|68711 12923-13060 to gi|N37351 1-138
String[] gff = "gi|68711\tblat-pasa\tcDNA_match\t12923\t13060\t98.55\t+\t.\tID=align_68;Target=gi|N37351 1 138 +"
.split("\\t");
@@ -179,7 +210,7 @@ public class Gff3HelperTest
// (this is important for 'align cdna to genome' to work correctly)
assertEquals(1, align.getCodonFrames().size());
AlignedCodonFrame mapping = align.getCodonFrames().get(0);
-
+
/*
* 'dnaseqs' (map from) is here [gi|68711]
* 'aaseqs' (map to) is here [gi|N37351]
@@ -192,8 +223,7 @@ public class Gff3HelperTest
assertEquals(1, mapping.getdnaToProt().length);
assertEquals(2, mapping.getdnaToProt()[0].getFromRanges().size());
// the two spliced dna ranges are combined in one MapList
- assertArrayEquals(new int[] { 12923, 13060 },
- mapping.getdnaToProt()[0]
+ assertArrayEquals(new int[] { 12923, 13060 }, mapping.getdnaToProt()[0]
.getFromRanges().get(0));
assertArrayEquals(new int[] { 13411, 13550 }, mapping.getdnaToProt()[0]
.getFromRanges().get(1));
@@ -203,4 +233,48 @@ public class Gff3HelperTest
.getToRanges().get(0));
}
+ @Test(groups = "Functional")
+ public void testGetDescription()
+ {
+ Gff3Helper testee = new Gff3Helper();
+ SequenceFeature sf = new SequenceFeature("type", "desc", 10, 20, 3f,
+ "group");
+ Map> attributes = new HashMap>();
+ assertNull(testee.getDescription(sf, attributes));
+
+ // ID if any is a fall-back for description
+ sf.setValue("ID", "Patrick");
+ assertEquals("Patrick", testee.getDescription(sf, attributes));
+
+ // Target is set by Exonerate
+ sf.setValue("Target", "Destination Moon");
+ assertEquals("Destination", testee.getDescription(sf, attributes));
+
+ // Ensembl variant feature - extract "alleles" value
+ // may be sequence_variant or a sub-type in the sequence ontology
+ sf = new SequenceFeature("feature_variant", "desc", 10, 20, 3f, "group");
+ List atts = new ArrayList();
+ atts.add("A");
+ atts.add("C");
+ atts.add("T");
+ attributes.put("alleles", atts);
+ assertEquals("A,C,T", testee.getDescription(sf, attributes));
+
+ // Ensembl transcript or exon feature - extract Name
+ List atts2 = new ArrayList();
+ atts2.add("ENSE00001871077");
+ attributes.put("Name", atts2);
+ sf = new SequenceFeature("transcript", "desc", 10, 20, 3f, "group");
+ assertEquals("ENSE00001871077", testee.getDescription(sf, attributes));
+ // transcript sub-type in SO
+ sf = new SequenceFeature("mRNA", "desc", 10, 20, 3f, "group");
+ assertEquals("ENSE00001871077", testee.getDescription(sf, attributes));
+ // special usage of feature by Ensembl
+ sf = new SequenceFeature("NMD_transcript_variant", "desc", 10, 20, 3f,
+ "group");
+ assertEquals("ENSE00001871077", testee.getDescription(sf, attributes));
+ // exon feature
+ sf = new SequenceFeature("exon", "desc", 10, 20, 3f, "group");
+ assertEquals("ENSE00001871077", testee.getDescription(sf, attributes));
+ }
}