X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=test%2Fjalview%2Fio%2Fgff%2FGffTests.java;h=221f612af038cb8a0f16b3c04dcc128ce458a6a3;hb=604cbee405a837565ba1a74aa9bddd62aed685ab;hp=77da8fa5bef4712bd472fe4077a4c8dab29f9b81;hpb=8f920d337154e092f5f9056ffde3cdf2735eca43;p=jalview.git diff --git a/test/jalview/io/gff/GffTests.java b/test/jalview/io/gff/GffTests.java index 77da8fa..221f612 100644 --- a/test/jalview/io/gff/GffTests.java +++ b/test/jalview/io/gff/GffTests.java @@ -1,3 +1,23 @@ +/* + * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$) + * Copyright (C) $$Year-Rel$$ The Jalview Authors + * + * This file is part of Jalview. + * + * Jalview is free software: you can redistribute it and/or + * modify it under the terms of the GNU General Public License + * as published by the Free Software Foundation, either version 3 + * of the License, or (at your option) any later version. + * + * Jalview is distributed in the hope that it will be useful, but + * WITHOUT ANY WARRANTY; without even the implied warranty + * of MERCHANTABILITY or FITNESS FOR A PARTICULAR + * PURPOSE. See the GNU General Public License for more details. + * + * You should have received a copy of the GNU General Public License + * along with Jalview. If not, see . + * The Jalview Authors are detailed in the 'AUTHORS' file. + */ package jalview.io.gff; import static org.testng.AssertJUnit.assertEquals; @@ -69,8 +89,6 @@ public class GffTests mappedRegion = mapList[0].getMap().locateInFrom(15, 15); assertArrayEquals(new int[] { 12, 10 }, mappedRegion); - // so far so good; TODO: programmatically add mapped sequences - // and verify the mappings are 'realised' SequenceI dna1 = new Sequence("dna1", "AAACCCGGGTTTAAACCCGGGTTT"); AlignmentI al = new Alignment(new SequenceI[] { dna1 }); al.setDataset(null);