X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=test%2Fjalview%2Fio%2Fvcf%2FVCFLoaderTest.java;fp=test%2Fjalview%2Fio%2Fvcf%2FVCFLoaderTest.java;h=2b418de990b35bdd70eecca833f8823d879b95ef;hb=3459a8a691cb22508d7067f240b7254e588e77d3;hp=a2bb08e6d3276cfd6433ba16fcf6798cb1261e99;hpb=5b27f1062b2203c4c31702e205f4c78e1992063e;p=jalview.git

diff --git a/test/jalview/io/vcf/VCFLoaderTest.java b/test/jalview/io/vcf/VCFLoaderTest.java
index a2bb08e..2b418de 100644
--- a/test/jalview/io/vcf/VCFLoaderTest.java
+++ b/test/jalview/io/vcf/VCFLoaderTest.java
@@ -1,3 +1,23 @@
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ * 
+ * This file is part of Jalview.
+ * 
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License 
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *  
+ * Jalview is distributed in the hope that it will be useful, but 
+ * WITHOUT ANY WARRANTY; without even the implied warranty 
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR 
+ * PURPOSE.  See the GNU General Public License for more details.
+ * 
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview.  If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
 package jalview.io.vcf;
 
 import static jalview.io.gff.SequenceOntologyI.SEQUENCE_VARIANT;
@@ -36,11 +56,10 @@ public class VCFLoaderTest
   private static final float DELTA = 0.00001f;
 
   // columns 9717- of gene P30419 from Ensembl (much modified)
-  private static final String FASTA = ""
-          +
-          /*
-           * forward strand 'gene' and 'transcript' with two exons
-           */
+  private static final String FASTA = "" +
+  /*
+   * forward strand 'gene' and 'transcript' with two exons
+   */
           ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n"
           + "CAAGCTGGCGGACGAGAGTGTGACA\n"
           + ">transcript1/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
@@ -49,8 +68,8 @@ public class VCFLoaderTest
            * reverse strand gene and transcript (reverse complement alleles!)
            */
           + ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n"
-          + "TGTCACACTCTCGTCCGCCAGCTTG\n"
-          + ">transcript2/1-18\n" + "-GTCACACTCT----CGCCAGCT--\n"
+          + "TGTCACACTCTCGTCCGCCAGCTTG\n" + ">transcript2/1-18\n"
+          + "-GTCACACTCT----CGCCAGCT--\n"
 
           /*
            * 'gene' on chromosome 5 with two transcripts
@@ -61,7 +80,8 @@ public class VCFLoaderTest
           + ">transcript4/1-18\n-----TGG-GGACGAGAGTGTGA-A\n";
 
   private static final String[] VCF = { "##fileformat=VCFv4.2",
-      // fields other than AF are ignored when parsing as they have no INFO definition
+      // fields other than AF are ignored when parsing as they have no INFO
+      // definition
       "##INFO=<ID=AF,Number=A,Type=Float,Description=\"Allele Frequency, for each ALT allele, in the same order as listed\">",
       "##INFO=<ID=AC_Female,Number=A,Type=Integer,Description=\"Allele count in Female genotypes\"",
       "##INFO=<ID=AF_AFR,Number=A,Type=Float,Description=\"Allele Frequency among African/African American genotypes\"",
@@ -258,8 +278,8 @@ public class VCFLoaderTest
     SequenceI gene1 = alignment.findName("gene1");
     int[] to = new int[] { 45051610, 45051634 };
     int[] from = new int[] { gene1.getStart(), gene1.getEnd() };
-    gene1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
-            1, 1));
+    gene1.setGeneLoci("homo_sapiens", "GRCh38", "17",
+            new MapList(from, to, 1, 1));
 
     /*
      * map 'transcript1' to chromosome via 'gene1'
@@ -269,9 +289,8 @@ public class VCFLoaderTest
     to = new int[] { 45051612, 45051619, 45051624, 45051633 };
     SequenceI transcript1 = alignment.findName("transcript1");
     from = new int[] { transcript1.getStart(), transcript1.getEnd() };
-    transcript1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
-            from, to,
-            1, 1));
+    transcript1.setGeneLoci("homo_sapiens", "GRCh38", "17",
+            new MapList(from, to, 1, 1));
 
     /*
      * map gene2 to chromosome reverse strand
@@ -279,8 +298,8 @@ public class VCFLoaderTest
     SequenceI gene2 = alignment.findName("gene2");
     to = new int[] { 45051634, 45051610 };
     from = new int[] { gene2.getStart(), gene2.getEnd() };
-    gene2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
-            1, 1));
+    gene2.setGeneLoci("homo_sapiens", "GRCh38", "17",
+            new MapList(from, to, 1, 1));
 
     /*
      * map 'transcript2' to chromosome via 'gene2'
@@ -290,9 +309,8 @@ public class VCFLoaderTest
     to = new int[] { 45051633, 45051624, 45051619, 45051612 };
     SequenceI transcript2 = alignment.findName("transcript2");
     from = new int[] { transcript2.getStart(), transcript2.getEnd() };
-    transcript2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
-            from, to,
-            1, 1));
+    transcript2.setGeneLoci("homo_sapiens", "GRCh38", "17",
+            new MapList(from, to, 1, 1));
 
     /*
      * add a protein product as a DBRef on transcript1
@@ -319,8 +337,8 @@ public class VCFLoaderTest
     SequenceI gene3 = alignment.findName("gene3");
     to = new int[] { 45051610, 45051634 };
     from = new int[] { gene3.getStart(), gene3.getEnd() };
-    gene3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(from, to,
-            1, 1));
+    gene3.setGeneLoci("homo_sapiens", "GRCh38", "5",
+            new MapList(from, to, 1, 1));
 
     /*
      * map 'transcript3' to chromosome
@@ -328,9 +346,8 @@ public class VCFLoaderTest
     SequenceI transcript3 = alignment.findName("transcript3");
     to = new int[] { 45051612, 45051619, 45051624, 45051633 };
     from = new int[] { transcript3.getStart(), transcript3.getEnd() };
-    transcript3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
-            from, to,
-            1, 1));
+    transcript3.setGeneLoci("homo_sapiens", "GRCh38", "5",
+            new MapList(from, to, 1, 1));
 
     /*
      * map 'transcript4' to chromosome
@@ -339,9 +356,8 @@ public class VCFLoaderTest
     to = new int[] { 45051615, 45051617, 45051619, 45051632, 45051634,
         45051634 };
     from = new int[] { transcript4.getStart(), transcript4.getEnd() };
-    transcript4.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
-            from, to,
-            1, 1));
+    transcript4.setGeneLoci("homo_sapiens", "GRCh38", "5",
+            new MapList(from, to, 1, 1));
 
     /*
      * add a protein product as a DBRef on transcript3
@@ -718,8 +734,7 @@ public class VCFLoaderTest
   @Test(groups = "Functional")
   public void testLoadVCFContig() throws IOException
   {
-    VCFLoader loader = new VCFLoader(
-            "test/jalview/io/vcf/testVcf2.vcf");
+    VCFLoader loader = new VCFLoader("test/jalview/io/vcf/testVcf2.vcf");
 
     SequenceI seq = loader.loadVCFContig("contig123");
     assertEquals(seq.getLength(), 15);