X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=test%2Fjalview%2Fio%2Fvcf%2FVCFLoaderTest.java;h=246337d6e8f9dfcf784e0e401b95ad8c649267b0;hb=0a680b4ff1aaad7580d3b10941233307e2190be4;hp=7379ecde8e8d8ce7525bd6aa0b5db1036e9655b8;hpb=4b24105fbfd942b6ec58a407b9dc68a331ba13d7;p=jalview.git diff --git a/test/jalview/io/vcf/VCFLoaderTest.java b/test/jalview/io/vcf/VCFLoaderTest.java index 7379ecd..246337d 100644 --- a/test/jalview/io/vcf/VCFLoaderTest.java +++ b/test/jalview/io/vcf/VCFLoaderTest.java @@ -2,12 +2,14 @@ package jalview.io.vcf; import static org.testng.Assert.assertEquals; +import jalview.bin.Cache; import jalview.datamodel.AlignmentI; import jalview.datamodel.DBRefEntry; import jalview.datamodel.Mapping; import jalview.datamodel.Sequence; import jalview.datamodel.SequenceFeature; import jalview.datamodel.SequenceI; +import jalview.datamodel.features.SequenceFeatures; import jalview.gui.AlignFrame; import jalview.io.DataSourceType; import jalview.io.FileLoader; @@ -19,84 +21,137 @@ import java.io.File; import java.io.IOException; import java.io.PrintWriter; import java.util.List; +import java.util.Map; +import org.testng.annotations.BeforeClass; import org.testng.annotations.Test; public class VCFLoaderTest { - // columns 9717- of gene P30419 from Ensembl (modified) - private static final String FASTA = - // forward strand 'gene' - ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n" + private static final float DELTA = 0.00001f; + + // columns 9717- of gene P30419 from Ensembl (much modified) + private static final String FASTA = "" + + + /* + * forward strand 'gene' and 'transcript' with two exons + */ + ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n" + "CAAGCTGGCGGACGAGAGTGTGACA\n" - // and a 'made up' mini-transcript with two exons + ">transcript1/1-18\n--AGCTGGCG----AGAGTGTGAC-\n" - + - // 'reverse strand' gene (reverse complement) - ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n" + + /* + * reverse strand gene and transcript (reverse complement alleles!) + */ + + ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n" + "TGTCACACTCTCGTCCGCCAGCTTG\n" - // and its 'transcript' - + ">transcript2/1-18\n" - + "-GTCACACTCT----CGCCAGCT--\n"; + + ">transcript2/1-18\n" + "-GTCACACTCT----CGCCAGCT--\n" + + /* + * 'gene' on chromosome 5 with two transcripts + */ + + ">gene3/1-25 chromosome:GRCh38:5:45051610:45051634:1\n" + + "CAAGCTGGCGGACGAGAGTGTGACA\n" + + ">transcript3/1-18\n--AGCTGGCG----AGAGTGTGAC-\n" + + ">transcript4/1-18\n-----TGG-GGACGAGAGTGTGA-A\n"; private static final String[] VCF = { "##fileformat=VCFv4.2", "##INFO=", - "##reference=GRCh38", + "##reference=Homo_sapiens/GRCh38", "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO", - // SNP A/T in position 2 of gene sequence (precedes transcript) - "17\t45051611\t.\tA\tT\t1666.64\tRF\tAC=15;AF=5.08130e-03", + // A/T,C variants in position 2 of gene sequence (precedes transcript) + // should create 2 variant features with respective scores + "17\t45051611\t.\tA\tT,C\t1666.64\tRF\tAC=15;AF=5.0e-03,4.0e-03", // SNP G/C in position 4 of gene sequence, position 2 of transcript - // this is a mixed variant, the insertion G/GA is not transferred - "17\t45051613\t.\tG\tGA,C\t1666.64\tRF\tAC=15;AF=3.08130e-03" }; + // insertion G/GA is transferred to nucleotide but not to peptide + "17\t45051613\t.\tG\tGA,C\t1666.64\tRF\tAC=15;AF=3.0e-03,2.0e-03" }; + + @BeforeClass + public void setUp() + { + /* + * configure to capture all available VCF and VEP (CSQ) fields + */ + Cache.loadProperties("test/jalview/io/testProps.jvprops"); + Cache.setProperty("VCF_FIELDS", ".*"); + Cache.setProperty("VEP_FIELDS", ".*"); + } @Test(groups = "Functional") - public void testLoadVCF() throws IOException + public void testDoLoad() throws IOException { AlignmentI al = buildAlignment(); VCFLoader loader = new VCFLoader(al); File f = makeVcf(); - loader.loadVCF(f.getPath(), null); + loader.doLoad(f.getPath(), null); /* * verify variant feature(s) added to gene + * NB alleles at a locus may not be processed, and features added, + * in the order in which they appear in the VCF record as method + * VariantContext.getAlternateAlleles() does not guarantee order + * - order of assertions here matches what we find (is not important) */ List geneFeatures = al.getSequenceAt(0) .getSequenceFeatures(); - assertEquals(geneFeatures.size(), 2); + SequenceFeatures.sortFeatures(geneFeatures, true); + assertEquals(geneFeatures.size(), 4); SequenceFeature sf = geneFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 2); assertEquals(sf.getEnd(), 2); + assertEquals(sf.getScore(), 4.0e-03, DELTA); + assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,C"); + assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); + sf = geneFeatures.get(1); + assertEquals(sf.getFeatureGroup(), "VCF"); + assertEquals(sf.getBegin(), 2); + assertEquals(sf.getEnd(), 2); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); - assertEquals(sf.getScore(), 5.08130e-03, 0.000001f); + assertEquals(sf.getScore(), 5.0e-03, DELTA); assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,T"); - sf = geneFeatures.get(1); + sf = geneFeatures.get(2); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 4); assertEquals(sf.getEnd(), 4); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); - assertEquals(sf.getScore(), 3.08130e-03, 0.000001f); + assertEquals(sf.getScore(), 2.0e-03, DELTA); assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C"); + sf = geneFeatures.get(3); + assertEquals(sf.getFeatureGroup(), "VCF"); + assertEquals(sf.getBegin(), 4); + assertEquals(sf.getEnd(), 4); + assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); + assertEquals(sf.getScore(), 3.0e-03, DELTA); + assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA"); + /* * verify variant feature(s) added to transcript */ List transcriptFeatures = al.getSequenceAt(1) .getSequenceFeatures(); - assertEquals(transcriptFeatures.size(), 1); + assertEquals(transcriptFeatures.size(), 2); sf = transcriptFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 2); assertEquals(sf.getEnd(), 2); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); - assertEquals(sf.getScore(), 3.08130e-03, 0.000001f); + assertEquals(sf.getScore(), 2.0e-03, DELTA); assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C"); + sf = transcriptFeatures.get(1); + assertEquals(sf.getFeatureGroup(), "VCF"); + assertEquals(sf.getBegin(), 2); + assertEquals(sf.getEnd(), 2); + assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); + assertEquals(sf.getScore(), 3.0e-03, DELTA); + assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA"); /* - * verify variant feature(s) computed and added to protein + * verify SNP variant feature(s) computed and added to protein * first codon AGC varies to ACC giving S/T */ DBRefEntry[] dbRefs = al.getSequenceAt(1).getDBRefs(); @@ -146,10 +201,11 @@ public class VCFLoaderTest * from Ensembl and transcripts computed) */ AlignmentI alignment = af.getViewport().getAlignment(); - SequenceI gene1 = alignment.getSequenceAt(0); + SequenceI gene1 = alignment.findName("gene1"); int[] to = new int[] { 45051610, 45051634 }; int[] from = new int[] { gene1.getStart(), gene1.getEnd() }; - gene1.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, 1, 1)); + gene1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to, + 1, 1)); /* * map 'transcript1' to chromosome via 'gene1' @@ -157,18 +213,20 @@ public class VCFLoaderTest * which is chromosome 45051612-45051619,45051624-45051633 */ to = new int[] { 45051612, 45051619, 45051624, 45051633 }; - SequenceI transcript1 = alignment.getSequenceAt(1); + SequenceI transcript1 = alignment.findName("transcript1"); from = new int[] { transcript1.getStart(), transcript1.getEnd() }; - transcript1.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, + transcript1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList( + from, to, 1, 1)); /* * map gene2 to chromosome reverse strand */ - SequenceI gene2 = alignment.getSequenceAt(2); + SequenceI gene2 = alignment.findName("gene2"); to = new int[] { 45051634, 45051610 }; from = new int[] { gene2.getStart(), gene2.getEnd() }; - gene2.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, 1, 1)); + gene2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to, + 1, 1)); /* * map 'transcript2' to chromosome via 'gene2' @@ -176,9 +234,10 @@ public class VCFLoaderTest * which is chromosome 45051633-45051624,45051619-45051612 */ to = new int[] { 45051633, 45051624, 45051619, 45051612 }; - SequenceI transcript2 = alignment.getSequenceAt(3); + SequenceI transcript2 = alignment.findName("transcript2"); from = new int[] { transcript2.getStart(), transcript2.getEnd() }; - transcript2.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, + transcript2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList( + from, to, 1, 1)); /* @@ -200,6 +259,45 @@ public class VCFLoaderTest product = new DBRefEntry("", "", "ENSP002", map); transcript2.addDBRef(product); + /* + * map gene3 to chromosome + */ + SequenceI gene3 = alignment.findName("gene3"); + to = new int[] { 45051610, 45051634 }; + from = new int[] { gene3.getStart(), gene3.getEnd() }; + gene3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(from, to, + 1, 1)); + + /* + * map 'transcript3' to chromosome + */ + SequenceI transcript3 = alignment.findName("transcript3"); + to = new int[] { 45051612, 45051619, 45051624, 45051633 }; + from = new int[] { transcript3.getStart(), transcript3.getEnd() }; + transcript3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList( + from, to, + 1, 1)); + + /* + * map 'transcript4' to chromosome + */ + SequenceI transcript4 = alignment.findName("transcript4"); + to = new int[] { 45051615, 45051617, 45051619, 45051632, 45051634, + 45051634 }; + from = new int[] { transcript4.getStart(), transcript4.getEnd() }; + transcript4.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList( + from, to, + 1, 1)); + + /* + * add a protein product as a DBRef on transcript3 + */ + SequenceI peptide3 = new Sequence("ENSP003", "SWRECD"); + mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1); + map = new Mapping(peptide3, mapList); + product = new DBRefEntry("", "", "ENSP003", map); + transcript3.addDBRef(product); + return alignment; } @@ -211,7 +309,7 @@ public class VCFLoaderTest * @throws IOException */ @Test(groups = "Functional") - public void testLoadVCF_reverseStrand() throws IOException + public void testDoLoad_reverseStrand() throws IOException { AlignmentI al = buildAlignment(); @@ -219,49 +317,74 @@ public class VCFLoaderTest File f = makeVcf(); - loader.loadVCF(f.getPath(), null); + loader.doLoad(f.getPath(), null); /* * verify variant feature(s) added to gene2 * gene/1-25 maps to chromosome 45051634- reverse strand - * variants A/T at 45051611 and G/C at 45051613 map to - * T/A and C/G at gene positions 24 and 22 respectively + * variants A/T, A/C at 45051611 and G/GA,G/C at 45051613 map to + * T/A, T/G and C/TC,C/G at gene positions 24 and 22 respectively */ List geneFeatures = al.getSequenceAt(2) .getSequenceFeatures(); - assertEquals(geneFeatures.size(), 2); + SequenceFeatures.sortFeatures(geneFeatures, true); + assertEquals(geneFeatures.size(), 4); SequenceFeature sf = geneFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 22); assertEquals(sf.getEnd(), 22); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); - assertEquals(sf.getScore(), 3.08130e-03, 0.000001f); + assertEquals(sf.getScore(), 2.0e-03, DELTA); assertEquals("C,G", sf.getValue(Gff3Helper.ALLELES)); sf = geneFeatures.get(1); assertEquals(sf.getFeatureGroup(), "VCF"); + assertEquals(sf.getBegin(), 22); + assertEquals(sf.getEnd(), 22); + assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); + assertEquals(sf.getScore(), 3.0e-03, DELTA); + assertEquals("C,TC", sf.getValue(Gff3Helper.ALLELES)); + + sf = geneFeatures.get(2); + assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 24); assertEquals(sf.getEnd(), 24); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); - assertEquals(sf.getScore(), 5.08130e-03, 0.000001f); + assertEquals(sf.getScore(), 4.0e-03, DELTA); + assertEquals("T,G", sf.getValue(Gff3Helper.ALLELES)); + + sf = geneFeatures.get(3); + assertEquals(sf.getFeatureGroup(), "VCF"); + assertEquals(sf.getBegin(), 24); + assertEquals(sf.getEnd(), 24); + assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); + assertEquals(sf.getScore(), 5.0e-03, DELTA); assertEquals("T,A", sf.getValue(Gff3Helper.ALLELES)); /* * verify variant feature(s) added to transcript2 - * variant C/G at position 22 of gene overlaps and maps to - * position 17 of transcript + * variants G/GA,G/C at position 22 of gene overlap and map to + * C/TC,C/G at position 17 of transcript */ List transcriptFeatures = al.getSequenceAt(3) .getSequenceFeatures(); - assertEquals(transcriptFeatures.size(), 1); + assertEquals(transcriptFeatures.size(), 2); sf = transcriptFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 17); assertEquals(sf.getEnd(), 17); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); - assertEquals(sf.getScore(), 3.08130e-03, 0.000001f); + assertEquals(sf.getScore(), 2.0e-03, DELTA); assertEquals("C,G", sf.getValue(Gff3Helper.ALLELES)); + sf = transcriptFeatures.get(1); + assertEquals(sf.getFeatureGroup(), "VCF"); + assertEquals(sf.getBegin(), 17); + assertEquals(sf.getEnd(), 17); + assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); + assertEquals(sf.getScore(), 3.0e-03, DELTA); + assertEquals("C,TC", sf.getValue(Gff3Helper.ALLELES)); + /* * verify variant feature(s) computed and added to protein * last codon GCT varies to GGT giving A/G in the last peptide position @@ -284,4 +407,193 @@ public class VCFLoaderTest assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getDescription(), "p.Ala6Gly"); } + + /** + * Tests that if VEP consequence (CSQ) data is present in the VCF data, then + * it is added to the variant feature, but restricted where possible to the + * consequences for a specific transcript + * + * @throws IOException + */ + @Test(groups = "Functional") + public void testDoLoad_vepCsq() throws IOException + { + AlignmentI al = buildAlignment(); + + VCFLoader loader = new VCFLoader(al); + + /* + * VCF data file with variants at gene3 positions + * 1 C/A + * 5 C/T + * 9 CGT/C (deletion) + * 13 C/G, C/T + * 17 A/AC (insertion), A/G + */ + loader.doLoad("test/jalview/io/vcf/testVcf.dat", null); + + /* + * verify variant feature(s) added to gene3 + */ + List geneFeatures = al.findName("gene3") + .getSequenceFeatures(); + SequenceFeatures.sortFeatures(geneFeatures, true); + assertEquals(geneFeatures.size(), 7); + SequenceFeature sf = geneFeatures.get(0); + assertEquals(sf.getBegin(), 1); + assertEquals(sf.getEnd(), 1); + assertEquals(sf.getScore(), 0.1f, DELTA); + assertEquals(sf.getValue("alleles"), "C,A"); + // gene features include Consequence for all transcripts + Map map = (Map) sf.getValue("CSQ"); + assertEquals(map.size(), 9); + + sf = geneFeatures.get(1); + assertEquals(sf.getBegin(), 5); + assertEquals(sf.getEnd(), 5); + assertEquals(sf.getScore(), 0.2f, DELTA); + assertEquals(sf.getValue("alleles"), "C,T"); + map = (Map) sf.getValue("CSQ"); + assertEquals(map.size(), 9); + + sf = geneFeatures.get(2); + assertEquals(sf.getBegin(), 9); + assertEquals(sf.getEnd(), 11); // deletion over 3 positions + assertEquals(sf.getScore(), 0.3f, DELTA); + assertEquals(sf.getValue("alleles"), "CGG,C"); + map = (Map) sf.getValue("CSQ"); + assertEquals(map.size(), 9); + + sf = geneFeatures.get(3); + assertEquals(sf.getBegin(), 13); + assertEquals(sf.getEnd(), 13); + assertEquals(sf.getScore(), 0.5f, DELTA); + assertEquals(sf.getValue("alleles"), "C,T"); + map = (Map) sf.getValue("CSQ"); + assertEquals(map.size(), 9); + + sf = geneFeatures.get(4); + assertEquals(sf.getBegin(), 13); + assertEquals(sf.getEnd(), 13); + assertEquals(sf.getScore(), 0.4f, DELTA); + assertEquals(sf.getValue("alleles"), "C,G"); + map = (Map) sf.getValue("CSQ"); + assertEquals(map.size(), 9); + + sf = geneFeatures.get(5); + assertEquals(sf.getBegin(), 17); + assertEquals(sf.getEnd(), 17); + assertEquals(sf.getScore(), 0.7f, DELTA); + assertEquals(sf.getValue("alleles"), "A,G"); + map = (Map) sf.getValue("CSQ"); + assertEquals(map.size(), 9); + + sf = geneFeatures.get(6); + assertEquals(sf.getBegin(), 17); + assertEquals(sf.getEnd(), 17); // insertion + assertEquals(sf.getScore(), 0.6f, DELTA); + assertEquals(sf.getValue("alleles"), "A,AC"); + map = (Map) sf.getValue("CSQ"); + assertEquals(map.size(), 9); + + /* + * verify variant feature(s) added to transcript3 + * at columns 5 (1), 17 (2), positions 3, 11 + * note the deletion at columns 9-11 is not transferred since col 11 + * has no mapping to transcript 3 + */ + List transcriptFeatures = al.findName("transcript3") + .getSequenceFeatures(); + SequenceFeatures.sortFeatures(transcriptFeatures, true); + assertEquals(transcriptFeatures.size(), 3); + sf = transcriptFeatures.get(0); + assertEquals(sf.getBegin(), 3); + assertEquals(sf.getEnd(), 3); + assertEquals(sf.getScore(), 0.2f, DELTA); + assertEquals(sf.getValue("alleles"), "C,T"); + // transcript features only have Consequence for that transcripts + map = (Map) sf.getValue("CSQ"); + assertEquals(map.size(), 9); + assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3"); + + sf = transcriptFeatures.get(1); + assertEquals(sf.getBegin(), 11); + assertEquals(sf.getEnd(), 11); + assertEquals(sf.getScore(), 0.7f, DELTA); + assertEquals(sf.getValue("alleles"), "A,G"); + assertEquals(map.size(), 9); + assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3"); + + sf = transcriptFeatures.get(2); + assertEquals(sf.getBegin(), 11); + assertEquals(sf.getEnd(), 11); + assertEquals(sf.getScore(), 0.6f, DELTA); + assertEquals(sf.getValue("alleles"), "A,AC"); + assertEquals(map.size(), 9); + assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3"); + + /* + * verify variants computed on protein product for transcript3 + * peptide is SWRECD + * codon variants are AGC/AGT position 1 which is synonymous + * and GAG/GGG which is E/G in position 4 + * the insertion variant is not transferred to the peptide + */ + DBRefEntry[] dbRefs = al.findName("transcript3").getDBRefs(); + SequenceI peptide = null; + for (DBRefEntry dbref : dbRefs) + { + if (dbref.getMap().getMap().getFromRatio() == 3) + { + peptide = dbref.getMap().getTo(); + } + } + List proteinFeatures = peptide.getSequenceFeatures(); + assertEquals(proteinFeatures.size(), 1); + sf = proteinFeatures.get(0); + assertEquals(sf.getFeatureGroup(), "VCF"); + assertEquals(sf.getBegin(), 4); + assertEquals(sf.getEnd(), 4); + assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); + assertEquals(sf.getDescription(), "p.Glu4Gly"); + + /* + * verify variant feature(s) added to transcript4 + * at columns 13 (2) and 17 (2), positions 7 and 11 + */ + transcriptFeatures = al.findName("transcript4").getSequenceFeatures(); + SequenceFeatures.sortFeatures(transcriptFeatures, true); + assertEquals(transcriptFeatures.size(), 4); + sf = transcriptFeatures.get(0); + assertEquals(sf.getBegin(), 7); + assertEquals(sf.getEnd(), 7); + assertEquals(sf.getScore(), 0.5f, DELTA); + assertEquals(sf.getValue("alleles"), "C,T"); + assertEquals(map.size(), 9); + assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4"); + + sf = transcriptFeatures.get(1); + assertEquals(sf.getBegin(), 7); + assertEquals(sf.getEnd(), 7); + assertEquals(sf.getScore(), 0.4f, DELTA); + assertEquals(sf.getValue("alleles"), "C,G"); + assertEquals(map.size(), 9); + assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4"); + + sf = transcriptFeatures.get(2); + assertEquals(sf.getBegin(), 11); + assertEquals(sf.getEnd(), 11); + assertEquals(sf.getScore(), 0.7f, DELTA); + assertEquals(sf.getValue("alleles"), "A,G"); + assertEquals(map.size(), 9); + assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4"); + + sf = transcriptFeatures.get(3); + assertEquals(sf.getBegin(), 11); + assertEquals(sf.getEnd(), 11); + assertEquals(sf.getScore(), 0.6f, DELTA); + assertEquals(sf.getValue("alleles"), "A,AC"); + assertEquals(map.size(), 9); + assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4"); + } }