X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=test%2Fjalview%2Fio%2Fvcf%2FVCFLoaderTest.java;h=f512d0b297c8fea4d543974433a98e3a88c0f0fc;hb=57738a1f3c19b1c3a00bd3ac5108f8cd0af32f99;hp=a87c160c458d3466337f489c836cf191c29c1119;hpb=1b0014839c94c711c09a94641ecb5036072bb5b3;p=jalview.git

diff --git a/test/jalview/io/vcf/VCFLoaderTest.java b/test/jalview/io/vcf/VCFLoaderTest.java
index a87c160..f512d0b 100644
--- a/test/jalview/io/vcf/VCFLoaderTest.java
+++ b/test/jalview/io/vcf/VCFLoaderTest.java
@@ -1,20 +1,24 @@
 package jalview.io.vcf;
 
+import static jalview.io.gff.SequenceOntologyI.SEQUENCE_VARIANT;
 import static org.testng.Assert.assertEquals;
+import static org.testng.Assert.assertNull;
+import static org.testng.Assert.assertTrue;
 
 import jalview.bin.Cache;
+import jalview.bin.Console;
 import jalview.datamodel.AlignmentI;
 import jalview.datamodel.DBRefEntry;
 import jalview.datamodel.Mapping;
 import jalview.datamodel.Sequence;
 import jalview.datamodel.SequenceFeature;
 import jalview.datamodel.SequenceI;
+import jalview.datamodel.features.FeatureAttributes;
 import jalview.datamodel.features.SequenceFeatures;
 import jalview.gui.AlignFrame;
 import jalview.io.DataSourceType;
 import jalview.io.FileLoader;
 import jalview.io.gff.Gff3Helper;
-import jalview.io.gff.SequenceOntologyI;
 import jalview.util.MapList;
 
 import java.io.File;
@@ -24,6 +28,7 @@ import java.util.List;
 import java.util.Map;
 
 import org.testng.annotations.BeforeClass;
+import org.testng.annotations.BeforeTest;
 import org.testng.annotations.Test;
 
 public class VCFLoaderTest
@@ -31,11 +36,10 @@ public class VCFLoaderTest
   private static final float DELTA = 0.00001f;
 
   // columns 9717- of gene P30419 from Ensembl (much modified)
-  private static final String FASTA = ""
-          +
-          /*
-           * forward strand 'gene' and 'transcript' with two exons
-           */
+  private static final String FASTA = "" +
+  /*
+   * forward strand 'gene' and 'transcript' with two exons
+   */
           ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n"
           + "CAAGCTGGCGGACGAGAGTGTGACA\n"
           + ">transcript1/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
@@ -44,8 +48,8 @@ public class VCFLoaderTest
            * reverse strand gene and transcript (reverse complement alleles!)
            */
           + ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n"
-          + "TGTCACACTCTCGTCCGCCAGCTTG\n"
-          + ">transcript2/1-18\n" + "-GTCACACTCT----CGCCAGCT--\n"
+          + "TGTCACACTCTCGTCCGCCAGCTTG\n" + ">transcript2/1-18\n"
+          + "-GTCACACTCT----CGCCAGCT--\n"
 
           /*
            * 'gene' on chromosome 5 with two transcripts
@@ -56,15 +60,22 @@ public class VCFLoaderTest
           + ">transcript4/1-18\n-----TGG-GGACGAGAGTGTGA-A\n";
 
   private static final String[] VCF = { "##fileformat=VCFv4.2",
+      // fields other than AF are ignored when parsing as they have no INFO
+      // definition
       "##INFO=<ID=AF,Number=A,Type=Float,Description=\"Allele Frequency, for each ALT allele, in the same order as listed\">",
+      "##INFO=<ID=AC_Female,Number=A,Type=Integer,Description=\"Allele count in Female genotypes\"",
+      "##INFO=<ID=AF_AFR,Number=A,Type=Float,Description=\"Allele Frequency among African/African American genotypes\"",
       "##reference=Homo_sapiens/GRCh38",
       "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO",
       // A/T,C variants in position 2 of gene sequence (precedes transcript)
-      // should create 2 variant features with respective scores
-      "17\t45051611\t.\tA\tT,C\t1666.64\tRF\tAC=15;AF=5.0e-03,4.0e-03",
+      // should create 2 variant features with respective AF values
+      // malformed values for AC_Female and AF_AFR should be ignored
+      "17\t45051611\trs384765\tA\tT,C\t1666.64\tRF;XYZ\tAC=15;AF=5.0e-03,4.0e-03;AC_Female=12,3d;AF_AFR=low,2.3e-4",
       // SNP G/C in position 4 of gene sequence, position 2 of transcript
       // insertion G/GA is transferred to nucleotide but not to peptide
-      "17\t45051613\t.\tG\tGA,C\t1666.64\tRF\tAC=15;AF=3.0e-03,2.0e-03" };
+      "17\t45051613\t.\tG\tGA,C\t1666.65\t.\tAC=15;AF=3.0e-03,2.0e-03",
+      // '.' in INFO field should be ignored
+      "17\t45051615\t.\tG\tC\t1666.66\tRF\tAC=16;AF=." };
 
   @BeforeClass(alwaysRun = true)
   public void setUp()
@@ -76,7 +87,16 @@ public class VCFLoaderTest
     Cache.setProperty("VCF_FIELDS", ".*");
     Cache.setProperty("VEP_FIELDS", ".*");
     Cache.setProperty("VCF_ASSEMBLY", "GRCh38=GRCh38");
-    Cache.initLogger();
+    Console.initLogger();
+  }
+
+  @BeforeTest(alwaysRun = true)
+  public void setUpBeforeTest()
+  {
+    /*
+     * clear down feature attributes metadata
+     */
+    FeatureAttributes.getInstance().clear();
   }
 
   @Test(groups = "Functional")
@@ -84,7 +104,7 @@ public class VCFLoaderTest
   {
     AlignmentI al = buildAlignment();
 
-    File f = makeVcf();
+    File f = makeVcfFile();
     VCFLoader loader = new VCFLoader(f.getPath());
 
     loader.doLoad(al.getSequencesArray(), null);
@@ -99,31 +119,41 @@ public class VCFLoaderTest
     List<SequenceFeature> geneFeatures = al.getSequenceAt(0)
             .getSequenceFeatures();
     SequenceFeatures.sortFeatures(geneFeatures, true);
-    assertEquals(geneFeatures.size(), 4);
+    assertEquals(geneFeatures.size(), 5);
     SequenceFeature sf = geneFeatures.get(0);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 2);
     assertEquals(sf.getEnd(), 2);
     assertEquals(sf.getScore(), 0f);
-    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 4.0e-03,
-            DELTA);
+    assertEquals(sf.getValue("AF"), "4.0e-03");
+    assertEquals(sf.getValue("AF_AFR"), "2.3e-4");
     assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,C");
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
+    assertEquals(sf.getValue("POS"), "45051611");
+    assertEquals(sf.getValue("ID"), "rs384765");
+    assertEquals(sf.getValue("QUAL"), "1666.64");
+    assertEquals(sf.getValue("FILTER"), "RF;XYZ");
+    // malformed integer for AC_Female is ignored (JAL-3375)
+    assertNull(sf.getValue("AC_Female"));
+
     sf = geneFeatures.get(1);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 2);
     assertEquals(sf.getEnd(), 2);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
     assertEquals(sf.getScore(), 0f);
     assertEquals(Float.parseFloat((String) sf.getValue("AF")), 5.0e-03,
             DELTA);
+    assertEquals(sf.getValue("AC_Female"), "12");
+    // malformed float for AF_AFR is ignored (JAL-3375)
+    assertNull(sf.getValue("AC_AFR"));
     assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,T");
 
     sf = geneFeatures.get(2);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 4);
     assertEquals(sf.getEnd(), 4);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
     assertEquals(sf.getScore(), 0f);
     assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
             DELTA);
@@ -133,23 +163,35 @@ public class VCFLoaderTest
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 4);
     assertEquals(sf.getEnd(), 4);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
     assertEquals(sf.getScore(), 0f);
     assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
             DELTA);
     assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
+    assertNull(sf.getValue("ID")); // '.' is ignored
+    assertNull(sf.getValue("FILTER")); // '.' is ignored
+
+    sf = geneFeatures.get(4);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 6);
+    assertEquals(sf.getEnd(), 6);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 0f);
+    // AF=. should not have been captured
+    assertNull(sf.getValue("AF"));
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
 
     /*
      * verify variant feature(s) added to transcript
      */
     List<SequenceFeature> transcriptFeatures = al.getSequenceAt(1)
             .getSequenceFeatures();
-    assertEquals(transcriptFeatures.size(), 2);
+    assertEquals(transcriptFeatures.size(), 3);
     sf = transcriptFeatures.get(0);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 2);
     assertEquals(sf.getEnd(), 2);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
     assertEquals(sf.getScore(), 0f);
     assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
             DELTA);
@@ -158,7 +200,7 @@ public class VCFLoaderTest
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 2);
     assertEquals(sf.getEnd(), 2);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
     assertEquals(sf.getScore(), 0f);
     assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
             DELTA);
@@ -168,7 +210,7 @@ public class VCFLoaderTest
      * verify SNP variant feature(s) computed and added to protein
      * first codon AGC varies to ACC giving S/T
      */
-    DBRefEntry[] dbRefs = al.getSequenceAt(1).getDBRefs();
+    List<DBRefEntry> dbRefs = al.getSequenceAt(1).getDBRefs();
     SequenceI peptide = null;
     for (DBRefEntry dbref : dbRefs)
     {
@@ -178,16 +220,14 @@ public class VCFLoaderTest
       }
     }
     List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
-    assertEquals(proteinFeatures.size(), 1);
-    sf = proteinFeatures.get(0);
-    assertEquals(sf.getFeatureGroup(), "VCF");
-    assertEquals(sf.getBegin(), 1);
-    assertEquals(sf.getEnd(), 1);
-    assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
-    assertEquals(sf.getDescription(), "p.Ser1Thr");
+
+    /*
+     * JAL-3187 don't precompute protein features, do dynamically instead
+     */
+    assertTrue(proteinFeatures.isEmpty());
   }
 
-  private File makeVcf() throws IOException
+  private File makeVcfFile() throws IOException
   {
     File f = File.createTempFile("Test", ".vcf");
     f.deleteOnExit();
@@ -218,8 +258,8 @@ public class VCFLoaderTest
     SequenceI gene1 = alignment.findName("gene1");
     int[] to = new int[] { 45051610, 45051634 };
     int[] from = new int[] { gene1.getStart(), gene1.getEnd() };
-    gene1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
-            1, 1));
+    gene1.setGeneLoci("homo_sapiens", "GRCh38", "17",
+            new MapList(from, to, 1, 1));
 
     /*
      * map 'transcript1' to chromosome via 'gene1'
@@ -229,9 +269,8 @@ public class VCFLoaderTest
     to = new int[] { 45051612, 45051619, 45051624, 45051633 };
     SequenceI transcript1 = alignment.findName("transcript1");
     from = new int[] { transcript1.getStart(), transcript1.getEnd() };
-    transcript1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
-            from, to,
-            1, 1));
+    transcript1.setGeneLoci("homo_sapiens", "GRCh38", "17",
+            new MapList(from, to, 1, 1));
 
     /*
      * map gene2 to chromosome reverse strand
@@ -239,8 +278,8 @@ public class VCFLoaderTest
     SequenceI gene2 = alignment.findName("gene2");
     to = new int[] { 45051634, 45051610 };
     from = new int[] { gene2.getStart(), gene2.getEnd() };
-    gene2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
-            1, 1));
+    gene2.setGeneLoci("homo_sapiens", "GRCh38", "17",
+            new MapList(from, to, 1, 1));
 
     /*
      * map 'transcript2' to chromosome via 'gene2'
@@ -250,9 +289,8 @@ public class VCFLoaderTest
     to = new int[] { 45051633, 45051624, 45051619, 45051612 };
     SequenceI transcript2 = alignment.findName("transcript2");
     from = new int[] { transcript2.getStart(), transcript2.getEnd() };
-    transcript2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
-            from, to,
-            1, 1));
+    transcript2.setGeneLoci("homo_sapiens", "GRCh38", "17",
+            new MapList(from, to, 1, 1));
 
     /*
      * add a protein product as a DBRef on transcript1
@@ -279,8 +317,8 @@ public class VCFLoaderTest
     SequenceI gene3 = alignment.findName("gene3");
     to = new int[] { 45051610, 45051634 };
     from = new int[] { gene3.getStart(), gene3.getEnd() };
-    gene3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(from, to,
-            1, 1));
+    gene3.setGeneLoci("homo_sapiens", "GRCh38", "5",
+            new MapList(from, to, 1, 1));
 
     /*
      * map 'transcript3' to chromosome
@@ -288,9 +326,8 @@ public class VCFLoaderTest
     SequenceI transcript3 = alignment.findName("transcript3");
     to = new int[] { 45051612, 45051619, 45051624, 45051633 };
     from = new int[] { transcript3.getStart(), transcript3.getEnd() };
-    transcript3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
-            from, to,
-            1, 1));
+    transcript3.setGeneLoci("homo_sapiens", "GRCh38", "5",
+            new MapList(from, to, 1, 1));
 
     /*
      * map 'transcript4' to chromosome
@@ -299,9 +336,8 @@ public class VCFLoaderTest
     to = new int[] { 45051615, 45051617, 45051619, 45051632, 45051634,
         45051634 };
     from = new int[] { transcript4.getStart(), transcript4.getEnd() };
-    transcript4.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
-            from, to,
-            1, 1));
+    transcript4.setGeneLoci("homo_sapiens", "GRCh38", "5",
+            new MapList(from, to, 1, 1));
 
     /*
      * add a protein product as a DBRef on transcript3
@@ -327,7 +363,7 @@ public class VCFLoaderTest
   {
     AlignmentI al = buildAlignment();
 
-    File f = makeVcf();
+    File f = makeVcfFile();
 
     VCFLoader loader = new VCFLoader(f.getPath());
 
@@ -340,102 +376,103 @@ public class VCFLoaderTest
     List<SequenceFeature> geneFeatures = al.getSequenceAt(2)
             .getSequenceFeatures();
     SequenceFeatures.sortFeatures(geneFeatures, true);
-    assertEquals(geneFeatures.size(), 4);
+    assertEquals(geneFeatures.size(), 5);
+    SequenceFeature sf;
 
     /*
-     * variant A/T at 45051611 maps to T/A at gene position 24
+     * insertion G/GA at 45051613 maps to an insertion at
+     * the preceding position (21) on reverse strand gene
+     * reference: CAAGC -> GCTTG/21-25
+     * genomic variant: CAAGAC (G/GA)
+     * gene variant: GTCTTG (G/GT at 21)
      */
-    SequenceFeature sf = geneFeatures.get(3);
+    sf = geneFeatures.get(1);
     assertEquals(sf.getFeatureGroup(), "VCF");
-    assertEquals(sf.getBegin(), 24);
-    assertEquals(sf.getEnd(), 24);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getBegin(), 21);
+    assertEquals(sf.getEnd(), 21);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
     assertEquals(sf.getScore(), 0f);
-    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 5.0e-03,
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
             DELTA);
-    assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,A");
 
     /*
-     * variant A/C at 45051611 maps to T/G at gene position 24
+     * variant G/C at 45051613 maps to C/G at gene position 22
      */
     sf = geneFeatures.get(2);
     assertEquals(sf.getFeatureGroup(), "VCF");
-    assertEquals(sf.getBegin(), 24);
-    assertEquals(sf.getEnd(), 24);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getBegin(), 22);
+    assertEquals(sf.getEnd(), 22);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
     assertEquals(sf.getScore(), 0f);
-    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 4.0e-03,
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
             DELTA);
-    assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,G");
 
     /*
-     * variant G/C at 45051613 maps to C/G at gene position 22
+     * variant A/C at 45051611 maps to T/G at gene position 24
      */
-    sf = geneFeatures.get(1);
+    sf = geneFeatures.get(3);
     assertEquals(sf.getFeatureGroup(), "VCF");
-    assertEquals(sf.getBegin(), 22);
-    assertEquals(sf.getEnd(), 22);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getBegin(), 24);
+    assertEquals(sf.getEnd(), 24);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
     assertEquals(sf.getScore(), 0f);
-    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,G");
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 4.0e-03,
             DELTA);
-    assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
 
     /*
-     * insertion G/GA at 45051613 maps to an insertion at
-     * the preceding position (21) on reverse strand gene
-     * reference: CAAGC -> GCTTG/21-25
-     * genomic variant: CAAGAC (G/GA)
-     * gene variant: GTCTTG (G/GT at 21)
+     * variant A/T at 45051611 maps to T/A at gene position 24
      */
-    sf = geneFeatures.get(0);
+    sf = geneFeatures.get(4);
     assertEquals(sf.getFeatureGroup(), "VCF");
-    assertEquals(sf.getBegin(), 21);
-    assertEquals(sf.getEnd(), 21);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getBegin(), 24);
+    assertEquals(sf.getEnd(), 24);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
     assertEquals(sf.getScore(), 0f);
-    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,A");
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 5.0e-03,
             DELTA);
-    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
 
     /*
-     * verify 2 variant features added to transcript2
+     * verify 3 variant features added to transcript2
      */
     List<SequenceFeature> transcriptFeatures = al.getSequenceAt(3)
             .getSequenceFeatures();
-    assertEquals(transcriptFeatures.size(), 2);
+    assertEquals(transcriptFeatures.size(), 3);
 
     /*
      * insertion G/GT at position 21 of gene maps to position 16 of transcript
      */
-    sf = transcriptFeatures.get(0);
+    sf = transcriptFeatures.get(1);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 16);
     assertEquals(sf.getEnd(), 16);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
     assertEquals(sf.getScore(), 0f);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
     assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
             DELTA);
-    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
 
     /*
      * SNP C/G at position 22 of gene maps to position 17 of transcript
      */
-    sf = transcriptFeatures.get(1);
+    sf = transcriptFeatures.get(2);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 17);
     assertEquals(sf.getEnd(), 17);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
     assertEquals(sf.getScore(), 0f);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
     assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
             DELTA);
-    assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
 
     /*
      * verify variant feature(s) computed and added to protein
      * last codon GCT varies to GGT giving A/G in the last peptide position
      */
-    DBRefEntry[] dbRefs = al.getSequenceAt(3).getDBRefs();
+    List<DBRefEntry> dbRefs = al.getSequenceAt(3).getDBRefs();
     SequenceI peptide = null;
     for (DBRefEntry dbref : dbRefs)
     {
@@ -445,13 +482,11 @@ public class VCFLoaderTest
       }
     }
     List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
-    assertEquals(proteinFeatures.size(), 1);
-    sf = proteinFeatures.get(0);
-    assertEquals(sf.getFeatureGroup(), "VCF");
-    assertEquals(sf.getBegin(), 6);
-    assertEquals(sf.getEnd(), 6);
-    assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
-    assertEquals(sf.getDescription(), "p.Ala6Gly");
+
+    /*
+     * JAL-3187 don't precompute protein features, do dynamically instead
+     */
+    assertTrue(proteinFeatures.isEmpty());
   }
 
   /**
@@ -494,6 +529,7 @@ public class VCFLoaderTest
     // gene features include Consequence for all transcripts
     Map map = (Map) sf.getValue("CSQ");
     assertEquals(map.size(), 9);
+    assertEquals(map.get("PolyPhen"), "Bad");
 
     sf = geneFeatures.get(1);
     assertEquals(sf.getBegin(), 5);
@@ -503,6 +539,7 @@ public class VCFLoaderTest
     assertEquals(sf.getValue("alleles"), "C,T");
     map = (Map) sf.getValue("CSQ");
     assertEquals(map.size(), 9);
+    assertEquals(map.get("PolyPhen"), "Bad;;"); // %3B%3B decoded
 
     sf = geneFeatures.get(2);
     assertEquals(sf.getBegin(), 9);
@@ -595,7 +632,7 @@ public class VCFLoaderTest
      * and GAG/GGG which is E/G in position 4
      * the insertion variant is not transferred to the peptide
      */
-    DBRefEntry[] dbRefs = al.findName("transcript3").getDBRefs();
+    List<DBRefEntry> dbRefs = al.findName("transcript3").getDBRefs();
     SequenceI peptide = null;
     for (DBRefEntry dbref : dbRefs)
     {
@@ -605,20 +642,24 @@ public class VCFLoaderTest
       }
     }
     List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
-    SequenceFeatures.sortFeatures(proteinFeatures, true);
-    assertEquals(proteinFeatures.size(), 2);
-    sf = proteinFeatures.get(0);
-    assertEquals(sf.getFeatureGroup(), "VCF");
-    assertEquals(sf.getBegin(), 1);
-    assertEquals(sf.getEnd(), 1);
-    assertEquals(sf.getType(), SequenceOntologyI.SYNONYMOUS_VARIANT);
-    assertEquals(sf.getDescription(), "agC/agT");
-    sf = proteinFeatures.get(1);
-    assertEquals(sf.getFeatureGroup(), "VCF");
-    assertEquals(sf.getBegin(), 4);
-    assertEquals(sf.getEnd(), 4);
-    assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
-    assertEquals(sf.getDescription(), "p.Glu4Gly");
+    /*
+     * JAL-3187 don't precompute protein features, do dynamically instead
+     */
+    assertTrue(proteinFeatures.isEmpty());
+    // SequenceFeatures.sortFeatures(proteinFeatures, true);
+    // assertEquals(proteinFeatures.size(), 2);
+    // sf = proteinFeatures.get(0);
+    // assertEquals(sf.getFeatureGroup(), "VCF");
+    // assertEquals(sf.getBegin(), 1);
+    // assertEquals(sf.getEnd(), 1);
+    // assertEquals(sf.getType(), SequenceOntologyI.SYNONYMOUS_VARIANT);
+    // assertEquals(sf.getDescription(), "agC/agT");
+    // sf = proteinFeatures.get(1);
+    // assertEquals(sf.getFeatureGroup(), "VCF");
+    // assertEquals(sf.getBegin(), 4);
+    // assertEquals(sf.getEnd(), 4);
+    // assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
+    // assertEquals(sf.getDescription(), "p.Glu4Gly");
 
     /*
      * verify variant feature(s) added to transcript4
@@ -673,8 +714,7 @@ public class VCFLoaderTest
   @Test(groups = "Functional")
   public void testLoadVCFContig() throws IOException
   {
-    VCFLoader loader = new VCFLoader(
-            "test/jalview/io/vcf/testVcf2.vcf");
+    VCFLoader loader = new VCFLoader("test/jalview/io/vcf/testVcf2.vcf");
 
     SequenceI seq = loader.loadVCFContig("contig123");
     assertEquals(seq.getLength(), 15);