X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=test%2Fjalview%2Futil%2FMappingUtilsTest.java;h=1420cee681e7823c82fd0907cda7a894f63b0a5a;hb=cb8e52fbbc5f725e3f7f48c672cdddb0690bd978;hp=cfb256337964205aba9054b9771636c1c974201b;hpb=df140c55ea500ff056e0602de542c13515ed1b55;p=jalview.git diff --git a/test/jalview/util/MappingUtilsTest.java b/test/jalview/util/MappingUtilsTest.java index cfb2563..1420cee 100644 --- a/test/jalview/util/MappingUtilsTest.java +++ b/test/jalview/util/MappingUtilsTest.java @@ -22,9 +22,10 @@ package jalview.util; import static org.testng.AssertJUnit.assertEquals; import static org.testng.AssertJUnit.assertFalse; +import static org.testng.AssertJUnit.assertNull; import static org.testng.AssertJUnit.assertSame; import static org.testng.AssertJUnit.assertTrue; -import static org.testng.AssertJUnit.fail; +import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals; import java.awt.Color; import java.io.IOException; @@ -37,7 +38,7 @@ import org.testng.annotations.BeforeClass; import org.testng.annotations.Test; import jalview.api.AlignViewportI; -import jalview.bin.Cache; +import jalview.bin.Console; import jalview.commands.EditCommand; import jalview.commands.EditCommand.Action; import jalview.commands.EditCommand.Edit; @@ -63,9 +64,8 @@ public class MappingUtilsTest @BeforeClass(alwaysRun = true) public void setUp() { - Cache.initLogger(); + Console.initLogger(); } - @BeforeClass(alwaysRun = true) public void setUpJvOptionPane() @@ -97,8 +97,9 @@ public class MappingUtilsTest MapList map = new MapList(new int[] { 5, 10 }, new int[] { 12, 13 }, 3, 1); acf.addMap(seq1.getDatasetSequence(), aseq1.getDatasetSequence(), map); - List acfList = Arrays.asList(new AlignedCodonFrame[] - { acf }); + List acfList = Arrays + .asList(new AlignedCodonFrame[] + { acf }); /* * Check protein residue 12 maps to codon 5-7, 13 to codon 8-10 @@ -147,11 +148,14 @@ public class MappingUtilsTest * Map dna bases [6, 8, 9], [11, 13, 115] to protein residues 8 and 9 */ AlignedCodonFrame acf = new AlignedCodonFrame(); - MapList map = new MapList(new int[] { 6, 6, 8, 9, 11, 11, 13, 13, 15, - 15 }, new int[] { 8, 9 }, 3, 1); + MapList map = new MapList( + new int[] + { 6, 6, 8, 9, 11, 11, 13, 13, 15, 15 }, new int[] { 8, 9 }, 3, + 1); acf.addMap(seq1.getDatasetSequence(), aseq1.getDatasetSequence(), map); - List acfList = Arrays.asList(new AlignedCodonFrame[] - { acf }); + List acfList = Arrays + .asList(new AlignedCodonFrame[] + { acf }); /* * Check protein residue 8 maps to [6, 8, 9] @@ -191,8 +195,8 @@ public class MappingUtilsTest for (int i = 5; i < 18; i++) { sr = MappingUtils.buildSearchResults(seq1, i, acfList); - int residue = (i == 6 || i == 8 || i == 9) ? 8 : (i == 11 || i == 13 - || i == 15 ? 9 : 0); + int residue = (i == 6 || i == 8 || i == 9) ? 8 + : (i == 11 || i == 13 || i == 15 ? 9 : 0); if (residue == 0) { assertEquals(0, sr.getResults().size()); @@ -228,18 +232,19 @@ public class MappingUtilsTest MapList map = new MapList(new int[] { 1, 3 }, new int[] { 1, 1 }, 3, 1); for (int seq = 0; seq < 3; seq++) { - acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(), protein - .getSequenceAt(seq).getDatasetSequence(), map); + acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(), + protein.getSequenceAt(seq).getDatasetSequence(), map); } - List acfList = Arrays.asList(new AlignedCodonFrame[] - { acf }); + List acfList = Arrays + .asList(new AlignedCodonFrame[] + { acf }); AlignViewportI dnaView = new AlignViewport(cdna); AlignViewportI proteinView = new AlignViewport(protein); protein.setCodonFrames(acfList); /* - * Select Seq1 and Seq3 in the protein (startRes=endRes=0) + * Select Seq1 and Seq3 in the protein */ SequenceGroup sg = new SequenceGroup(); sg.setColourText(true); @@ -247,6 +252,7 @@ public class MappingUtilsTest sg.setOutlineColour(Color.LIGHT_GRAY); sg.addSequence(protein.getSequenceAt(0), false); sg.addSequence(protein.getSequenceAt(2), false); + sg.setEndRes(protein.getWidth() - 1); /* * Verify the mapped sequence group in dna @@ -260,7 +266,7 @@ public class MappingUtilsTest assertSame(cdna.getSequenceAt(0), mappedGroup.getSequences().get(0)); assertSame(cdna.getSequenceAt(2), mappedGroup.getSequences().get(1)); assertEquals(0, mappedGroup.getStartRes()); - assertEquals(2, mappedGroup.getEndRes()); + assertEquals(2, mappedGroup.getEndRes()); // 3 columns (1 codon) /* * Verify mapping sequence group from dna to protein @@ -293,8 +299,8 @@ public class MappingUtilsTest protected AlignmentI loadAlignment(final String data, FileFormatI format) throws IOException { - AlignmentI a = new FormatAdapter().readFile(data, - DataSourceType.PASTE, format); + AlignmentI a = new FormatAdapter().readFile(data, DataSourceType.PASTE, + format); a.setDataset(null); return a; } @@ -339,8 +345,8 @@ public class MappingUtilsTest cs.clear(); colsel.clear(); colsel.addElement(2); - MappingUtils.mapColumnSelection(colsel, hidden, proteinView, - dnaView, cs, hs); + MappingUtils.mapColumnSelection(colsel, hidden, proteinView, dnaView, + cs, hs); assertEquals("[]", cs.getSelected().toString()); /* @@ -350,8 +356,8 @@ public class MappingUtilsTest cs.clear(); colsel.clear(); colsel.addElement(3); - MappingUtils.mapColumnSelection(colsel, hidden, proteinView, - dnaView, cs, hs); + MappingUtils.mapColumnSelection(colsel, hidden, proteinView, dnaView, + cs, hs); assertEquals("[5, 6, 7, 8, 9, 10]", cs.getSelected().toString()); /* @@ -362,10 +368,10 @@ public class MappingUtilsTest colsel.clear(); colsel.addElement(1); colsel.addElement(3); - MappingUtils.mapColumnSelection(colsel, hidden, proteinView, - dnaView, cs, hs); - assertEquals("[0, 1, 2, 3, 5, 6, 7, 8, 9, 10]", cs.getSelected() - .toString()); + MappingUtils.mapColumnSelection(colsel, hidden, proteinView, dnaView, + cs, hs); + assertEquals("[0, 1, 2, 3, 5, 6, 7, 8, 9, 10]", + cs.getSelected().toString()); } /** @@ -394,23 +400,27 @@ public class MappingUtilsTest // map first dna to first protein seq AlignedCodonFrame acf = new AlignedCodonFrame(); MapList map = new MapList(new int[] { 10, 12, 15, 15, 17, 18 }, - new int[] { 40, 41 }, 3, 1); - acf.addMap(cdna.getSequenceAt(0).getDatasetSequence(), protein - .getSequenceAt(0).getDatasetSequence(), map); + new int[] + { 40, 41 }, 3, 1); + acf.addMap(cdna.getSequenceAt(0).getDatasetSequence(), + protein.getSequenceAt(0).getDatasetSequence(), map); // map second dna to second protein seq - map = new MapList(new int[] { 20, 20, 22, 23, 24, 26 }, new int[] { 50, - 51 }, 3, 1); - acf.addMap(cdna.getSequenceAt(1).getDatasetSequence(), protein - .getSequenceAt(1).getDatasetSequence(), map); + map = new MapList(new int[] { 20, 20, 22, 23, 24, 26 }, + new int[] + { 50, 51 }, 3, 1); + acf.addMap(cdna.getSequenceAt(1).getDatasetSequence(), + protein.getSequenceAt(1).getDatasetSequence(), map); // map third dna to third protein seq - map = new MapList(new int[] { 30, 30, 32, 34, 36, 37 }, new int[] { 60, - 61 }, 3, 1); - acf.addMap(cdna.getSequenceAt(2).getDatasetSequence(), protein - .getSequenceAt(2).getDatasetSequence(), map); - List acfList = Arrays.asList(new AlignedCodonFrame[] - { acf }); + map = new MapList(new int[] { 30, 30, 32, 34, 36, 37 }, + new int[] + { 60, 61 }, 3, 1); + acf.addMap(cdna.getSequenceAt(2).getDatasetSequence(), + protein.getSequenceAt(2).getDatasetSequence(), map); + List acfList = Arrays + .asList(new AlignedCodonFrame[] + { acf }); dnaView = new AlignViewport(cdna); proteinView = new AlignViewport(protein); @@ -473,24 +483,21 @@ public class MappingUtilsTest public void testFlattenRanges() { assertEquals("[1, 2, 3, 4]", - Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 4 }))); - assertEquals( - "[1, 2, 3, 4]", - Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 2, 3, - 4 }))); - assertEquals( - "[1, 2, 3, 4]", - Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 1, 2, - 2, 3, 3, 4, 4 }))); - assertEquals( - "[1, 2, 3, 4, 7, 8, 9, 12]", - Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 4, 7, - 9, 12, 12 }))); + Arrays.toString(MappingUtils.flattenRanges(new int[] + { 1, 4 }))); + assertEquals("[1, 2, 3, 4]", + Arrays.toString(MappingUtils.flattenRanges(new int[] + { 1, 2, 3, 4 }))); + assertEquals("[1, 2, 3, 4]", + Arrays.toString(MappingUtils.flattenRanges(new int[] + { 1, 1, 2, 2, 3, 3, 4, 4 }))); + assertEquals("[1, 2, 3, 4, 7, 8, 9, 12]", + Arrays.toString(MappingUtils.flattenRanges(new int[] + { 1, 4, 7, 9, 12, 12 }))); // trailing unpaired start position is ignored: - assertEquals( - "[1, 2, 3, 4, 7, 8, 9, 12]", - Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 4, 7, - 9, 12, 12, 15 }))); + assertEquals("[1, 2, 3, 4, 7, 8, 9, 12]", + Arrays.toString(MappingUtils.flattenRanges(new int[] + { 1, 4, 7, 9, 12, 12, 15 }))); } /** @@ -516,11 +523,12 @@ public class MappingUtilsTest MapList map = new MapList(new int[] { 1, 6 }, new int[] { 1, 2 }, 3, 1); for (int seq = 0; seq < 3; seq++) { - acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(), protein - .getSequenceAt(seq).getDatasetSequence(), map); + acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(), + protein.getSequenceAt(seq).getDatasetSequence(), map); } - List acfList = Arrays.asList(new AlignedCodonFrame[] - { acf }); + List acfList = Arrays + .asList(new AlignedCodonFrame[] + { acf }); AlignViewportI dnaView = new AlignViewport(cdna); AlignViewportI proteinView = new AlignViewport(protein); @@ -593,17 +601,19 @@ public class MappingUtilsTest FileFormat.Fasta); cdna.setDataset(null); AlignmentI protein = loadAlignment( - ">Seq1\n-KA-S\n>Seq2\n--L-QY\n>Seq3\nQ-V-M\n", FileFormat.Fasta); + ">Seq1\n-KA-S\n>Seq2\n--L-QY\n>Seq3\nQ-V-M\n", + FileFormat.Fasta); protein.setDataset(null); AlignedCodonFrame acf = new AlignedCodonFrame(); MapList map = new MapList(new int[] { 1, 9 }, new int[] { 1, 3 }, 3, 1); for (int seq = 0; seq < 3; seq++) { - acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(), protein - .getSequenceAt(seq).getDatasetSequence(), map); + acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(), + protein.getSequenceAt(seq).getDatasetSequence(), map); } - List acfList = Arrays.asList(new AlignedCodonFrame[] - { acf }); + List acfList = Arrays + .asList(new AlignedCodonFrame[] + { acf }); AlignViewportI dnaView = new AlignViewport(cdna); AlignViewportI proteinView = new AlignViewport(protein); @@ -706,8 +716,8 @@ public class MappingUtilsTest /* * Seq1 has three mappings */ - List result = MappingUtils.findMappingsForSequence( - seq1, mappings); + List result = MappingUtils + .findMappingsForSequence(seq1, mappings); assertEquals(3, result.size()); assertTrue(result.contains(acf1)); assertTrue(result.contains(acf2)); @@ -784,22 +794,22 @@ public class MappingUtilsTest */ List result = MappingUtils .findMappingsForSequenceAndOthers(null, mappings, - Arrays.asList(new SequenceI[] { seq1, seq2 })); + Arrays.asList(new SequenceI[] + { seq1, seq2 })); assertTrue(result.isEmpty()); result = MappingUtils.findMappingsForSequenceAndOthers(seq1, null, - Arrays.asList(new SequenceI[] { seq1, seq2 })); + Arrays.asList(new SequenceI[] + { seq1, seq2 })); assertTrue(result.isEmpty()); /* * Seq1 has three mappings, but filter argument will only accept * those to seq2 */ - result = MappingUtils.findMappingsForSequenceAndOthers( - seq1, - mappings, - Arrays.asList(new SequenceI[] { seq1, seq2, - seq1.getDatasetSequence() })); + result = MappingUtils.findMappingsForSequenceAndOthers(seq1, mappings, + Arrays.asList(new SequenceI[] + { seq1, seq2, seq1.getDatasetSequence() })); assertEquals(2, result.size()); assertTrue(result.contains(acf1)); assertTrue(result.contains(acf2)); @@ -828,7 +838,8 @@ public class MappingUtilsTest dna.createDatasetSequence(); protein.createDatasetSequence(); AlignedCodonFrame acf = new AlignedCodonFrame(); - MapList map = new MapList(new int[] { 8, 16 }, new int[] { 5, 7 }, 3, 1); + MapList map = new MapList(new int[] { 8, 16 }, new int[] { 5, 7 }, 3, + 1); acf.addMap(dna.getDatasetSequence(), protein.getDatasetSequence(), map); List mappings = new ArrayList<>(); mappings.add(acf); @@ -843,7 +854,8 @@ public class MappingUtilsTest */ EditCommand ec = new EditCommand(); final Edit edit = ec.new Edit(Action.INSERT_GAP, - new SequenceI[] { protein }, 4, 2, '-'); + new SequenceI[] + { protein }, 4, 2, '-'); ec.appendEdit(edit, prot, true, null); /* @@ -869,34 +881,29 @@ public class MappingUtilsTest public void testFlattenRanges_reverseStrand() { assertEquals("[4, 3, 2, 1]", - Arrays.toString(MappingUtils.flattenRanges(new int[] { 4, 1 }))); - assertEquals( - "[4, 3, 2, 1]", - Arrays.toString(MappingUtils.flattenRanges(new int[] { 4, 3, 2, - 1 }))); - assertEquals( - "[4, 3, 2, 1]", - Arrays.toString(MappingUtils.flattenRanges(new int[] { 4, 4, 3, - 3, 2, 2, 1, 1 }))); - assertEquals( - "[12, 9, 8, 7, 4, 3, 2, 1]", - Arrays.toString(MappingUtils.flattenRanges(new int[] { 12, 12, - 9, 7, 4, 1 }))); + Arrays.toString(MappingUtils.flattenRanges(new int[] + { 4, 1 }))); + assertEquals("[4, 3, 2, 1]", + Arrays.toString(MappingUtils.flattenRanges(new int[] + { 4, 3, 2, 1 }))); + assertEquals("[4, 3, 2, 1]", + Arrays.toString(MappingUtils.flattenRanges(new int[] + { 4, 4, 3, 3, 2, 2, 1, 1 }))); + assertEquals("[12, 9, 8, 7, 4, 3, 2, 1]", + Arrays.toString(MappingUtils.flattenRanges(new int[] + { 12, 12, 9, 7, 4, 1 }))); // forwards and backwards anyone? - assertEquals( - "[4, 5, 6, 3, 2, 1]", - Arrays.toString(MappingUtils.flattenRanges(new int[] { 4, 6, 3, - 1 }))); + assertEquals("[4, 5, 6, 3, 2, 1]", + Arrays.toString(MappingUtils.flattenRanges(new int[] + { 4, 6, 3, 1 }))); // backwards and forwards - assertEquals( - "[3, 2, 1, 4, 5, 6]", - Arrays.toString(MappingUtils.flattenRanges(new int[] { 3, 1, 4, - 6 }))); + assertEquals("[3, 2, 1, 4, 5, 6]", + Arrays.toString(MappingUtils.flattenRanges(new int[] + { 3, 1, 4, 6 }))); // trailing unpaired start position is ignored: - assertEquals( - "[12, 9, 8, 7, 4, 3, 2]", - Arrays.toString(MappingUtils.flattenRanges(new int[] { 12, 12, - 9, 7, 4, 2, 1 }))); + assertEquals("[12, 9, 8, 7, 4, 3, 2]", + Arrays.toString(MappingUtils.flattenRanges(new int[] + { 12, 12, 9, 7, 4, 2, 1 }))); } /** @@ -1164,85 +1171,115 @@ public class MappingUtilsTest /* * both forward ranges */ - assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { - 1, 10 })); - assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { - 2, 10 })); - assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { - 1, 9 })); - assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { - 4, 5 })); - assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { - 0, 9 })); - assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { - -10, -9 })); - assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { - 1, 11 })); - assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { - 11, 12 })); + assertTrue( + MappingUtils.rangeContains(new int[] + { 1, 10 }, new int[] { 1, 10 })); + assertTrue( + MappingUtils.rangeContains(new int[] + { 1, 10 }, new int[] { 2, 10 })); + assertTrue( + MappingUtils.rangeContains(new int[] + { 1, 10 }, new int[] { 1, 9 })); + assertTrue( + MappingUtils.rangeContains(new int[] + { 1, 10 }, new int[] { 4, 5 })); + assertFalse( + MappingUtils.rangeContains(new int[] + { 1, 10 }, new int[] { 0, 9 })); + assertFalse( + MappingUtils.rangeContains(new int[] + { 1, 10 }, new int[] { -10, -9 })); + assertFalse( + MappingUtils.rangeContains(new int[] + { 1, 10 }, new int[] { 1, 11 })); + assertFalse( + MappingUtils.rangeContains(new int[] + { 1, 10 }, new int[] { 11, 12 })); /* * forward range, reverse query */ - assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { - 10, 1 })); - assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { - 9, 1 })); - assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { - 10, 2 })); - assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { - 5, 5 })); - assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { - 11, 1 })); - assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { - 10, 0 })); + assertTrue( + MappingUtils.rangeContains(new int[] + { 1, 10 }, new int[] { 10, 1 })); + assertTrue( + MappingUtils.rangeContains(new int[] + { 1, 10 }, new int[] { 9, 1 })); + assertTrue( + MappingUtils.rangeContains(new int[] + { 1, 10 }, new int[] { 10, 2 })); + assertTrue( + MappingUtils.rangeContains(new int[] + { 1, 10 }, new int[] { 5, 5 })); + assertFalse( + MappingUtils.rangeContains(new int[] + { 1, 10 }, new int[] { 11, 1 })); + assertFalse( + MappingUtils.rangeContains(new int[] + { 1, 10 }, new int[] { 10, 0 })); /* * reverse range, forward query */ - assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { - 1, 10 })); - assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { - 1, 9 })); - assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { - 2, 10 })); - assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { - 6, 6 })); - assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { - 6, 11 })); - assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { - 11, 20 })); - assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { - -3, -2 })); + assertTrue( + MappingUtils.rangeContains(new int[] + { 10, 1 }, new int[] { 1, 10 })); + assertTrue( + MappingUtils.rangeContains(new int[] + { 10, 1 }, new int[] { 1, 9 })); + assertTrue( + MappingUtils.rangeContains(new int[] + { 10, 1 }, new int[] { 2, 10 })); + assertTrue( + MappingUtils.rangeContains(new int[] + { 10, 1 }, new int[] { 6, 6 })); + assertFalse( + MappingUtils.rangeContains(new int[] + { 10, 1 }, new int[] { 6, 11 })); + assertFalse( + MappingUtils.rangeContains(new int[] + { 10, 1 }, new int[] { 11, 20 })); + assertFalse( + MappingUtils.rangeContains(new int[] + { 10, 1 }, new int[] { -3, -2 })); /* * both reverse */ - assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { - 10, 1 })); - assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { - 9, 1 })); - assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { - 10, 2 })); - assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { - 3, 3 })); - assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { - 11, 1 })); - assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { - 10, 0 })); - assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { - 12, 11 })); - assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { - -5, -8 })); + assertTrue( + MappingUtils.rangeContains(new int[] + { 10, 1 }, new int[] { 10, 1 })); + assertTrue( + MappingUtils.rangeContains(new int[] + { 10, 1 }, new int[] { 9, 1 })); + assertTrue( + MappingUtils.rangeContains(new int[] + { 10, 1 }, new int[] { 10, 2 })); + assertTrue( + MappingUtils.rangeContains(new int[] + { 10, 1 }, new int[] { 3, 3 })); + assertFalse( + MappingUtils.rangeContains(new int[] + { 10, 1 }, new int[] { 11, 1 })); + assertFalse( + MappingUtils.rangeContains(new int[] + { 10, 1 }, new int[] { 10, 0 })); + assertFalse( + MappingUtils.rangeContains(new int[] + { 10, 1 }, new int[] { 12, 11 })); + assertFalse( + MappingUtils.rangeContains(new int[] + { 10, 1 }, new int[] { -5, -8 })); /* * bad arguments */ - assertFalse(MappingUtils.rangeContains(new int[] { 1, 10, 12 }, - new int[] { - 1, 10 })); - assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, - new int[] { 1 })); + assertFalse( + MappingUtils.rangeContains(new int[] + { 1, 10, 12 }, new int[] { 1, 10 })); + assertFalse( + MappingUtils.rangeContains(new int[] + { 1, 10 }, new int[] { 1 })); assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, null)); assertFalse(MappingUtils.rangeContains(null, new int[] { 1, 10 })); } @@ -1292,33 +1329,123 @@ public class MappingUtilsTest assertEquals(1, ranges.size()); assertEquals(9, ranges.get(0)[1]); } - + @Test(groups = "Functional") - public void testListToArray() + public void testFindOverlap() { List ranges = new ArrayList<>(); - - int[] result = MappingUtils.listToArray(ranges); - assertEquals(result.length, 0); - ranges.add(new int[] {24, 12}); - result = MappingUtils.listToArray(ranges); - assertEquals(result.length, 2); - assertEquals(result[0], 24); - assertEquals(result[1], 12); - ranges.add(new int[] {-7, 30}); - result = MappingUtils.listToArray(ranges); - assertEquals(result.length, 4); - assertEquals(result[0], 24); - assertEquals(result[1], 12); - assertEquals(result[2], -7); - assertEquals(result[3], 30); - try - { - MappingUtils.listToArray(null); - fail("Expected exception"); - } catch (NullPointerException e) - { - // expected - } + ranges.add(new int[] { 4, 8 }); + ranges.add(new int[] { 10, 12 }); + ranges.add(new int[] { 16, 19 }); + + int[] overlap = MappingUtils.findOverlap(ranges, 5, 13); + assertArrayEquals(overlap, new int[] { 5, 12 }); + overlap = MappingUtils.findOverlap(ranges, -100, 100); + assertArrayEquals(overlap, new int[] { 4, 19 }); + overlap = MappingUtils.findOverlap(ranges, 7, 17); + assertArrayEquals(overlap, new int[] { 7, 17 }); + overlap = MappingUtils.findOverlap(ranges, 13, 15); + assertNull(overlap); + } + + /** + * Test mapping a sequence group where sequences in and outside the group + * share a dataset sequence (e.g. alternative CDS for the same gene) + *

+ * This scenario doesn't arise after JAL-3763 changes, but test left as still valid + * @throws IOException + */ + @Test(groups = { "Functional" }) + public void testMapSequenceGroup_sharedDataset() throws IOException + { + /* + * Set up dna and protein Seq1/2/3 with mappings (held on the protein + * viewport). CDS sequences share the same 'gene' dataset sequence. + */ + SequenceI dna = new Sequence("dna", "aaatttgggcccaaatttgggccc"); + SequenceI cds1 = new Sequence("cds1/1-6", "aaattt"); + SequenceI cds2 = new Sequence("cds1/4-9", "tttggg"); + SequenceI cds3 = new Sequence("cds1/19-24", "gggccc"); + + cds1.setDatasetSequence(dna); + cds2.setDatasetSequence(dna); + cds3.setDatasetSequence(dna); + + SequenceI pep1 = new Sequence("pep1", "KF"); + SequenceI pep2 = new Sequence("pep2", "FG"); + SequenceI pep3 = new Sequence("pep3", "GP"); + pep1.createDatasetSequence(); + pep2.createDatasetSequence(); + pep3.createDatasetSequence(); + + /* + * add mappings from coding positions of dna to respective peptides + */ + AlignedCodonFrame acf = new AlignedCodonFrame(); + acf.addMap(dna, pep1, + new MapList(new int[] + { 1, 6 }, new int[] { 1, 2 }, 3, 1)); + acf.addMap(dna, pep2, + new MapList(new int[] + { 4, 9 }, new int[] { 1, 2 }, 3, 1)); + acf.addMap(dna, pep3, + new MapList(new int[] + { 19, 24 }, new int[] { 1, 2 }, 3, 1)); + + List acfList = Arrays + .asList(new AlignedCodonFrame[] + { acf }); + + AlignmentI cdna = new Alignment(new SequenceI[] { cds1, cds2, cds3 }); + AlignmentI protein = new Alignment( + new SequenceI[] + { pep1, pep2, pep3 }); + AlignViewportI cdnaView = new AlignViewport(cdna); + AlignViewportI peptideView = new AlignViewport(protein); + protein.setCodonFrames(acfList); + + /* + * Select pep1 and pep3 in the protein alignment + */ + SequenceGroup sg = new SequenceGroup(); + sg.setColourText(true); + sg.setIdColour(Color.GREEN); + sg.setOutlineColour(Color.LIGHT_GRAY); + sg.addSequence(pep1, false); + sg.addSequence(pep3, false); + sg.setEndRes(protein.getWidth() - 1); + + /* + * Verify the mapped sequence group in dna is cds1 and cds3 + */ + SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg, + peptideView, cdnaView); + assertTrue(mappedGroup.getColourText()); + assertSame(sg.getIdColour(), mappedGroup.getIdColour()); + assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); + assertEquals(2, mappedGroup.getSequences().size()); + assertSame(cds1, mappedGroup.getSequences().get(0)); + assertSame(cds3, mappedGroup.getSequences().get(1)); + // columns 1-6 selected (0-5 base zero) + assertEquals(0, mappedGroup.getStartRes()); + assertEquals(5, mappedGroup.getEndRes()); + + /* + * Select mapping sequence group from dna to protein + */ + sg.clear(); + sg.addSequence(cds2, false); + sg.addSequence(cds1, false); + sg.setStartRes(0); + sg.setEndRes(cdna.getWidth() - 1); + mappedGroup = MappingUtils.mapSequenceGroup(sg, cdnaView, peptideView); + assertTrue(mappedGroup.getColourText()); + assertSame(sg.getIdColour(), mappedGroup.getIdColour()); + assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); + assertEquals(2, mappedGroup.getSequences().size()); + assertSame(protein.getSequenceAt(1), mappedGroup.getSequences().get(0)); + assertSame(protein.getSequenceAt(0), mappedGroup.getSequences().get(1)); + assertEquals(0, mappedGroup.getStartRes()); + assertEquals(1, mappedGroup.getEndRes()); // two columns } }