X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=test%2Fjalview%2Futil%2FMappingUtilsTest.java;h=8cb1208bc69a9710cd6f32593cad9124a82305f5;hb=279c6495df1a0de231600a2d283098c7411c4730;hp=204d80369931663706ff676f5b6fde94195b8fe1;hpb=8bcec0698d13dede379ac8079d544d2da50e106c;p=jalview.git diff --git a/test/jalview/util/MappingUtilsTest.java b/test/jalview/util/MappingUtilsTest.java index 204d803..8cb1208 100644 --- a/test/jalview/util/MappingUtilsTest.java +++ b/test/jalview/util/MappingUtilsTest.java @@ -25,7 +25,6 @@ import static org.testng.AssertJUnit.assertFalse; import static org.testng.AssertJUnit.assertNull; import static org.testng.AssertJUnit.assertSame; import static org.testng.AssertJUnit.assertTrue; -import static org.testng.AssertJUnit.fail; import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals; import java.awt.Color; @@ -39,7 +38,7 @@ import org.testng.annotations.BeforeClass; import org.testng.annotations.Test; import jalview.api.AlignViewportI; -import jalview.bin.Cache; +import jalview.bin.Console; import jalview.commands.EditCommand; import jalview.commands.EditCommand.Action; import jalview.commands.EditCommand.Edit; @@ -65,7 +64,7 @@ public class MappingUtilsTest @BeforeClass(alwaysRun = true) public void setUp() { - Cache.initLogger(); + Console.initLogger(); } @BeforeClass(alwaysRun = true) @@ -240,8 +239,8 @@ public class MappingUtilsTest .asList(new AlignedCodonFrame[] { acf }); - AlignViewportI theDnaView = new AlignViewport(cdna); - AlignViewportI theProteinView = new AlignViewport(protein); + AlignViewportI dnaView = new AlignViewport(cdna); + AlignViewportI proteinView = new AlignViewport(protein); protein.setCodonFrames(acfList); /* @@ -259,7 +258,7 @@ public class MappingUtilsTest * Verify the mapped sequence group in dna */ SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg, - theProteinView, theDnaView); + proteinView, dnaView); assertTrue(mappedGroup.getColourText()); assertSame(sg.getIdColour(), mappedGroup.getIdColour()); assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); @@ -277,8 +276,7 @@ public class MappingUtilsTest sg.addSequence(cdna.getSequenceAt(0), false); sg.setStartRes(0); sg.setEndRes(2); - mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, - theProteinView); + mappedGroup = MappingUtils.mapSequenceGroup(sg, dnaView, proteinView); assertTrue(mappedGroup.getColourText()); assertSame(sg.getIdColour(), mappedGroup.getIdColour()); assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); @@ -532,8 +530,8 @@ public class MappingUtilsTest .asList(new AlignedCodonFrame[] { acf }); - AlignViewportI theDnaView = new AlignViewport(cdna); - AlignViewportI theProteinView = new AlignViewport(protein); + AlignViewportI dnaView = new AlignViewport(cdna); + AlignViewportI proteinView = new AlignViewport(protein); protein.setCodonFrames(acfList); /* @@ -553,7 +551,7 @@ public class MappingUtilsTest * Verify the mapped sequence group in dna */ SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg, - theProteinView, theDnaView); + proteinView, dnaView); assertTrue(mappedGroup.getColourText()); assertSame(sg.getIdColour(), mappedGroup.getIdColour()); assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); @@ -574,8 +572,7 @@ public class MappingUtilsTest // select columns 2 and 3 in DNA which span protein columns 0 and 1 sg.setStartRes(2); sg.setEndRes(3); - mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, - theProteinView); + mappedGroup = MappingUtils.mapSequenceGroup(sg, dnaView, proteinView); assertTrue(mappedGroup.getColourText()); assertSame(sg.getIdColour(), mappedGroup.getIdColour()); assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); @@ -600,11 +597,11 @@ public class MappingUtilsTest * viewport). */ AlignmentI cdna = loadAlignment( - ">Cds11\nA-CG-GC--AT-CA\n>Cds2\n-TG-AC-AG-T-AT\n>Cds3\n-T--ACG-TAAT-G\n", + ">Seq1\nA-CG-GC--AT-CA\n>Seq2\n-TG-AC-AG-T-AT\n>Seq3\n-T--ACG-TAAT-G\n", FileFormat.Fasta); cdna.setDataset(null); AlignmentI protein = loadAlignment( - ">Pep1\n-KA-S\n>Pep2\n--L-QY\n>Pep3\nQ-V-M\n", + ">Seq1\n-KA-S\n>Seq2\n--L-QY\n>Seq3\nQ-V-M\n", FileFormat.Fasta); protein.setDataset(null); AlignedCodonFrame acf = new AlignedCodonFrame(); @@ -618,14 +615,15 @@ public class MappingUtilsTest .asList(new AlignedCodonFrame[] { acf }); - AlignViewportI theDnaView = new AlignViewport(cdna); - AlignViewportI theProteinView = new AlignViewport(protein); + AlignViewportI dnaView = new AlignViewport(cdna); + AlignViewportI proteinView = new AlignViewport(protein); protein.setCodonFrames(acfList); /* - * Select Pep1 and Pep2 in the protein, column 1 (K/-). Expect mapped - * sequence group to cover Cds1, columns 0-3 (ACG). Although the selection - * only includes a gap in Cds2, mapped Cds2 is included with 'no columns' + * Select Seq1 and Seq2 in the protein, column 1 (K/-). Expect mapped + * sequence group to cover Seq1, columns 0-3 (ACG). Because the selection + * only includes a gap in Seq2 there is no mappable selection region in the + * corresponding DNA. */ SequenceGroup sg = new SequenceGroup(); sg.setColourText(true); @@ -640,15 +638,14 @@ public class MappingUtilsTest * Verify the mapped sequence group in dna */ SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg, - theProteinView, theDnaView); + proteinView, dnaView); assertTrue(mappedGroup.getColourText()); assertSame(sg.getIdColour(), mappedGroup.getIdColour()); assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); - assertEquals(2, mappedGroup.getSequences().size()); + assertEquals(1, mappedGroup.getSequences().size()); assertSame(cdna.getSequenceAt(0), mappedGroup.getSequences().get(0)); - assertSame(cdna.getSequenceAt(1), mappedGroup.getSequences().get(1)); - // Pep2 in protein has a gap in column 1 - doesn't map to any column - // Pep1 has K which should map to columns 0-3 in Cds1 + // Seq2 in protein has a gap in column 1 - ignored + // Seq1 has K which should map to columns 0-3 in Seq1 assertEquals(0, mappedGroup.getStartRes()); assertEquals(3, mappedGroup.getEndRes()); @@ -658,8 +655,7 @@ public class MappingUtilsTest */ sg.setStartRes(2); sg.setEndRes(4); - mappedGroup = MappingUtils.mapSequenceGroup(sg, theProteinView, - theDnaView); + mappedGroup = MappingUtils.mapSequenceGroup(sg, proteinView, dnaView); assertEquals(1, mappedGroup.getStartRes()); assertEquals(13, mappedGroup.getEndRes()); @@ -672,22 +668,19 @@ public class MappingUtilsTest // select columns 4,5 - includes Seq1:codon2 (A) only sg.setStartRes(4); sg.setEndRes(5); - mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, - theProteinView); + mappedGroup = MappingUtils.mapSequenceGroup(sg, dnaView, proteinView); assertEquals(2, mappedGroup.getStartRes()); assertEquals(2, mappedGroup.getEndRes()); // add Seq2 to dna selection cols 4-5 include codons 1 and 2 (LQ) sg.addSequence(cdna.getSequenceAt(1), false); - mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, - theProteinView); + mappedGroup = MappingUtils.mapSequenceGroup(sg, dnaView, proteinView); assertEquals(2, mappedGroup.getStartRes()); assertEquals(4, mappedGroup.getEndRes()); // add Seq3 to dna selection cols 4-5 include codon 1 (Q) sg.addSequence(cdna.getSequenceAt(2), false); - mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, - theProteinView); + mappedGroup = MappingUtils.mapSequenceGroup(sg, dnaView, proteinView); assertEquals(0, mappedGroup.getStartRes()); assertEquals(4, mappedGroup.getEndRes()); } @@ -1338,32 +1331,21 @@ public class MappingUtilsTest } @Test(groups = "Functional") - public void testListToArray() + public void testFindOverlap() { List ranges = new ArrayList<>(); + ranges.add(new int[] { 4, 8 }); + ranges.add(new int[] { 10, 12 }); + ranges.add(new int[] { 16, 19 }); - int[] result = MappingUtils.listToArray(ranges); - assertEquals(result.length, 0); - ranges.add(new int[] { 24, 12 }); - result = MappingUtils.listToArray(ranges); - assertEquals(result.length, 2); - assertEquals(result[0], 24); - assertEquals(result[1], 12); - ranges.add(new int[] { -7, 30 }); - result = MappingUtils.listToArray(ranges); - assertEquals(result.length, 4); - assertEquals(result[0], 24); - assertEquals(result[1], 12); - assertEquals(result[2], -7); - assertEquals(result[3], 30); - try - { - MappingUtils.listToArray(null); - fail("Expected exception"); - } catch (NullPointerException e) - { - // expected - } + int[] overlap = MappingUtils.findOverlap(ranges, 5, 13); + assertArrayEquals(overlap, new int[] { 5, 12 }); + overlap = MappingUtils.findOverlap(ranges, -100, 100); + assertArrayEquals(overlap, new int[] { 4, 19 }); + overlap = MappingUtils.findOverlap(ranges, 7, 17); + assertArrayEquals(overlap, new int[] { 7, 17 }); + overlap = MappingUtils.findOverlap(ranges, 13, 15); + assertNull(overlap); } /** @@ -1468,105 +1450,4 @@ public class MappingUtilsTest assertEquals(0, mappedGroup.getStartRes()); assertEquals(1, mappedGroup.getEndRes()); // two columns } - - @Test(groups = "Functional") - public void testFindOverlap() - { - List ranges = new ArrayList<>(); - ranges.add(new int[] { 4, 8 }); - ranges.add(new int[] { 10, 12 }); - ranges.add(new int[] { 16, 19 }); - - int[] overlap = MappingUtils.findOverlap(ranges, 5, 13); - assertArrayEquals(overlap, new int[] { 5, 12 }); - overlap = MappingUtils.findOverlap(ranges, -100, 100); - assertArrayEquals(overlap, new int[] { 4, 19 }); - overlap = MappingUtils.findOverlap(ranges, 7, 17); - assertArrayEquals(overlap, new int[] { 7, 17 }); - overlap = MappingUtils.findOverlap(ranges, 13, 15); - assertNull(overlap); - } - - /** - * Test mapping a sequence group including a sequence which maps to more than - * one other sequence - * - * @throws IOException - */ - @Test(groups = { "Functional" }) - public void testMapSequenceGroup_oneToMany() throws IOException - { - /* - * Uniprot:FER2_ARATH has cross-refs to 10 EMBLCDS sequences; - * we'll just mimic 3 of them here (abbreviated) - * From EMBLCDS|BAE98526 [ [1, 444] ] 3:1 to [ [1, 148] ] FER2_ARATH - * From EMBLCDS|AAM91336 same - * From EMBLCDS|AAM13033 same - */ - String coding = "atggcttccactgctctctca"; - AlignmentI cds = loadAlignment(">BAE98526\n" + coding + "\n>AAM91336\n" - + coding + "\n>AAM13033\n" + coding + "\n", - FileFormat.Fasta); - cds.setDataset(null); - AlignmentI protein = loadAlignment(">FER2_ARATH\nMASTALS\n", - FileFormat.Fasta); - protein.setDataset(null); - AlignedCodonFrame acf = new AlignedCodonFrame(); - MapList map = new MapList(new int[] { 1, 21 }, new int[] { 1, 7 }, 3, 1); - for (int seq = 0; seq < 3; seq++) - { - acf.addMap(cds.getSequenceAt(seq).getDatasetSequence(), - protein.getSequenceAt(0).getDatasetSequence(), map); - } - List acfList = Arrays - .asList(new AlignedCodonFrame[] - { acf }); - - AlignViewportI theDnaView = new AlignViewport(cds); - AlignViewportI theProteinView = new AlignViewport(protein); - protein.setCodonFrames(acfList); - - /* - * Select FER2_ARATH in the protein - */ - SequenceGroup sg = new SequenceGroup(); - sg.setColourText(true); - sg.setIdColour(Color.GREEN); - sg.setOutlineColour(Color.LIGHT_GRAY); - sg.addSequence(protein.getSequenceAt(0), false); - sg.setEndRes(protein.getWidth() - 1); - - /* - * Verify the mapped sequence group in dna - */ - SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg, - theProteinView, theDnaView); - assertTrue(mappedGroup.getColourText()); - assertSame(sg.getIdColour(), mappedGroup.getIdColour()); - assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); - assertEquals(3, mappedGroup.getSequences().size()); - assertSame(cds.getSequenceAt(0), mappedGroup.getSequences().get(0)); - assertSame(cds.getSequenceAt(1), mappedGroup.getSequences().get(1)); - assertSame(cds.getSequenceAt(2), mappedGroup.getSequences().get(2)); - assertEquals(0, mappedGroup.getStartRes()); - assertEquals(20, mappedGroup.getEndRes()); // 21 columns (7 codons) - - /* - * Select 2 CDS, verify peptide is mapped - */ - sg.clear(); - sg.addSequence(cds.getSequenceAt(1), false); - sg.addSequence(cds.getSequenceAt(0), false); - sg.setStartRes(0); - sg.setEndRes(20); - mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, - theProteinView); - assertTrue(mappedGroup.getColourText()); - assertSame(sg.getIdColour(), mappedGroup.getIdColour()); - assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); - assertEquals(1, mappedGroup.getSequences().size()); - assertSame(protein.getSequenceAt(0), mappedGroup.getSequences().get(0)); - assertEquals(0, mappedGroup.getStartRes()); - assertEquals(6, mappedGroup.getEndRes()); - } }