X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=test%2Fjalview%2Futil%2FMappingUtilsTest.java;h=feaa948a66bb778be3721c32b265a264dfcd2b46;hb=refs%2Fheads%2Fbug%2FJAL-3806_without_shared_DS_for_2_11_2;hp=4b7c75c2eb8bc7c3f92b659a49ab84b2f60fb2c1;hpb=e5c29155a0ac8f9a03b3a7302576dc4223066a65;p=jalview.git

diff --git a/test/jalview/util/MappingUtilsTest.java b/test/jalview/util/MappingUtilsTest.java
index 4b7c75c..feaa948 100644
--- a/test/jalview/util/MappingUtilsTest.java
+++ b/test/jalview/util/MappingUtilsTest.java
@@ -244,7 +244,7 @@ public class MappingUtilsTest
     protein.setCodonFrames(acfList);
 
     /*
-     * Select Seq1 and Seq3 in the protein (startRes=endRes=0)
+     * Select Seq1 and Seq3 in the protein
      */
     SequenceGroup sg = new SequenceGroup();
     sg.setColourText(true);
@@ -252,6 +252,7 @@ public class MappingUtilsTest
     sg.setOutlineColour(Color.LIGHT_GRAY);
     sg.addSequence(protein.getSequenceAt(0), false);
     sg.addSequence(protein.getSequenceAt(2), false);
+    sg.setEndRes(protein.getWidth() - 1);
 
     /*
      * Verify the mapped sequence group in dna
@@ -265,7 +266,7 @@ public class MappingUtilsTest
     assertSame(cdna.getSequenceAt(0), mappedGroup.getSequences().get(0));
     assertSame(cdna.getSequenceAt(2), mappedGroup.getSequences().get(1));
     assertEquals(0, mappedGroup.getStartRes());
-    assertEquals(2, mappedGroup.getEndRes());
+    assertEquals(2, mappedGroup.getEndRes()); // 3 columns (1 codon)
 
     /*
      * Verify mapping sequence group from dna to protein
@@ -1346,4 +1347,105 @@ public class MappingUtilsTest
     overlap = MappingUtils.findOverlap(ranges, 13, 15);
     assertNull(overlap);
   }
+  
+  /**
+   * Test mapping a sequence group where sequences in and outside the group
+   * share a dataset sequence (e.g. alternative CDS for the same gene)
+   * <p>
+   * This scenario doesn't arise after JAL-3763 changes, but test left as still valid
+   * @throws IOException
+   */
+  @Test(groups = { "Functional" })
+  public void testMapSequenceGroup_sharedDataset() throws IOException
+  {
+    /*
+     * Set up dna and protein Seq1/2/3 with mappings (held on the protein
+     * viewport). CDS sequences share the same 'gene' dataset sequence.
+     */
+    SequenceI dna = new Sequence("dna", "aaatttgggcccaaatttgggccc");
+    SequenceI cds1 = new Sequence("cds1/1-6", "aaattt");
+    SequenceI cds2 = new Sequence("cds1/4-9", "tttggg");
+    SequenceI cds3 = new Sequence("cds1/19-24", "gggccc");
+
+    cds1.setDatasetSequence(dna);
+    cds2.setDatasetSequence(dna);
+    cds3.setDatasetSequence(dna);
+
+    SequenceI pep1 = new Sequence("pep1", "KF");
+    SequenceI pep2 = new Sequence("pep2", "FG");
+    SequenceI pep3 = new Sequence("pep3", "GP");
+    pep1.createDatasetSequence();
+    pep2.createDatasetSequence();
+    pep3.createDatasetSequence();
+
+    /*
+     * add mappings from coding positions of dna to respective peptides
+     */
+    AlignedCodonFrame acf = new AlignedCodonFrame();
+    acf.addMap(dna, pep1,
+            new MapList(new int[]
+            { 1, 6 }, new int[] { 1, 2 }, 3, 1));
+    acf.addMap(dna, pep2,
+            new MapList(new int[]
+            { 4, 9 }, new int[] { 1, 2 }, 3, 1));
+    acf.addMap(dna, pep3,
+            new MapList(new int[]
+            { 19, 24 }, new int[] { 1, 2 }, 3, 1));
+
+    List<AlignedCodonFrame> acfList = Arrays
+            .asList(new AlignedCodonFrame[]
+            { acf });
+
+    AlignmentI cdna = new Alignment(new SequenceI[] { cds1, cds2, cds3 });
+    AlignmentI protein = new Alignment(
+            new SequenceI[]
+            { pep1, pep2, pep3 });
+    AlignViewportI cdnaView = new AlignViewport(cdna);
+    AlignViewportI peptideView = new AlignViewport(protein);
+    protein.setCodonFrames(acfList);
+
+    /*
+     * Select pep1 and pep3 in the protein alignment
+     */
+    SequenceGroup sg = new SequenceGroup();
+    sg.setColourText(true);
+    sg.setIdColour(Color.GREEN);
+    sg.setOutlineColour(Color.LIGHT_GRAY);
+    sg.addSequence(pep1, false);
+    sg.addSequence(pep3, false);
+    sg.setEndRes(protein.getWidth() - 1);
+
+    /*
+     * Verify the mapped sequence group in dna is cds1 and cds3
+     */
+    SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg,
+            peptideView, cdnaView);
+    assertTrue(mappedGroup.getColourText());
+    assertSame(sg.getIdColour(), mappedGroup.getIdColour());
+    assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
+    assertEquals(2, mappedGroup.getSequences().size());
+    assertSame(cds1, mappedGroup.getSequences().get(0));
+    assertSame(cds3, mappedGroup.getSequences().get(1));
+    // columns 1-6 selected (0-5 base zero)
+    assertEquals(0, mappedGroup.getStartRes());
+    assertEquals(5, mappedGroup.getEndRes());
+
+    /*
+     * Select mapping sequence group from dna to protein
+     */
+    sg.clear();
+    sg.addSequence(cds2, false);
+    sg.addSequence(cds1, false);
+    sg.setStartRes(0);
+    sg.setEndRes(cdna.getWidth() - 1);
+    mappedGroup = MappingUtils.mapSequenceGroup(sg, cdnaView, peptideView);
+    assertTrue(mappedGroup.getColourText());
+    assertSame(sg.getIdColour(), mappedGroup.getIdColour());
+    assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
+    assertEquals(2, mappedGroup.getSequences().size());
+    assertSame(protein.getSequenceAt(1), mappedGroup.getSequences().get(0));
+    assertSame(protein.getSequenceAt(0), mappedGroup.getSequences().get(1));
+    assertEquals(0, mappedGroup.getStartRes());
+    assertEquals(1, mappedGroup.getEndRes()); // two columns
+  }
 }