From: tcofoegbu <tcnofoegbu@dundee.ac.uk>
Date: Tue, 31 May 2016 16:56:31 +0000 (+0100)
Subject: merge
X-Git-Tag: Release_2_10_0~196
X-Git-Url: http://source.jalview.org/gitweb/?a=commitdiff_plain;h=1f959f4a5bc07769cde4c2577022ad64e55b4a1a;hp=e2821ddd6f7ba986dff9a3a27bb7711ec71c3b9b;p=jalview.git

merge
---

diff --git a/help/html/releases.html b/help/html/releases.html
index d4bbd33..6f1c351 100755
--- a/help/html/releases.html
+++ b/help/html/releases.html
@@ -47,7 +47,7 @@
     <tr>
       <td width="60" nowrap>
         <div align="center">
-          <strong><a name="Jalview.2.9.1">2.9.1</a><br /> <em>1/6/2016</em></strong>
+          <strong><a name="Jalview.2.9.1">2.9.1</a><br /> <em>14/6/2016</em></strong>
         </div>
       </td>
       <td><em>General</em>
@@ -64,7 +64,7 @@
         <div align="left">
           <em>General</em>
           <ul>
-            <li></li>
+            <li><!-- JAL-2077 -->reinstate CTRL-click for opening pop-up menu on OSX</li>
           </ul>
           <em>Application</em>
           <ul>
diff --git a/resources/embl_mapping.xml b/resources/embl_mapping.xml
index ccbde5e..01b921a 100644
--- a/resources/embl_mapping.xml
+++ b/resources/embl_mapping.xml
@@ -22,35 +22,61 @@
 <!--
 	History: Originally created from EMBL_common_V1.0
 	Updated on 24th April 2007 for WsDBFetch Service move to EMBL_Services_V1.1.xsd
+	Updated May 2016 for EMBL XML 1.2 JAL-2113 JAL-2114
+	  see ftp://ftp.sra.ebi.ac.uk/meta/xsd/sra_1_5/ENA.embl.xsd
+	  see http://www.ebi.ac.uk/ena/submit/data-formats
 	-->
 	<class name="jalview.datamodel.xdb.embl.EmblFile">
-		<map-to xml="EMBL_Services"/>
+		<map-to xml="ROOT"/>
 		<field name="entries" type="jalview.datamodel.xdb.embl.EmblEntry" collection="vector">
 			<bind-xml name="entry"/>
 		</field>
-		
 		<field name="errors" type="jalview.datamodel.xdb.embl.EmblError" collection="vector">
 			<bind-xml name="Error"/>
 		</field>
 	</class>
 	<class name="jalview.datamodel.xdb.embl.EmblEntry">
 		<field name="accession" type="string">
-			<bind-xml location="accession" node="attribute"/>
+			<bind-xml name="accession" node="attribute"/>
 		</field>
-		<!--  May 2015 changed from last-updated to match xml -->
-		<field name="lastUpdated" type="string">
-			<bind-xml location="lastUpdated" node="attribute"/>
+		<!-- 
+		    in EMBL XML 1.2 sequence/@version became entry/version 
+		    entry/@version became entry/@entryVersion
+		-->
+		<field name="sequenceVersion" type="string">
+			<bind-xml name="version" node="attribute"/>
 		</field>
-		<field name="version" type="string">
-			<bind-xml location="version" node="attribute"/>
+		<field name="entryVersion" type="string">
+			<bind-xml name="entryVersion" node="attribute"/>
+		</field>
+		<field name="dataClass" type="string">
+			<bind-xml name="dataClass" node="attribute"/>
+		</field>
+		<field name="taxonomicDivision" type="string">
+			<bind-xml name="taxonomicDivision" node="attribute"/>
+		</field>
+		<field name="moleculeType" type="string">
+			<bind-xml name="moleculeType" node="attribute"/>
+		</field>
+		<field name="sequenceLength" type="string">
+			<bind-xml name="sequenceLength" node="attribute"/>
+		</field>
+		<field name="topology" type="string">
+			<bind-xml name="topology" node="attribute" location="type"/>
+		</field>
+		<field name="firstPublicDate" type="string">
+			<bind-xml name="firstPublic" node="attribute"/>
 		</field>
-		<field name="rCreated" type="string">
-			<bind-xml location="releaseCreated" node="attribute"/>
+		<field name="firstPublicRelease" type="string">
+			<bind-xml name="firstPublicRelease" node="attribute"/>
 		</field>
-		<field name="rLastUpdated" type="string">
-			<bind-xml location="releaseLastUpdated" node="attribute"/>
+		<field name="lastUpdatedDate" type="string">
+			<bind-xml name="lastUpdated" node="attribute"/>
 		</field>
-		<field name="desc" type="string">
+		<field name="lastUpdatedRelease" type="string">
+			<bind-xml name="lastUpdatedRelease" node="attribute"/>
+		</field>
+		<field name="description" type="string">
 			<bind-xml name="description" node="element"/>
 		</field>
 		<field name="keywords" type="string" collection="vector">
@@ -60,19 +86,13 @@
 			<bind-xml name="feature"/>
 		</field>
 		<field name="dbRefs" type="jalview.datamodel.DBRefEntry" collection="vector">
-			<bind-xml name="dbreference" />
+			<bind-xml name="xref" />
 		</field>
 		<field name="sequence" type="jalview.datamodel.xdb.embl.EmblSequence">
 			<bind-xml name="sequence"/>
 		</field>
 	</class>
 	<class name="jalview.datamodel.xdb.embl.EmblSequence">
-		<field name="type" type="string">
-			<bind-xml name="type" node="attribute" location="type"/>
-		</field>
-		<field name="version" type="string">
-			<bind-xml name="version" node="attribute" location="version"/>
-		</field>
 		<field name="sequence" type="string">
 			<bind-xml node="text"/>
 		</field>
@@ -81,25 +101,25 @@
 		<field name="name" type="string">
 			<bind-xml name="name" node="attribute"/>
 		</field>
+		<field name="location" type="string">
+			<bind-xml name="location" node="attribute"/>
+		</field>
 		<field name="dbRefs" type="jalview.datamodel.DBRefEntry" collection="vector">
-			<bind-xml name="dbreference" node="element"/>
+			<bind-xml name="xref" node="element"/>
 		</field>
 		<field name="qualifiers" type="jalview.datamodel.xdb.embl.Qualifier" collection="vector">
 			<bind-xml name="qualifier"/>
 		</field>					
-		<field name="locations" type="jalview.datamodel.xdb.embl.EmblFeatureLocations" collection="vector">
-			<bind-xml name="location"/>
-		</field>
 	</class>
 	<class name="jalview.datamodel.DBRefEntry" verify-constructable="false">
 		<field name="accessionId" type="java.lang.String">
-			<bind-xml name="primary" node="attribute"/>
+			<bind-xml name="id" node="attribute"/>
 		</field>
 		<field name="source" type="java.lang.String"> 
 			<bind-xml name="db" node="attribute"/>
 		</field>
 		<field name="version" type="string">
-			<bind-xml name="secondary" node="attribute"/>
+			<bind-xml name="secondaryId" node="attribute"/>
 		</field>
 	</class>
 	<class  name="jalview.datamodel.xdb.embl.Qualifier" verify-constructable="false">
@@ -113,40 +133,4 @@
 			<bind-xml name="value" node="element"/>
 		</field>
 	</class>
-	<class name="jalview.datamodel.xdb.embl.EmblFeatureLocations">
-		<field name="locationType" type="string">
-			<bind-xml name="type" node="attribute"/>
-		</field>
-		<field name="locationComplement" type="boolean">
-			<bind-xml name="complement" node="attribute"/>
-		</field>
-		<field name="locElements" type="jalview.datamodel.xdb.embl.EmblFeatureLocElement" collection="vector">
-			<bind-xml name="locationElement"/>
-		</field>
-	</class>
-	<class name="jalview.datamodel.xdb.embl.EmblFeatureLocElement">
-		<field name="type" type="string">
-			<bind-xml name="type" node="attribute"/>
-		</field>
-		<field name="accession" type="string">
-			<bind-xml name="accession" node="attribute"/>			
-		</field>
-		<field name="version" type="string">
-			<bind-xml name="version" node="attribute"/>
-		</field>
-		<field name="complement" type="boolean">
-			<bind-xml name="complement"/>
-		</field>
-		<field name="basePositions" type="jalview.datamodel.xdb.embl.BasePosition" collection="array">
-			<bind-xml name="basePosition" node="element"/>
-		</field>
-	</class>
-	<class name="jalview.datamodel.xdb.embl.BasePosition">
-		<field name="type">
-			<bind-xml name="type" node="attribute"/>
-		</field>
-		<field name="pos">
-			<bind-xml node="text"/>
-		</field>
-	</class>
 </mapping>
diff --git a/src/MCview/PDBViewer.java b/src/MCview/PDBViewer.java
index e032c7a..d5f0d0b 100755
--- a/src/MCview/PDBViewer.java
+++ b/src/MCview/PDBViewer.java
@@ -151,7 +151,7 @@ public class PDBViewer extends JInternalFrame implements Runnable
     {
       EBIFetchClient ebi = new EBIFetchClient();
       String query = "pdb:" + pdbentry.getId();
-      pdbentry.setFile(ebi.fetchDataAsFile(query, "default", "raw", ".xml")
+      pdbentry.setFile(ebi.fetchDataAsFile(query, "default", ".xml")
               .getAbsolutePath());
 
       if (pdbentry.getFile() != null)
diff --git a/src/jalview/analysis/AlignmentUtils.java b/src/jalview/analysis/AlignmentUtils.java
index fba023f..081f446 100644
--- a/src/jalview/analysis/AlignmentUtils.java
+++ b/src/jalview/analysis/AlignmentUtils.java
@@ -2114,6 +2114,26 @@ public class AlignmentUtils
   {
     AlignmentI copy = new Alignment(new Alignment(seqs));
 
+    /*
+     * add mappings between sequences to the new alignment
+     */
+    AlignedCodonFrame mappings = new AlignedCodonFrame();
+    copy.addCodonFrame(mappings);
+    for (int i = 0; i < copy.getHeight(); i++)
+    {
+      SequenceI from = seqs[i];
+      SequenceI to = copy.getSequenceAt(i);
+      if (to.getDatasetSequence() != null)
+      {
+        to = to.getDatasetSequence();
+      }
+      int start = from.getStart();
+      int end = from.getEnd();
+      MapList map = new MapList(new int[] { start, end }, new int[] {
+          start, end }, 1, 1);
+      mappings.addMap(to, from, map);
+    }
+
     SequenceIdMatcher matcher = new SequenceIdMatcher(seqs);
     if (xrefs != null)
     {
diff --git a/src/jalview/api/DBRefEntryI.java b/src/jalview/api/DBRefEntryI.java
index 490b21a..49858cb 100644
--- a/src/jalview/api/DBRefEntryI.java
+++ b/src/jalview/api/DBRefEntryI.java
@@ -1,5 +1,6 @@
 package jalview.api;
 
+import jalview.datamodel.DBRefEntry;
 import jalview.datamodel.Mapping;
 
 //JBPComment: this is a datamodel API - so it should be in datamodel (it's a peer of SequenceI)
@@ -74,4 +75,20 @@ public interface DBRefEntryI
   public int getEndRes();
 
   public Mapping getMap();
+
+  /**
+   * Answers true if this object is either equivalent to, or can be 'improved'
+   * by, the given entry. Specifically, answers true if
+   * <ul>
+   * <li>source and accession are identical</li>
+   * <li>version is identical, or this version is of the format "someSource:0",
+   * in which case the version for the other entry replaces it</li>
+   * <li>mappings are not compared but if this entry has no mapping, replace
+   * with that for the other entry</li>
+   * </ul>
+   * 
+   * @param otherEntry
+   * @return
+   */
+  public boolean updateFrom(DBRefEntry otherEntry);
 }
diff --git a/src/jalview/appletgui/AnnotationLabels.java b/src/jalview/appletgui/AnnotationLabels.java
index 5727e9c..b28ccc7 100755
--- a/src/jalview/appletgui/AnnotationLabels.java
+++ b/src/jalview/appletgui/AnnotationLabels.java
@@ -162,6 +162,7 @@ public class AnnotationLabels extends Panel implements ActionListener,
     return row;
   }
 
+  @Override
   public void actionPerformed(ActionEvent evt)
   {
     AlignmentAnnotation[] aa = av.getAlignment().getAlignmentAnnotation();
@@ -261,6 +262,7 @@ public class AnnotationLabels extends Panel implements ActionListener,
 
   boolean resizePanel = false;
 
+  @Override
   public void mouseMoved(MouseEvent evt)
   {
     resizePanel = evt.getY() < 10 && evt.getX() < 14;
@@ -306,6 +308,7 @@ public class AnnotationLabels extends Panel implements ActionListener,
     dragCancelled = true;
   }
 
+  @Override
   public void mouseDragged(MouseEvent evt)
   {
     if (dragCancelled)
@@ -365,10 +368,12 @@ public class AnnotationLabels extends Panel implements ActionListener,
     }
   }
 
+  @Override
   public void mouseClicked(MouseEvent evt)
   {
   }
 
+  @Override
   public void mouseReleased(MouseEvent evt)
   {
     if (!resizePanel && !dragCancelled)
@@ -400,6 +405,7 @@ public class AnnotationLabels extends Panel implements ActionListener,
     ap.annotationPanel.repaint();
   }
 
+  @Override
   public void mouseEntered(MouseEvent evt)
   {
     if (evt.getY() < 10 && evt.getX() < 14)
@@ -409,6 +415,7 @@ public class AnnotationLabels extends Panel implements ActionListener,
     }
   }
 
+  @Override
   public void mouseExited(MouseEvent evt)
   {
     dragCancelled = false;
@@ -427,6 +434,7 @@ public class AnnotationLabels extends Panel implements ActionListener,
     repaint();
   }
 
+  @Override
   public void mousePressed(MouseEvent evt)
   {
     oldY = evt.getY();
@@ -522,6 +530,7 @@ public class AnnotationLabels extends Panel implements ActionListener,
             final AlignmentAnnotation aaa = aa[selectedRow];
             cbmi.addItemListener(new ItemListener()
             {
+              @Override
               public void itemStateChanged(ItemEvent e)
               {
                 if (aaa.groupRef != null)
@@ -545,6 +554,7 @@ public class AnnotationLabels extends Panel implements ActionListener,
                       aa[selectedRow].groupRef.isShowConsensusHistogram());
               chist.addItemListener(new ItemListener()
               {
+                @Override
                 public void itemStateChanged(ItemEvent e)
                 {
                   // TODO: pass on reference
@@ -564,6 +574,7 @@ public class AnnotationLabels extends Panel implements ActionListener,
                       aa[selectedRow].groupRef.isShowSequenceLogo());
               cprofl.addItemListener(new ItemListener()
               {
+                @Override
                 public void itemStateChanged(ItemEvent e)
                 {
                   // TODO: pass on reference
@@ -585,6 +596,7 @@ public class AnnotationLabels extends Panel implements ActionListener,
                       aa[selectedRow].groupRef.isNormaliseSequenceLogo());
               cprofn.addItemListener(new ItemListener()
               {
+                @Override
                 public void itemStateChanged(ItemEvent e)
                 {
                   // TODO: pass on reference
@@ -608,6 +620,7 @@ public class AnnotationLabels extends Panel implements ActionListener,
                       av.isShowConsensusHistogram());
               chist.addItemListener(new ItemListener()
               {
+                @Override
                 public void itemStateChanged(ItemEvent e)
                 {
                   // TODO: pass on reference
@@ -631,6 +644,7 @@ public class AnnotationLabels extends Panel implements ActionListener,
                       av.isShowSequenceLogo());
               cprof.addItemListener(new ItemListener()
               {
+                @Override
                 public void itemStateChanged(ItemEvent e)
                 {
                   // TODO: pass on reference
@@ -655,6 +669,7 @@ public class AnnotationLabels extends Panel implements ActionListener,
                       av.isNormaliseSequenceLogo());
               cprofn.addItemListener(new ItemListener()
               {
+                @Override
                 public void itemStateChanged(ItemEvent e)
                 {
                   // TODO: pass on reference
@@ -697,11 +712,47 @@ public class AnnotationLabels extends Panel implements ActionListener,
             // todo: make the ap scroll to the selection - not necessary, first
             // click highlights/scrolls, second selects
             ap.seqPanel.ap.idPanel.highlightSearchResults(null);
-            ap.av.setSelectionGroup(// new SequenceGroup(
-            aa[selectedRow].groupRef); // );
-            ap.av.sendSelection();
+            // process modifiers
+            SequenceGroup sg = ap.av.getSelectionGroup();
+            if (sg == null
+                    || sg == aa[selectedRow].groupRef
+                    || !(jalview.util.Platform.isControlDown(evt) || evt
+                            .isShiftDown()))
+            {
+              if (jalview.util.Platform.isControlDown(evt)
+                      || evt.isShiftDown())
+              {
+                // clone a new selection group from the associated group
+                ap.av.setSelectionGroup(new SequenceGroup(
+                        aa[selectedRow].groupRef));
+              }
+              else
+              {
+                // set selection to the associated group so it can be edited
+                ap.av.setSelectionGroup(aa[selectedRow].groupRef);
+              }
+            }
+            else
+            {
+              // modify current selection with associated group
+              int remainToAdd = aa[selectedRow].groupRef.getSize();
+              for (SequenceI sgs : aa[selectedRow].groupRef.getSequences())
+              {
+                if (jalview.util.Platform.isControlDown(evt))
+                {
+                  sg.addOrRemove(sgs, --remainToAdd == 0);
+                }
+                else
+                {
+                  // notionally, we should also add intermediate sequences from
+                  // last added sequence ?
+                  sg.addSequence(sgs, --remainToAdd == 0);
+                }
+              }
+            }
             ap.paintAlignment(false);
             PaintRefresher.Refresh(ap, ap.av.getSequenceSetId());
+            ap.av.sendSelection();
           }
           else
           {
@@ -728,7 +779,8 @@ public class AnnotationLabels extends Panel implements ActionListener,
               // we make a copy rather than edit the current selection if no
               // modifiers pressed
               // see Enhancement JAL-1557
-              if (!(evt.isControlDown() || evt.isShiftDown()))
+              if (!(jalview.util.Platform.isControlDown(evt) || evt
+                      .isShiftDown()))
               {
                 sg = new SequenceGroup(sg);
                 sg.clear();
@@ -736,7 +788,7 @@ public class AnnotationLabels extends Panel implements ActionListener,
               }
               else
               {
-                if (evt.isControlDown())
+                if (jalview.util.Platform.isControlDown(evt))
                 {
                   sg.addOrRemove(aa[selectedRow].sequenceRef, true);
                 }
@@ -794,11 +846,13 @@ public class AnnotationLabels extends Panel implements ActionListener,
     }
   }
 
+  @Override
   public void update(Graphics g)
   {
     paint(g);
   }
 
+  @Override
   public void paint(Graphics g)
   {
     int w = getSize().width;
diff --git a/src/jalview/appletgui/IdPanel.java b/src/jalview/appletgui/IdPanel.java
index 8f24f11..36c2199 100755
--- a/src/jalview/appletgui/IdPanel.java
+++ b/src/jalview/appletgui/IdPanel.java
@@ -100,6 +100,7 @@ public class IdPanel extends Panel implements MouseListener,
 
   Tooltip tooltip;
 
+  @Override
   public void mouseMoved(MouseEvent e)
   {
     int seq = alignPanel.seqPanel.findSeq(e);
@@ -188,6 +189,7 @@ public class IdPanel extends Panel implements MouseListener,
     tooltiptext = null;
   }
 
+  @Override
   public void mouseDragged(MouseEvent e)
   {
     mouseDragging = true;
@@ -207,6 +209,7 @@ public class IdPanel extends Panel implements MouseListener,
     alignPanel.paintAlignment(false);
   }
 
+  @Override
   public void mouseClicked(MouseEvent e)
   {
     if (e.getClickCount() < 2)
@@ -270,6 +273,7 @@ public class IdPanel extends Panel implements MouseListener,
     }
   }
 
+  @Override
   public void mouseEntered(MouseEvent e)
   {
     if (scrollThread != null)
@@ -278,6 +282,7 @@ public class IdPanel extends Panel implements MouseListener,
     }
   }
 
+  @Override
   public void mouseExited(MouseEvent e)
   {
     if (av.getWrapAlignment())
@@ -297,6 +302,7 @@ public class IdPanel extends Panel implements MouseListener,
     }
   }
 
+  @Override
   public void mousePressed(MouseEvent e)
   {
     if (e.getClickCount() > 1)
@@ -345,7 +351,8 @@ public class IdPanel extends Panel implements MouseListener,
     }
 
     if ((av.getSelectionGroup() == null)
-            || ((!e.isControlDown() && !e.isShiftDown()) && av
+            || ((!jalview.util.Platform.isControlDown(e) && !e
+                    .isShiftDown()) && av
                     .getSelectionGroup() != null))
     {
       av.setSelectionGroup(new SequenceGroup());
@@ -401,6 +408,7 @@ public class IdPanel extends Panel implements MouseListener,
 
   }
 
+  @Override
   public void mouseReleased(MouseEvent e)
   {
     if (scrollThread != null)
@@ -455,6 +463,7 @@ public class IdPanel extends Panel implements MouseListener,
       running = false;
     }
 
+    @Override
     public void run()
     {
       running = true;
diff --git a/src/jalview/appletgui/SeqPanel.java b/src/jalview/appletgui/SeqPanel.java
index a4dad4b..31bf6a4 100644
--- a/src/jalview/appletgui/SeqPanel.java
+++ b/src/jalview/appletgui/SeqPanel.java
@@ -1813,9 +1813,12 @@ public class SeqPanel extends Panel implements MouseMotionListener,
 
     // do we want to thread this ? (contention with seqsel and colsel locks, I
     // suspect)
-    // rules are: colsel is copied if there is a real intersection between
-    // sequence selection
-    boolean repaint = false, copycolsel = true;
+    /*
+     * only copy colsel if there is a real intersection between
+     * sequence selection and this panel's alignment
+     */
+    boolean repaint = false;
+    boolean copycolsel = false;
     if (av.getSelectionGroup() == null || !av.isSelectionGroupChanged(true))
     {
       SequenceGroup sgroup = null;
@@ -1832,11 +1835,9 @@ public class SeqPanel extends Panel implements MouseMotionListener,
         }
         sgroup = seqsel.intersect(av.getAlignment(),
                 (av.hasHiddenRows()) ? av.getHiddenRepSequences() : null);
-        if ((sgroup == null || sgroup.getSize() == 0)
-                && (colsel == null || colsel.isEmpty()))
+        if ((sgroup != null && sgroup.getSize() > 0))
         {
-          // don't copy columns if the region didn't intersect.
-          copycolsel = false;
+          copycolsel = true;
         }
       }
       if (sgroup != null && sgroup.getSize() > 0)
diff --git a/src/jalview/datamodel/Alignment.java b/src/jalview/datamodel/Alignment.java
index a9b0d53..f14539b 100755
--- a/src/jalview/datamodel/Alignment.java
+++ b/src/jalview/datamodel/Alignment.java
@@ -30,6 +30,7 @@ import java.util.Collections;
 import java.util.Enumeration;
 import java.util.HashSet;
 import java.util.Hashtable;
+import java.util.Iterator;
 import java.util.List;
 import java.util.Map;
 import java.util.Set;
@@ -1287,6 +1288,22 @@ public class Alignment implements AlignmentI
     }
   }
 
+  /**
+   * adds a set of mappings (while ignoring any duplicates)
+   */
+  @Override
+  public void addCodonFrames(Iterable<AlignedCodonFrame> codons)
+  {
+    if (codons != null)
+    {
+      Iterator<AlignedCodonFrame> it = codons.iterator();
+      while (it.hasNext())
+      {
+        addCodonFrame(it.next());
+      }
+    }
+  }
+
   /*
    * (non-Javadoc)
    * 
diff --git a/src/jalview/datamodel/AlignmentI.java b/src/jalview/datamodel/AlignmentI.java
index 76d1a48..4ae8ba2 100755
--- a/src/jalview/datamodel/AlignmentI.java
+++ b/src/jalview/datamodel/AlignmentI.java
@@ -363,6 +363,14 @@ public interface AlignmentI extends AnnotatedCollectionI
   void addCodonFrame(AlignedCodonFrame codons);
 
   /**
+   * add a set of aligned codons mappings for this alignment, apart from any
+   * duplicates which are ignored
+   * 
+   * @param codons
+   */
+  void addCodonFrames(Iterable<AlignedCodonFrame> codons);
+
+  /**
    * remove a particular codon frame reference from this alignment
    * 
    * @param codons
diff --git a/src/jalview/datamodel/DBRefEntry.java b/src/jalview/datamodel/DBRefEntry.java
index 53642b5..738c4dc 100755
--- a/src/jalview/datamodel/DBRefEntry.java
+++ b/src/jalview/datamodel/DBRefEntry.java
@@ -98,6 +98,82 @@ public class DBRefEntry implements DBRefEntryI
   }
 
   /**
+   * Answers true if this object is either equivalent to, or can be 'improved'
+   * by, the given entry. Specifically, answers true if
+   * <ul>
+   * <li>source and accession are identical (ignoring case)</li>
+   * <li>version is identical (ignoring case), or this version is of the format
+   * "someSource:0", in which case the version for the other entry replaces it</li>
+   * <li>mappings are not compared but if this entry has no mapping, replace
+   * with that for the other entry</li>
+   * </ul>
+   * 
+   * @param other
+   * @return
+   */
+  @Override
+  public boolean updateFrom(DBRefEntry other)
+  {
+    if (other == null)
+    {
+      return false;
+    }
+    if (other == this)
+    {
+      return true;
+    }
+
+    /*
+     * source must either match or be both null
+     */
+    String otherSource = other.getSource();
+    if ((source == null && otherSource != null)
+            || (source != null && otherSource == null)
+            || (source != null && !source.equalsIgnoreCase(otherSource)))
+    {
+      return false;
+    }
+
+    /*
+     * accession id must either match or be both null
+     */
+    String otherAccession = other.getAccessionId();
+    if ((accessionId == null && otherAccession != null)
+            || (accessionId != null && otherAccession == null)
+            || (accessionId != null && !accessionId.equalsIgnoreCase(otherAccession)))
+    {
+      return false;
+    }
+
+    /*
+     * if my version is null, "0" or "source:0" then replace with other version,
+     * otherwise the versions have to match
+     */
+    String otherVersion = other.getVersion();
+    if ((version == null || version.equals("0") || version.endsWith(":0"))
+            && otherVersion != null)
+    {
+      setVersion(otherVersion);
+    }
+    else
+    {
+      if (!version.equalsIgnoreCase(otherVersion))
+      {
+        return false;
+      }
+    }
+
+    /*
+     * if I have no mapping, take that of the other dbref
+     */
+    if (map == null)
+    {
+      setMap(other.getMap());
+    }
+    return true;
+  }
+
+  /**
    * test for similar DBRef attributes, except for the map object.
    * 
    * @param entry
@@ -106,6 +182,7 @@ public class DBRefEntry implements DBRefEntryI
   @Override
   public boolean equalRef(DBRefEntryI entry)
   {
+    // TODO is this method and equals() not needed?
     if (entry == null)
     {
       return false;
diff --git a/src/jalview/datamodel/FeatureProperties.java b/src/jalview/datamodel/FeatureProperties.java
index d25eb96..2306bec 100644
--- a/src/jalview/datamodel/FeatureProperties.java
+++ b/src/jalview/datamodel/FeatureProperties.java
@@ -28,8 +28,7 @@ package jalview.datamodel;
  */
 public class FeatureProperties
 {
-
-  private static final String EMBL_CODING_FEATURE = "CDS";
+  public static final String EMBL_CODING_FEATURE = "CDS";
 
   public static final String EXONPOS = "exon number";
 
diff --git a/src/jalview/datamodel/Sequence.java b/src/jalview/datamodel/Sequence.java
index a61f093..151d8c4 100755
--- a/src/jalview/datamodel/Sequence.java
+++ b/src/jalview/datamodel/Sequence.java
@@ -966,26 +966,25 @@ public class Sequence extends ASequence implements SequenceI
       dbrefs = new DBRefEntry[0];
     }
 
-    int i, iSize = dbrefs.length;
-
-    for (i = 0; i < iSize; i++)
+    for (DBRefEntryI dbr : dbrefs)
     {
-      if (dbrefs[i].equalRef(entry))
+      if (dbr.updateFrom(entry))
       {
-        if (entry.getMap() != null)
-        {
-          if (dbrefs[i].getMap() == null)
-          {
-            // overwrite with 'superior' entry that contains a mapping.
-            dbrefs[i] = entry;
-          }
-        }
+        /*
+         * found a dbref that either matched, or could be
+         * updated from, the new entry - no need to add it
+         */
         return;
       }
     }
 
-    DBRefEntry[] temp = new DBRefEntry[iSize + 1];
-    System.arraycopy(dbrefs, 0, temp, 0, iSize);
+    /*
+     * extend the array to make room for one more
+     */
+    // TODO use an ArrayList instead
+    int j = dbrefs.length;
+    DBRefEntry[] temp = new DBRefEntry[j + 1];
+    System.arraycopy(dbrefs, 0, temp, 0, j);
     temp[temp.length - 1] = entry;
 
     dbrefs = temp;
diff --git a/src/jalview/datamodel/SequenceFeature.java b/src/jalview/datamodel/SequenceFeature.java
index f2eb8ac..c75d6f2 100755
--- a/src/jalview/datamodel/SequenceFeature.java
+++ b/src/jalview/datamodel/SequenceFeature.java
@@ -39,6 +39,9 @@ public class SequenceFeature
   // private key for Phase designed not to conflict with real GFF data
   private static final String PHASE = "!Phase";
 
+  // private key for ENA location designed not to conflict with real GFF data
+  private static final String LOCATION = "!Location";
+
   /*
    * ATTRIBUTES is reserved for the GFF 'column 9' data, formatted as
    * name1=value1;name2=value2,value3;...etc
@@ -55,6 +58,10 @@ public class SequenceFeature
 
   public String description;
 
+  /*
+   * a map of key-value pairs; may be populated from GFF 'column 9' data,
+   * other data sources (e.g. GenBank file), or programmatically
+   */
   public Map<String, Object> otherDetails;
 
   public Vector<String> links;
@@ -480,6 +487,26 @@ public class SequenceFeature
   }
 
   /**
+   * Sets the 'raw' ENA format location specifier e.g. join(12..45,89..121)
+   * 
+   * @param loc
+   */
+  public void setEnaLocation(String loc)
+  {
+    setValue(LOCATION, loc);
+  }
+
+  /**
+   * Gets the 'raw' ENA format location specifier e.g. join(12..45,89..121)
+   * 
+   * @param loc
+   */
+  public String getEnaLocation()
+  {
+    return (String) getValue(LOCATION);
+  }
+
+  /**
    * Readable representation, for debug only, not guaranteed not to change
    * between versions
    */
diff --git a/src/jalview/datamodel/xdb/embl/BasePosition.java b/src/jalview/datamodel/xdb/embl/BasePosition.java
deleted file mode 100644
index 3737adc..0000000
--- a/src/jalview/datamodel/xdb/embl/BasePosition.java
+++ /dev/null
@@ -1,68 +0,0 @@
-/*
- * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
- * Copyright (C) $$Year-Rel$$ The Jalview Authors
- * 
- * This file is part of Jalview.
- * 
- * Jalview is free software: you can redistribute it and/or
- * modify it under the terms of the GNU General Public License 
- * as published by the Free Software Foundation, either version 3
- * of the License, or (at your option) any later version.
- *  
- * Jalview is distributed in the hope that it will be useful, but 
- * WITHOUT ANY WARRANTY; without even the implied warranty 
- * of MERCHANTABILITY or FITNESS FOR A PARTICULAR 
- * PURPOSE.  See the GNU General Public License for more details.
- * 
- * You should have received a copy of the GNU General Public License
- * along with Jalview.  If not, see <http://www.gnu.org/licenses/>.
- * The Jalview Authors are detailed in the 'AUTHORS' file.
- */
-package jalview.datamodel.xdb.embl;
-
-/**
- * Data model for a feature/location/locationElement/basePosition read from an
- * EMBL query reply
- * 
- * @see embl_mapping.xml
- */
-public class BasePosition
-{
-  String type;
-
-  String pos;
-
-  /**
-   * @return the pos
-   */
-  public String getPos()
-  {
-    return pos;
-  }
-
-  /**
-   * @param pos
-   *          the pos to set
-   */
-  public void setPos(String pos)
-  {
-    this.pos = pos;
-  }
-
-  /**
-   * @return the type
-   */
-  public String getType()
-  {
-    return type;
-  }
-
-  /**
-   * @param type
-   *          the type to set
-   */
-  public void setType(String type)
-  {
-    this.type = type;
-  }
-}
diff --git a/src/jalview/datamodel/xdb/embl/EmblEntry.java b/src/jalview/datamodel/xdb/embl/EmblEntry.java
index 691a4c9..cfe87d9 100644
--- a/src/jalview/datamodel/xdb/embl/EmblEntry.java
+++ b/src/jalview/datamodel/xdb/embl/EmblEntry.java
@@ -29,6 +29,7 @@ import jalview.datamodel.Sequence;
 import jalview.datamodel.SequenceFeature;
 import jalview.datamodel.SequenceI;
 import jalview.util.DBRefUtils;
+import jalview.util.DnaUtils;
 import jalview.util.MapList;
 import jalview.util.MappingUtils;
 import jalview.util.StringUtils;
@@ -57,17 +58,29 @@ public class EmblEntry
 
   String accession;
 
-  String version;
+  String entryVersion;
 
-  String taxDivision;
+  String sequenceVersion;
 
-  String desc;
+  String dataClass;
 
-  String rCreated;
+  String moleculeType;
 
-  String rLastUpdated;
+  String topology;
 
-  String lastUpdated;
+  String sequenceLength;
+
+  String taxonomicDivision;
+
+  String description;
+
+  String firstPublicDate;
+
+  String firstPublicRelease;
+
+  String lastUpdatedDate;
+
+  String lastUpdatedRelease;
 
   Vector<String> keywords;
 
@@ -112,23 +125,6 @@ public class EmblEntry
   }
 
   /**
-   * @return the desc
-   */
-  public String getDesc()
-  {
-    return desc;
-  }
-
-  /**
-   * @param desc
-   *          the desc to set
-   */
-  public void setDesc(String desc)
-  {
-    this.desc = desc;
-  }
-
-  /**
    * @return the features
    */
   public Vector<EmblFeature> getFeatures()
@@ -163,57 +159,6 @@ public class EmblEntry
   }
 
   /**
-   * @return the lastUpdated
-   */
-  public String getLastUpdated()
-  {
-    return lastUpdated;
-  }
-
-  /**
-   * @param lastUpdated
-   *          the lastUpdated to set
-   */
-  public void setLastUpdated(String lastUpdated)
-  {
-    this.lastUpdated = lastUpdated;
-  }
-
-  /**
-   * @return the releaseCreated
-   */
-  public String getRCreated()
-  {
-    return rCreated;
-  }
-
-  /**
-   * @param releaseCreated
-   *          the releaseCreated to set
-   */
-  public void setRCreated(String releaseCreated)
-  {
-    this.rCreated = releaseCreated;
-  }
-
-  /**
-   * @return the releaseLastUpdated
-   */
-  public String getRLastUpdated()
-  {
-    return rLastUpdated;
-  }
-
-  /**
-   * @param releaseLastUpdated
-   *          the releaseLastUpdated to set
-   */
-  public void setRLastUpdated(String releaseLastUpdated)
-  {
-    this.rLastUpdated = releaseLastUpdated;
-  }
-
-  /**
    * @return the sequence
    */
   public EmblSequence getSequence()
@@ -231,40 +176,6 @@ public class EmblEntry
   }
 
   /**
-   * @return the taxDivision
-   */
-  public String getTaxDivision()
-  {
-    return taxDivision;
-  }
-
-  /**
-   * @param taxDivision
-   *          the taxDivision to set
-   */
-  public void setTaxDivision(String taxDivision)
-  {
-    this.taxDivision = taxDivision;
-  }
-
-  /**
-   * @return the version
-   */
-  public String getVersion()
-  {
-    return version;
-  }
-
-  /**
-   * @param version
-   *          the version to set
-   */
-  public void setVersion(String version)
-  {
-    this.version = version;
-  }
-
-  /**
    * Recover annotated sequences from EMBL file
    * 
    * @param sourceDb
@@ -276,8 +187,9 @@ public class EmblEntry
   {
     SequenceI dna = new Sequence(sourceDb + "|" + accession,
             sequence.getSequence());
-    dna.setDescription(desc);
-    DBRefEntry retrievedref = new DBRefEntry(sourceDb, version, accession);
+    dna.setDescription(description);
+    DBRefEntry retrievedref = new DBRefEntry(sourceDb,
+            getSequenceVersion(), accession);
     dna.addDBRef(retrievedref);
     // add map to indicate the sequence is a valid coordinate frame for the
     // dbref
@@ -479,7 +391,8 @@ public class EmblEntry
           DBRefEntry pcdnaref = new DBRefEntry();
           pcdnaref.setAccessionId(prid);
           pcdnaref.setSource(DBRefSource.EMBLCDS);
-          pcdnaref.setVersion(getVersion()); // same as parent EMBL version.
+          pcdnaref.setVersion(getSequenceVersion()); // same as parent EMBL
+                                                     // version.
           MapList mp = new MapList(new int[] { 1, prseq.length() },
                   new int[] { 1 + (codonStart - 1),
                       (codonStart - 1) + 3 * prseq.length() }, 1, 3);
@@ -499,6 +412,7 @@ public class EmblEntry
         SequenceFeature sf = makeCdsFeature(exon, xint, prname, prid, vals,
                 codonStart);
         sf.setType(feature.getName()); // "CDS"
+        sf.setEnaLocation(feature.getLocation());
         sf.setFeatureGroup(sourceDb);
         dna.addSequenceFeature(sf);
       }
@@ -559,7 +473,7 @@ public class EmblEntry
           if (map != null)
           {
             Mapping pmap = new Mapping(dna, map.getMap().getInverse());
-            pref = new DBRefEntry(sourceDb, getVersion(),
+            pref = new DBRefEntry(sourceDb, getSequenceVersion(),
                     this.getAccession());
             pref.setMap(pmap);
             if (map.getTo() != null)
@@ -578,7 +492,7 @@ public class EmblEntry
           protEMBLCDS = new DBRefEntry();
           protEMBLCDS.setAccessionId(prid);
           protEMBLCDS.setSource(DBRefSource.EMBLCDSProduct);
-          protEMBLCDS.setVersion(getVersion());
+          protEMBLCDS.setVersion(getSequenceVersion());
           protEMBLCDS
                   .setMap(new Mapping(product, map.getMap().getInverse()));
         }
@@ -658,28 +572,31 @@ public class EmblEntry
    */
   protected int[] getCdsRanges(EmblFeature feature)
   {
-    if (feature.locations == null)
+    if (feature.location == null)
     {
       return new int[] {};
     }
-    int cdsBoundaryCount = 0; // count of all start/stop locations
-    int[][] cdsLocations = new int[feature.locations.size()][];
-    int locationNumber = 0;
-    for (EmblFeatureLocations loc : feature.locations)
-    {
-      int[] locationRanges = loc.getElementRanges(accession);
-      cdsLocations[locationNumber++] = locationRanges;
-      cdsBoundaryCount += locationRanges.length;
-    }
-    int[] cdsRanges = new int[cdsBoundaryCount];
-    int copyTo = 0;
-    for (int[] ranges : cdsLocations)
+    List<int[]> ranges = DnaUtils.parseLocation(feature.location);
+    return ranges == null ? new int[] {} : listToArray(ranges);
+  }
+
+  /**
+   * Converts a list of [start, end] ranges to a single array of [start, end,
+   * start, end ...]
+   * 
+   * @param ranges
+   * @return
+   */
+  int[] listToArray(List<int[]> ranges)
+  {
+    int[] result = new int[ranges.size() * 2];
+    int i = 0;
+    for (int[] range : ranges)
     {
-      System.arraycopy(ranges, 0, cdsRanges, copyTo, ranges.length);
-      copyTo += ranges.length;
+      result[i++] = range[0];
+      result[i++] = range[1];
     }
-    return cdsRanges;
-
+    return result;
   }
 
   /**
@@ -754,4 +671,124 @@ public class EmblEntry
     }
     return exon;
   }
+
+  public String getSequenceVersion()
+  {
+    return sequenceVersion;
+  }
+
+  public void setSequenceVersion(String sequenceVersion)
+  {
+    this.sequenceVersion = sequenceVersion;
+  }
+
+  public String getSequenceLength()
+  {
+    return sequenceLength;
+  }
+
+  public void setSequenceLength(String sequenceLength)
+  {
+    this.sequenceLength = sequenceLength;
+  }
+
+  public String getEntryVersion()
+  {
+    return entryVersion;
+  }
+
+  public void setEntryVersion(String entryVersion)
+  {
+    this.entryVersion = entryVersion;
+  }
+
+  public String getMoleculeType()
+  {
+    return moleculeType;
+  }
+
+  public void setMoleculeType(String moleculeType)
+  {
+    this.moleculeType = moleculeType;
+  }
+
+  public String getTopology()
+  {
+    return topology;
+  }
+
+  public void setTopology(String topology)
+  {
+    this.topology = topology;
+  }
+
+  public String getTaxonomicDivision()
+  {
+    return taxonomicDivision;
+  }
+
+  public void setTaxonomicDivision(String taxonomicDivision)
+  {
+    this.taxonomicDivision = taxonomicDivision;
+  }
+
+  public String getDescription()
+  {
+    return description;
+  }
+
+  public void setDescription(String description)
+  {
+    this.description = description;
+  }
+
+  public String getFirstPublicDate()
+  {
+    return firstPublicDate;
+  }
+
+  public void setFirstPublicDate(String firstPublicDate)
+  {
+    this.firstPublicDate = firstPublicDate;
+  }
+
+  public String getFirstPublicRelease()
+  {
+    return firstPublicRelease;
+  }
+
+  public void setFirstPublicRelease(String firstPublicRelease)
+  {
+    this.firstPublicRelease = firstPublicRelease;
+  }
+
+  public String getLastUpdatedDate()
+  {
+    return lastUpdatedDate;
+  }
+
+  public void setLastUpdatedDate(String lastUpdatedDate)
+  {
+    this.lastUpdatedDate = lastUpdatedDate;
+  }
+
+  public String getLastUpdatedRelease()
+  {
+    return lastUpdatedRelease;
+  }
+
+  public void setLastUpdatedRelease(String lastUpdatedRelease)
+  {
+    this.lastUpdatedRelease = lastUpdatedRelease;
+  }
+
+  public String getDataClass()
+  {
+    return dataClass;
+  }
+
+  public void setDataClass(String dataClass)
+  {
+    this.dataClass = dataClass;
+  }
 }
diff --git a/src/jalview/datamodel/xdb/embl/EmblFeature.java b/src/jalview/datamodel/xdb/embl/EmblFeature.java
index 7e503c9..51d740b 100644
--- a/src/jalview/datamodel/xdb/embl/EmblFeature.java
+++ b/src/jalview/datamodel/xdb/embl/EmblFeature.java
@@ -37,7 +37,7 @@ public class EmblFeature
 
   Vector<Qualifier> qualifiers;
 
-  Vector<EmblFeatureLocations> locations;
+  String location;
 
   /**
    * @return the dbRefs
@@ -57,20 +57,19 @@ public class EmblFeature
   }
 
   /**
-   * @return the locations
+   * @return the location
    */
-  public Vector<EmblFeatureLocations> getLocations()
+  public String getLocation()
   {
-    return locations;
+    return location;
   }
 
   /**
-   * @param locations
-   *          the locations to set
+   * @param loc
    */
-  public void setLocations(Vector<EmblFeatureLocations> locations)
+  public void setLocation(String loc)
   {
-    this.locations = locations;
+    this.location = loc;
   }
 
   /**
diff --git a/src/jalview/datamodel/xdb/embl/EmblFeatureLocElement.java b/src/jalview/datamodel/xdb/embl/EmblFeatureLocElement.java
deleted file mode 100644
index 134ce9e..0000000
--- a/src/jalview/datamodel/xdb/embl/EmblFeatureLocElement.java
+++ /dev/null
@@ -1,125 +0,0 @@
-/*
- * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
- * Copyright (C) $$Year-Rel$$ The Jalview Authors
- * 
- * This file is part of Jalview.
- * 
- * Jalview is free software: you can redistribute it and/or
- * modify it under the terms of the GNU General Public License 
- * as published by the Free Software Foundation, either version 3
- * of the License, or (at your option) any later version.
- *  
- * Jalview is distributed in the hope that it will be useful, but 
- * WITHOUT ANY WARRANTY; without even the implied warranty 
- * of MERCHANTABILITY or FITNESS FOR A PARTICULAR 
- * PURPOSE.  See the GNU General Public License for more details.
- * 
- * You should have received a copy of the GNU General Public License
- * along with Jalview.  If not, see <http://www.gnu.org/licenses/>.
- * The Jalview Authors are detailed in the 'AUTHORS' file.
- */
-package jalview.datamodel.xdb.embl;
-
-/**
- * Data model for a feature/location/locationElement read from an EMBL query
- * reply
- * 
- * @see embl_mapping.xml
- */
-public class EmblFeatureLocElement
-{
-  String type;
-
-  String accession;
-
-  String version;
-
-  boolean complement;
-
-  BasePosition basePositions[];
-
-  /**
-   * @return the accession
-   */
-  public String getAccession()
-  {
-    return accession;
-  }
-
-  /**
-   * @param accession
-   *          the accession to set
-   */
-  public void setAccession(String accession)
-  {
-    this.accession = accession;
-  }
-
-  /**
-   * @return the basePositions
-   */
-  public BasePosition[] getBasePositions()
-  {
-    return basePositions;
-  }
-
-  /**
-   * @param basePositions
-   *          the basePositions to set
-   */
-  public void setBasePositions(BasePosition[] basePositions)
-  {
-    this.basePositions = basePositions;
-  }
-
-  /**
-   * @return the complement
-   */
-  public boolean isComplement()
-  {
-    return complement;
-  }
-
-  /**
-   * @param complement
-   *          the complement to set
-   */
-  public void setComplement(boolean complement)
-  {
-    this.complement = complement;
-  }
-
-  /**
-   * @return the type
-   */
-  public String getType()
-  {
-    return type;
-  }
-
-  /**
-   * @param type
-   *          the type to set
-   */
-  public void setType(String type)
-  {
-    this.type = type;
-  }
-
-  /**
-   * @return the version
-   */
-  public String getVersion()
-  {
-    return version;
-  }
-
-  /**
-   * @param version
-   *          the version to set
-   */
-  public void setVersion(String version)
-  {
-    this.version = version;
-  }
-}
diff --git a/src/jalview/datamodel/xdb/embl/EmblFeatureLocations.java b/src/jalview/datamodel/xdb/embl/EmblFeatureLocations.java
deleted file mode 100644
index 9774004..0000000
--- a/src/jalview/datamodel/xdb/embl/EmblFeatureLocations.java
+++ /dev/null
@@ -1,191 +0,0 @@
-/*
- * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
- * Copyright (C) $$Year-Rel$$ The Jalview Authors
- * 
- * This file is part of Jalview.
- * 
- * Jalview is free software: you can redistribute it and/or
- * modify it under the terms of the GNU General Public License 
- * as published by the Free Software Foundation, either version 3
- * of the License, or (at your option) any later version.
- *  
- * Jalview is distributed in the hope that it will be useful, but 
- * WITHOUT ANY WARRANTY; without even the implied warranty 
- * of MERCHANTABILITY or FITNESS FOR A PARTICULAR 
- * PURPOSE.  See the GNU General Public License for more details.
- * 
- * You should have received a copy of the GNU General Public License
- * along with Jalview.  If not, see <http://www.gnu.org/licenses/>.
- * The Jalview Authors are detailed in the 'AUTHORS' file.
- */
-package jalview.datamodel.xdb.embl;
-
-import jalview.bin.Cache;
-import jalview.util.ArrayUtils;
-
-import java.util.Arrays;
-import java.util.Vector;
-
-/**
- * Data model for a &lt;location&gt; child element of a &lt;feature&gt; read
- * from an EMBL query reply
- * 
- * @see embl_mapping.xml
- * @see http://www.insdc.org/files/feature_table.html#3.4.2
- */
-public class EmblFeatureLocations
-{
-  Vector<EmblFeatureLocElement> locElements;
-
-  String locationType;
-
-  boolean locationComplement;
-
-  /**
-   * @return the locationComplement
-   */
-  public boolean isLocationComplement()
-  {
-    return locationComplement;
-  }
-
-  /**
-   * @param locationComplement
-   *          the locationComplement to set
-   */
-  public void setLocationComplement(boolean locationComplement)
-  {
-    this.locationComplement = locationComplement;
-  }
-
-  /**
-   * @return the locationType
-   */
-  public String getLocationType()
-  {
-    return locationType;
-  }
-
-  /**
-   * @param locationType
-   *          the locationType to set
-   */
-  public void setLocationType(String locationType)
-  {
-    this.locationType = locationType;
-  }
-
-  /**
-   * @return the locElements
-   */
-  public Vector<EmblFeatureLocElement> getLocElements()
-  {
-    return locElements;
-  }
-
-  /**
-   * @param locElements
-   *          the locElements to set
-   */
-  public void setLocElements(Vector<EmblFeatureLocElement> locElements)
-  {
-    this.locElements = locElements;
-  }
-
-  /**
-   * Return all location elements as start-end pairs (without accessions) TODO:
-   * pass back complement and 'less than or more than' range information Note:
-   * do not use this since it throws away any accessionIds associated with each
-   * location!
-   * 
-   * @return int[] { start1, end1, ... }
-   */
-  public int[] getElementRanges()
-  {
-    return getElementRanges(null);
-  }
-
-  /**
-   * Return all location elements concerning given accession as start-end pairs.
-   * If the CDS feature is on the forward strand, then start <= end, if on the
-   * reverse strand then start > end.
-   * 
-   * @param accession
-   *          the accession string for which locations are requested, or null
-   *          for all locations
-   * @return int[] { start1, end1, ... }
-   */
-  int[] getElementRanges(String accession)
-  {
-    int sepos = 0;
-    int[] se = new int[locElements.size() * 2];
-    if ("single".equalsIgnoreCase(locationType)
-            || "join".equalsIgnoreCase(locationType))
-    {
-      for (EmblFeatureLocElement loce : locElements)
-      {
-        if (accession == null || loce.accession != null
-                && accession.equals(loce.accession))
-        {
-          BasePosition bp[] = loce.getBasePositions();
-          if (bp.length == 2)
-          {
-            try
-            {
-              int start = Integer.parseInt(bp[0].getPos());
-              int end = Integer.parseInt(bp[1].getPos());
-              se[sepos++] = start;
-              se[sepos++] = end;
-            } catch (NumberFormatException e)
-            {
-              System.err
-                      .println("format error in EMBL CDS location basePosition: "
-                              + e.getMessage());
-            }
-          }
-          else
-          {
-            System.err
-                    .println("format error in EMBL CDS location, basePosition count = "
-                            + bp.length);
-          }
-        }
-      }
-    }
-    else if (locationType != null)
-    {
-      if (Cache.log != null)
-      {
-        Cache.log
-                .error("EmblFeatureLocations.getElementRanges cannot deal with locationType=='"
-                        + locationType + "'");
-      }
-      else
-      {
-        System.err
-                .println("EmblFeatureLocations.getElementRanges cannot deal with locationType=='"
-                        + locationType + "'");
-      }
-    }
-
-    if (sepos != se.length)
-    {
-      /*
-       * we failed to parse something - trim off null values
-       */
-      se = Arrays.copyOf(se, sepos);
-    }
-
-    /*
-     * If on the complement, reverse the ranges to [end, start, ...end1, start1].
-     * For an example of a joined complement, see (tRNA feature) CAGL0B00165r on
-     * http://www.ebi.ac.uk/ena/data/view/CR380948&display=xml
-     * http://www.ebi.ac.uk/Tools/dbfetch/dbfetch/embl/CR380948/emblxml
-     */
-    if (locationComplement)
-    {
-      ArrayUtils.reverseIntArray(se);
-    }
-    return se;
-  }
-}
diff --git a/src/jalview/datamodel/xdb/embl/EmblSequence.java b/src/jalview/datamodel/xdb/embl/EmblSequence.java
index 2a6fa84..92c424b 100644
--- a/src/jalview/datamodel/xdb/embl/EmblSequence.java
+++ b/src/jalview/datamodel/xdb/embl/EmblSequence.java
@@ -27,12 +27,8 @@ package jalview.datamodel.xdb.embl;
  */
 public class EmblSequence
 {
-  String version;
-
   String sequence;
 
-  String type;
-
   /**
    * @return the sequence
    */
@@ -47,40 +43,7 @@ public class EmblSequence
    */
   public void setSequence(String sequence)
   {
-    this.sequence = sequence;
-  }
-
-  /**
-   * @return the type
-   */
-  public String getType()
-  {
-    return type;
-  }
-
-  /**
-   * @param type
-   *          the type to set
-   */
-  public void setType(String type)
-  {
-    this.type = type;
-  }
-
-  /**
-   * @return the version
-   */
-  public String getVersion()
-  {
-    return version;
-  }
-
-  /**
-   * @param version
-   *          the version to set
-   */
-  public void setVersion(String version)
-  {
-    this.version = version;
+    // remove spaces introduced by unmarshalling of newline characters
+    this.sequence = sequence.replace(" ", "");
   }
 }
diff --git a/src/jalview/ext/rbvi/chimera/JalviewChimeraBinding.java b/src/jalview/ext/rbvi/chimera/JalviewChimeraBinding.java
index 1ce0d2b..944ef52 100644
--- a/src/jalview/ext/rbvi/chimera/JalviewChimeraBinding.java
+++ b/src/jalview/ext/rbvi/chimera/JalviewChimeraBinding.java
@@ -101,17 +101,13 @@ public abstract class JalviewChimeraBinding extends AAStructureBindingModel
 
   private String lastCommand;
 
-  private boolean loadedInline;
-
-  /**
+  /*
    * current set of model filenames loaded
    */
   String[] modelFileNames = null;
 
   String lastHighlightCommand;
 
-  private List<String> lastReply;
-
   /*
    * incremented every time a load notification is successfully handled -
    * lightweight mechanism for other threads to detect when they can start
@@ -617,7 +613,8 @@ public abstract class JalviewChimeraBinding extends AAStructureBindingModel
     if (lastCommand == null || !lastCommand.equals(command))
     {
       // trim command or it may never find a match in the replyLog!!
-      lastReply = viewer.sendChimeraCommand(command.trim(), logResponse);
+      List<String> lastReply = viewer.sendChimeraCommand(command.trim(),
+              logResponse);
       if (logResponse && debug)
       {
         log("Response from command ('" + command + "') was:\n" + lastReply);
@@ -715,17 +712,6 @@ public abstract class JalviewChimeraBinding extends AAStructureBindingModel
   // End StructureListener
   // //////////////////////////
 
-  public Color getColour(int atomIndex, int pdbResNum, String chain,
-          String pdbfile)
-  {
-    if (getModelNum(pdbfile) < 0)
-    {
-      return null;
-    }
-    log("get model / residue colour attribute unimplemented");
-    return null;
-  }
-
   /**
    * returns the current featureRenderer that should be used to colour the
    * structures
@@ -795,15 +781,6 @@ public abstract class JalviewChimeraBinding extends AAStructureBindingModel
   }
 
   /**
-   * map from string to applet
-   */
-  public Map getRegistryInfo()
-  {
-    // TODO Auto-generated method stub
-    return null;
-  }
-
-  /**
    * returns the current sequenceRenderer that should be used to colour the
    * structures
    * 
@@ -815,20 +792,18 @@ public abstract class JalviewChimeraBinding extends AAStructureBindingModel
           AlignmentViewPanel alignment);
 
   /**
-   * Construct and send a command to highlight zero, one or more atoms.
-   * 
-   * <pre>
-   * Done by generating a command like (to 'highlight' positions 44 and 46)
-   *   show #0:44,46.C
-   * </pre>
+   * Construct and send a command to highlight zero, one or more atoms. We do
+   * this by sending an "rlabel" command to show the residue label at that
+   * position.
    */
   @Override
   public void highlightAtoms(List<AtomSpec> atoms)
   {
-    if (atoms == null)
+    if (atoms == null || atoms.size() == 0)
     {
       return;
     }
+
     StringBuilder cmd = new StringBuilder(128);
     boolean first = true;
     boolean found = false;
@@ -843,7 +818,7 @@ public abstract class JalviewChimeraBinding extends AAStructureBindingModel
       {
         if (first)
         {
-          cmd.append("show #").append(cms.get(0).getModelNumber())
+          cmd.append("rlabel #").append(cms.get(0).getModelNumber())
                   .append(":");
         }
         else
@@ -851,7 +826,6 @@ public abstract class JalviewChimeraBinding extends AAStructureBindingModel
           cmd.append(",");
         }
         first = false;
-        cmd.append(cms.get(0).getModelNumber()).append(":");
         cmd.append(pdbResNum);
         if (!chain.equals(" "))
         {
@@ -863,19 +837,24 @@ public abstract class JalviewChimeraBinding extends AAStructureBindingModel
     String command = cmd.toString();
 
     /*
-     * Avoid repeated commands for the same residue
+     * avoid repeated commands for the same residue
      */
     if (command.equals(lastHighlightCommand))
     {
       return;
     }
 
-    viewerCommandHistory(false);
+    /*
+     * unshow the label for the previous residue
+     */
+    if (lastHighlightCommand != null)
+    {
+      viewer.sendChimeraCommand("~" + lastHighlightCommand, false);
+    }
     if (found)
     {
-      viewer.sendChimeraCommand(command.toString(), false);
+      viewer.sendChimeraCommand(command, false);
     }
-    viewerCommandHistory(true);
     this.lastHighlightCommand = command;
   }
 
diff --git a/src/jalview/gui/AlignFrame.java b/src/jalview/gui/AlignFrame.java
index 895f2f6..818c150 100644
--- a/src/jalview/gui/AlignFrame.java
+++ b/src/jalview/gui/AlignFrame.java
@@ -4680,6 +4680,17 @@ public class AlignFrame extends GAlignFrame implements DropTargetListener,
     return showp;
   }
 
+  /**
+   * Finds and displays cross-references for the selected sequences (protein
+   * products for nucleotide sequences, dna coding sequences for peptides).
+   * 
+   * @param sel
+   *          the sequences to show cross-references for
+   * @param dna
+   *          true if from a nucleotide alignment (so showing proteins)
+   * @param source
+   *          the database to show cross-references for
+   */
   protected void showProductsFor(final SequenceI[] sel, final boolean dna,
           final String source)
   {
@@ -4750,7 +4761,8 @@ public class AlignFrame extends GAlignFrame implements DropTargetListener,
                 System.err.println("Failed to make CDS alignment");
               }
               al.getCodonFrames().clear();
-              al.getCodonFrames().addAll(copyAlignment.getCodonFrames());
+              al.addCodonFrames(copyAlignment.getCodonFrames());
+              al.addCodonFrames(cf);
 
               /*
                * pending getting Embl transcripts to 'align', 
@@ -4768,7 +4780,9 @@ public class AlignFrame extends GAlignFrame implements DropTargetListener,
             {
               copyAlignment = AlignmentUtils.makeCopyAlignment(
                       sequenceSelection, xrefs.getSequencesArray());
-              copyAlignment.getCodonFrames().addAll(cf);
+              copyAlignment.addCodonFrames(cf);
+              al.addCodonFrames(copyAlignment.getCodonFrames());
+              al.addCodonFrames(cf);
             }
             copyAlignment.setGapCharacter(AlignFrame.this.viewport
                     .getGapCharacter());
diff --git a/src/jalview/gui/AnnotationLabels.java b/src/jalview/gui/AnnotationLabels.java
index 68df498..e27b919 100755
--- a/src/jalview/gui/AnnotationLabels.java
+++ b/src/jalview/gui/AnnotationLabels.java
@@ -802,8 +802,45 @@ public class AnnotationLabels extends JPanel implements MouseListener,
             // todo: make the ap scroll to the selection - not necessary, first
             // click highlights/scrolls, second selects
             ap.getSeqPanel().ap.getIdPanel().highlightSearchResults(null);
-            ap.av.setSelectionGroup(// new SequenceGroup(
-            aa[selectedRow].groupRef); // );
+            // process modifiers
+            SequenceGroup sg = ap.av.getSelectionGroup();
+            if (sg == null
+                    || sg == aa[selectedRow].groupRef
+                    || !(jalview.util.Platform.isControlDown(evt) || evt
+                            .isShiftDown()))
+            {
+              if (jalview.util.Platform.isControlDown(evt)
+                      || evt.isShiftDown())
+              {
+                // clone a new selection group from the associated group
+                ap.av.setSelectionGroup(new SequenceGroup(
+                        aa[selectedRow].groupRef));
+              }
+              else
+              {
+                // set selection to the associated group so it can be edited
+                ap.av.setSelectionGroup(aa[selectedRow].groupRef);
+              }
+            }
+            else
+            {
+              // modify current selection with associated group
+              int remainToAdd = aa[selectedRow].groupRef.getSize();
+              for (SequenceI sgs : aa[selectedRow].groupRef.getSequences())
+              {
+                if (jalview.util.Platform.isControlDown(evt))
+                {
+                  sg.addOrRemove(sgs, --remainToAdd == 0);
+                }
+                else
+                {
+                  // notionally, we should also add intermediate sequences from
+                  // last added sequence ?
+                  sg.addSequence(sgs, --remainToAdd == 0);
+                }
+              }
+            }
+
             ap.paintAlignment(false);
             PaintRefresher.Refresh(ap, ap.av.getSequenceSetId());
             ap.av.sendSelection();
@@ -833,7 +870,8 @@ public class AnnotationLabels extends JPanel implements MouseListener,
               // we make a copy rather than edit the current selection if no
               // modifiers pressed
               // see Enhancement JAL-1557
-              if (!(evt.isControlDown() || evt.isShiftDown()))
+              if (!(jalview.util.Platform.isControlDown(evt) || evt
+                      .isShiftDown()))
               {
                 sg = new SequenceGroup(sg);
                 sg.clear();
@@ -841,7 +879,7 @@ public class AnnotationLabels extends JPanel implements MouseListener,
               }
               else
               {
-                if (evt.isControlDown())
+                if (jalview.util.Platform.isControlDown(evt))
                 {
                   sg.addOrRemove(aa[selectedRow].sequenceRef, true);
                 }
@@ -861,9 +899,9 @@ public class AnnotationLabels extends JPanel implements MouseListener,
               sg.addSequence(aa[selectedRow].sequenceRef, false);
             }
             ap.av.setSelectionGroup(sg);
-            ap.av.sendSelection();
             ap.paintAlignment(false);
             PaintRefresher.Refresh(ap, ap.av.getSequenceSetId());
+            ap.av.sendSelection();
           }
 
         }
diff --git a/src/jalview/gui/IdPanel.java b/src/jalview/gui/IdPanel.java
index c84505b..61ddafb 100755
--- a/src/jalview/gui/IdPanel.java
+++ b/src/jalview/gui/IdPanel.java
@@ -349,10 +349,9 @@ public class IdPanel extends JPanel implements MouseListener,
 
       return;
     }
-
     if ((av.getSelectionGroup() == null)
-            || ((!e.isControlDown() && !e.isShiftDown()) && av
-                    .getSelectionGroup() != null))
+            || (!jalview.util.Platform.isControlDown(e)
+                    && !e.isShiftDown() && av.getSelectionGroup() != null))
     {
       av.setSelectionGroup(new SequenceGroup());
       av.getSelectionGroup().setStartRes(0);
diff --git a/src/jalview/gui/SeqPanel.java b/src/jalview/gui/SeqPanel.java
index bd4b234..2d44a0f 100644
--- a/src/jalview/gui/SeqPanel.java
+++ b/src/jalview/gui/SeqPanel.java
@@ -1947,10 +1947,12 @@ public class SeqPanel extends JPanel implements MouseListener,
 
     // do we want to thread this ? (contention with seqsel and colsel locks, I
     // suspect)
-    // rules are: colsel is copied if there is a real intersection between
-    // sequence selection
+    /*
+     * only copy colsel if there is a real intersection between
+     * sequence selection and this panel's alignment
+     */
     boolean repaint = false;
-    boolean copycolsel = true;
+    boolean copycolsel = false;
 
     SequenceGroup sgroup = null;
     if (seqsel != null && seqsel.getSize() > 0)
@@ -1964,11 +1966,9 @@ public class SeqPanel extends JPanel implements MouseListener,
       }
       sgroup = seqsel.intersect(av.getAlignment(),
               (av.hasHiddenRows()) ? av.getHiddenRepSequences() : null);
-      if ((sgroup == null || sgroup.getSize() == 0)
-              || (colsel == null || colsel.isEmpty()))
+      if ((sgroup != null && sgroup.getSize() > 0))
       {
-        // don't copy columns if the region didn't intersect.
-        copycolsel = false;
+        copycolsel = true;
       }
     }
     if (sgroup != null && sgroup.getSize() > 0)
diff --git a/src/jalview/util/Platform.java b/src/jalview/util/Platform.java
index b812feb..786f5bf 100644
--- a/src/jalview/util/Platform.java
+++ b/src/jalview/util/Platform.java
@@ -20,6 +20,9 @@
  */
 package jalview.util;
 
+import java.awt.Toolkit;
+import java.awt.event.MouseEvent;
+
 /**
  * System platform information used by Applet and Application
  * 
@@ -74,4 +77,11 @@ public class Platform
     f.append(file.substring(lastp));
     return f.toString();
   }
+
+  public static boolean isControlDown(MouseEvent e)
+  {
+    return (jalview.util.Platform.isAMac() ? (Toolkit.getDefaultToolkit()
+            .getMenuShortcutKeyMask() & e.getModifiers()) != 0 : e
+            .isControlDown());
+  }
 }
diff --git a/src/jalview/ws/dbsources/EmblXmlSource.java b/src/jalview/ws/dbsources/EmblXmlSource.java
index 0085221..2049766 100644
--- a/src/jalview/ws/dbsources/EmblXmlSource.java
+++ b/src/jalview/ws/dbsources/EmblXmlSource.java
@@ -63,7 +63,7 @@ public abstract class EmblXmlSource extends EbiFileRetrievedProxy
     try
     {
       reply = dbFetch.fetchDataAsFile(
-              emprefx.toLowerCase() + ":" + query.trim(), "emblxml", null,
+              emprefx.toLowerCase() + ":" + query.trim(), "display=xml",
               ".xml");
     } catch (Exception e)
     {
diff --git a/src/jalview/ws/dbsources/Pdb.java b/src/jalview/ws/dbsources/Pdb.java
index b2063c1..c87a111 100644
--- a/src/jalview/ws/dbsources/Pdb.java
+++ b/src/jalview/ws/dbsources/Pdb.java
@@ -1,3 +1,4 @@
+
 /*
  * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
  * Copyright (C) $$Year-Rel$$ The Jalview Authors
@@ -136,7 +137,7 @@ public class Pdb extends EbiFileRetrievedProxy
             : ".xml";
     EBIFetchClient ebi = new EBIFetchClient();
     file = ebi.fetchDataAsFile("pdb:" + id,
-            getCurrentDefaultFormat().toLowerCase(), "raw", ext)
+            getCurrentDefaultFormat().toLowerCase(), ext)
             .getAbsolutePath();
     stopQuery();
     if (file == null)
diff --git a/src/jalview/ws/dbsources/Uniprot.java b/src/jalview/ws/dbsources/Uniprot.java
index 17f1842..8cc0ce4 100644
--- a/src/jalview/ws/dbsources/Uniprot.java
+++ b/src/jalview/ws/dbsources/Uniprot.java
@@ -165,7 +165,7 @@ public class Uniprot extends DbSourceProxyImpl
       // uniprotxml parameter required since december 2007
       // uniprotkb dbname changed introduced december 2008
       File file = ebi.fetchDataAsFile("uniprotkb:" + queries, "uniprotxml",
-              null, ".xml");
+              ".xml");
       Vector<UniprotEntry> entries = getUniprotEntries(new FileReader(file));
 
       if (entries != null)
diff --git a/src/jalview/ws/ebi/EBIFetchClient.java b/src/jalview/ws/ebi/EBIFetchClient.java
index 9f6bc65..1dff32f 100644
--- a/src/jalview/ws/ebi/EBIFetchClient.java
+++ b/src/jalview/ws/ebi/EBIFetchClient.java
@@ -42,9 +42,6 @@ import java.util.StringTokenizer;
  */
 public class EBIFetchClient
 {
-  String format = "default";
-
-  String style = "raw";
 
   /**
    * Creates a new EBIFetchClient object.
@@ -93,14 +90,13 @@ public class EBIFetchClient
    *          the query formatted as db:query1;query2;query3
    * @param format
    *          the format wanted
-   * @param s
-   *          - unused parameter
+   * @param extension
+   *          for the temporary file to hold response
    * @return the file holding the response
    * @throws OutOfMemoryError
    */
 
-  public File fetchDataAsFile(String ids, String format, String s,
-          String ext)
+  public File fetchDataAsFile(String ids, String format, String ext)
           throws OutOfMemoryError
   {
     File outFile = null;
@@ -108,7 +104,7 @@ public class EBIFetchClient
     {
       outFile = File.createTempFile("jalview", ext);
       outFile.deleteOnExit();
-      fetchData(ids, format, s, outFile);
+      fetchData(ids, format, outFile);
       if (outFile.length() == 0)
       {
         outFile.delete();
@@ -121,92 +117,92 @@ public class EBIFetchClient
   }
 
   /**
-   * Single DB multiple record retrieval
+   * Fetches queries and either saves the response to a file or returns as
+   * string data
    * 
    * @param ids
-   *          db:query1;query2;query3
    * @param format
-   *          raw/xml
-   * @param s
-   *          not used - remove?
-   * 
-   * @return Raw string array result of query set
+   * @param outFile
+   * @return
+   * @throws OutOfMemoryError
    */
-  public String[] fetchData(String ids, String format, String s)
+  String[] fetchData(String ids, String format, File outFile)
           throws OutOfMemoryError
   {
-    return fetchData(ids, format, s, null);
+    StringBuilder querystring = new StringBuilder(ids.length());
+    String database = parseIds(ids, querystring);
+    if (database == null)
+    {
+      System.err.println("Invalid Query string : '" + ids + "'");
+      System.err.println("Should be of form 'dbname:q1;q2;q3;q4'");
+      return null;
+    }
+
+    // note: outFile is currently always specified, so return value is null
+    String[] rslt = fetchBatch(querystring.toString(), database, format, outFile);
+
+    return (rslt != null && rslt.length > 0 ? rslt : null);
   }
 
-  String[] fetchData(String ids, String f, String s, File outFile)
-          throws OutOfMemoryError
+  /**
+   * Parses ids formatted as dbname:q1;q2;q3, returns the dbname and adds
+   * queries as comma-separated items to the querystring. dbname must be
+   * specified for at least one queryId. Returns null if a mixture of different
+   * dbnames is found (ignoring case).
+   * 
+   * @param ids
+   * @param queryString
+   * @return
+   */
+  static String parseIds(String ids, StringBuilder queryString)
   {
-    // Need to split
-    // ids of the form uniprot:25KD_SARPE;ADHR_DROPS;
-    String[] rslts = new String[0];
+    String database = null;
     StringTokenizer queries = new StringTokenizer(ids, ";");
-    String db = null;
-    StringBuffer querystring = null;
-    int nq = 0;
+    boolean appending = queryString.length() > 0;
     while (queries.hasMoreTokens())
     {
       String query = queries.nextToken();
-      int p;
-      if ((p = query.indexOf(':')) > -1)
+      int p = query.indexOf(':');
+      if (p > -1)
       {
-        db = query.substring(0, p);
+        String db = query.substring(0, p);
+        if (database != null && !db.equalsIgnoreCase(database))
+        {
+          /*
+           * different databases mixed in together - invalid
+           */
+          return null;
+        }
+        database = db;
         query = query.substring(p + 1);
       }
-      if (querystring == null)
-      {
-        querystring = new StringBuffer(query);
-        nq++;
-      }
-      else
-      {
-        querystring.append("," + query);
-        nq++;
-      }
-    }
-    if (db == null)
-    {
-      System.err.println("Invalid Query string : '" + ids
-              + "'\nShould be of form 'dbname:q1;q2;q3;q4'");
-      return null;
-    }
-    String[] rslt = fetchBatch(querystring.toString(), db, f, s, outFile);
-    if (rslt != null)
-    {
-      String[] nrslts = new String[rslt.length + rslts.length];
-      System.arraycopy(rslts, 0, nrslts, 0, rslts.length);
-      System.arraycopy(rslt, 0, nrslts, rslts.length, rslt.length);
-      rslts = nrslts;
+      queryString.append(appending ? "," : "");
+      queryString.append(query);
+      appending = true;
     }
-
-    return (rslts.length == 0 ? null : rslts);
+    return database;
   }
 
-  public String[] fetchBatch(String ids, String dbPath, String format, String s,
+  /**
+   * Fetches queries and either saves the response to a file or (if no file
+   * specified) returns as string data
+   * 
+   * @param ids
+   * @param database
+   * @param format
+   * @param outFile
+   * @return
+   * @throws OutOfMemoryError
+   */
+  String[] fetchBatch(String ids, String database, String format,
           File outFile) throws OutOfMemoryError
   {
     // long time = System.currentTimeMillis();
-    /*
-     * JAL-1855 dbfetch from ena_sequence, ena_coding
-     */
-    if (dbPath.equalsIgnoreCase(DBRefSource.EMBL))
-    {
-      dbPath = "ena_sequence";
-    }
-    else if (dbPath.equalsIgnoreCase(DBRefSource.EMBLCDS))
-    {
-      dbPath = "ena_coding";
-    }
+    String url = buildUrl(ids, database, format);
 
     try
     {
-      URL rcall = new URL("http://www.ebi.ac.uk/Tools/dbfetch/dbfetch/"
-              + dbPath.toLowerCase() + "/" + ids.toLowerCase()
-              + (format != null ? "/" + format : ""));
+      URL rcall = new URL(url);
 
       InputStream is = new BufferedInputStream(rcall.openStream());
       if (outFile != null)
@@ -234,8 +230,7 @@ public class EBIFetchClient
       }
     } catch (OutOfMemoryError er)
     {
-
-      System.out.println("OUT OF MEMORY DOWNLOADING QUERY FROM " + dbPath
+      System.out.println("OUT OF MEMORY DOWNLOADING QUERY FROM " + database
               + ":\n" + ids);
       throw er;
     } catch (Exception ex)
@@ -246,7 +241,7 @@ public class EBIFetchClient
         return null;
       }
       System.err.println("Unexpected exception when retrieving from "
-              + dbPath
+              + database
               + "\nQuery was : '" + ids + "'");
       ex.printStackTrace(System.err);
       return null;
@@ -257,4 +252,30 @@ public class EBIFetchClient
     }
     return null;
   }
+
+  /**
+   * Constructs the URL to fetch from
+   * 
+   * @param ids
+   * @param database
+   * @param format
+   * @return
+   */
+  static String buildUrl(String ids, String database, String format)
+  {
+    String url;
+    if (database.equalsIgnoreCase(DBRefSource.EMBL)
+            || database.equalsIgnoreCase(DBRefSource.EMBLCDS))
+    {
+      url = "http://www.ebi.ac.uk/ena/data/view/" + ids.toLowerCase()
+              + (format != null ? "&" + format : "");
+    }
+    else
+    {
+      url = "http://www.ebi.ac.uk/Tools/dbfetch/dbfetch/"
+              + database.toLowerCase() + "/" + ids.toLowerCase()
+              + (format != null ? "/" + format : "");
+    }
+    return url;
+  }
 }
diff --git a/test/jalview/datamodel/DBRefEntryTest.java b/test/jalview/datamodel/DBRefEntryTest.java
index b3376a6..ae6dcda 100644
--- a/test/jalview/datamodel/DBRefEntryTest.java
+++ b/test/jalview/datamodel/DBRefEntryTest.java
@@ -20,7 +20,9 @@
  */
 package jalview.datamodel;
 
+import static org.testng.AssertJUnit.assertEquals;
 import static org.testng.AssertJUnit.assertFalse;
+import static org.testng.AssertJUnit.assertSame;
 import static org.testng.AssertJUnit.assertTrue;
 
 import jalview.util.MapList;
@@ -60,4 +62,80 @@ public class DBRefEntryTest
     assertTrue(ref1.equalRef(ref2));
     assertTrue(ref2.equalRef(ref1));
   }
+
+  /**
+   * Tests for the method that may update a DBRefEntry from another with a
+   * mapping or 'real' version
+   */
+  @Test(groups = { "Functional" })
+  public void testUpdateFrom()
+  {
+    DBRefEntry ref1 = new DBRefEntry("UNIPROT", "1", "V71633");
+
+    assertFalse(ref1.updateFrom(null));
+
+    /*
+     * equivalent other dbref
+     */
+    DBRefEntry ref2 = new DBRefEntry("uniprot", "1", "v71633");
+    assertTrue(ref1.updateFrom(ref2));
+    assertEquals("UNIPROT", ref1.getSource()); // unchanged
+    assertEquals("V71633", ref1.getAccessionId()); // unchanged
+  
+    /*
+     * ref1 has no mapping, acquires mapping from ref2
+     */
+    Mapping map = new Mapping(new MapList(new int[] { 1, 3 }, new int[] {
+        1, 1 }, 3, 1));
+    ref2.setMap(map);
+    assertTrue(ref1.updateFrom(ref2));
+    assertSame(map, ref1.getMap()); // null mapping updated
+
+    /*
+     * ref1 has a mapping, does not acquire mapping from ref2
+     */
+    ref2.setMap(new Mapping(map));
+    assertTrue(ref1.updateFrom(ref2));
+    assertSame(map, ref1.getMap()); // non-null mapping not updated
+
+    /*
+     * ref2 has a different source, accession or version
+     */
+    ref2.setSource("pdb");
+    assertFalse(ref1.updateFrom(ref2));
+    ref2.setSource(ref1.getSource());
+    ref2.setAccessionId("P12345");
+    assertFalse(ref1.updateFrom(ref2));
+    ref2.setAccessionId(ref1.getAccessionId());
+    ref1.setVersion("2");
+    assertFalse(ref1.updateFrom(ref2));
+
+    /*
+     * a non-null version supersedes "0" or "source:0"
+     */
+    ref2.setVersion(null);
+    assertFalse(ref1.updateFrom(ref2));
+    assertEquals("2", ref1.getVersion());
+    ref2.setVersion("3");
+    ref1.setVersion("0");
+    assertTrue(ref1.updateFrom(ref2));
+    assertEquals("3", ref1.getVersion());
+    ref1.setVersion("UNIPROT:0");
+    assertTrue(ref1.updateFrom(ref2));
+    assertEquals("3", ref1.getVersion());
+
+    /*
+     * version "source:n" with n>0 is not superseded
+     */
+    ref1.setVersion("UNIPROT:1");
+    assertFalse(ref1.updateFrom(ref2));
+    assertEquals("UNIPROT:1", ref1.getVersion());
+
+    /*
+     * version "10" is not superseded
+     */
+    ref1.setVersion("10");
+    assertFalse(ref1.updateFrom(ref2));
+    assertEquals("10", ref1.getVersion());
+  }
 }
diff --git a/test/jalview/datamodel/SequenceTest.java b/test/jalview/datamodel/SequenceTest.java
index 03c4a96..17dfcdc 100644
--- a/test/jalview/datamodel/SequenceTest.java
+++ b/test/jalview/datamodel/SequenceTest.java
@@ -29,6 +29,7 @@ import static org.testng.AssertJUnit.assertTrue;
 import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
 
 import jalview.datamodel.PDBEntry.Type;
+import jalview.util.MapList;
 
 import java.util.ArrayList;
 import java.util.Arrays;
@@ -616,4 +617,85 @@ public class SequenceTest
     assertEquals(' ', sq.getCharAt(5));
     assertEquals(' ', sq.getCharAt(-1));
   }
+
+  /**
+   * Tests for adding (or updating) dbrefs
+   * 
+   * @see DBRefEntry#updateFrom(DBRefEntry)
+   */
+  @Test(groups = { "Functional" })
+  public void testAddDBRef()
+  {
+    SequenceI sq = new Sequence("", "abcde");
+    assertNull(sq.getDBRefs());
+    DBRefEntry dbref = new DBRefEntry("Uniprot", "1", "P00340");
+    sq.addDBRef(dbref);
+    assertEquals(1, sq.getDBRefs().length);
+    assertSame(dbref, sq.getDBRefs()[0]);
+
+    /*
+     * change of version - new entry
+     */
+    DBRefEntry dbref2 = new DBRefEntry("Uniprot", "2", "P00340");
+    sq.addDBRef(dbref2);
+    assertEquals(2, sq.getDBRefs().length);
+    assertSame(dbref, sq.getDBRefs()[0]);
+    assertSame(dbref2, sq.getDBRefs()[1]);
+
+    /*
+     * matches existing entry - not added
+     */
+    sq.addDBRef(new DBRefEntry("UNIPROT", "1", "p00340"));
+    assertEquals(2, sq.getDBRefs().length);
+
+    /*
+     * different source = new entry
+     */
+    DBRefEntry dbref3 = new DBRefEntry("UniRef", "1", "p00340");
+    sq.addDBRef(dbref3);
+    assertEquals(3, sq.getDBRefs().length);
+    assertSame(dbref3, sq.getDBRefs()[2]);
+
+    /*
+     * different ref = new entry
+     */
+    DBRefEntry dbref4 = new DBRefEntry("UniRef", "1", "p00341");
+    sq.addDBRef(dbref4);
+    assertEquals(4, sq.getDBRefs().length);
+    assertSame(dbref4, sq.getDBRefs()[3]);
+
+    /*
+     * matching ref with a mapping - map updated
+     */
+    DBRefEntry dbref5 = new DBRefEntry("UniRef", "1", "p00341");
+    Mapping map = new Mapping(new MapList(new int[] { 1, 3 }, new int[] {
+        1, 1 }, 3, 1));
+    dbref5.setMap(map);
+    sq.addDBRef(dbref5);
+    assertEquals(4, sq.getDBRefs().length);
+    assertSame(dbref4, sq.getDBRefs()[3]);
+    assertSame(map, dbref4.getMap());
+
+    /*
+     * 'real' version replaces "0" version
+     */
+    dbref2.setVersion("0");
+    DBRefEntry dbref6 = new DBRefEntry(dbref2.getSource(), "3",
+            dbref2.getAccessionId());
+    sq.addDBRef(dbref6);
+    assertEquals(4, sq.getDBRefs().length);
+    assertSame(dbref2, sq.getDBRefs()[1]);
+    assertEquals("3", dbref2.getVersion());
+
+    /*
+     * 'real' version replaces "source:0" version
+     */
+    dbref3.setVersion("Uniprot:0");
+    DBRefEntry dbref7 = new DBRefEntry(dbref3.getSource(), "3",
+            dbref3.getAccessionId());
+    sq.addDBRef(dbref7);
+    assertEquals(4, sq.getDBRefs().length);
+    assertSame(dbref3, sq.getDBRefs()[2]);
+    assertEquals("3", dbref2.getVersion());
+  }
 }
diff --git a/test/jalview/datamodel/xdb/embl/EmblEntryTest.java b/test/jalview/datamodel/xdb/embl/EmblEntryTest.java
index 9fffc45..e8760bd 100644
--- a/test/jalview/datamodel/xdb/embl/EmblEntryTest.java
+++ b/test/jalview/datamodel/xdb/embl/EmblEntryTest.java
@@ -3,10 +3,13 @@ package jalview.datamodel.xdb.embl;
 import static org.testng.AssertJUnit.assertEquals;
 import static org.testng.AssertJUnit.assertSame;
 
-import jalview.util.MappingUtils;
+import jalview.datamodel.DBRefEntry;
+import jalview.datamodel.Sequence;
+import jalview.datamodel.SequenceI;
 
+import java.util.ArrayList;
 import java.util.Arrays;
-import java.util.Vector;
+import java.util.List;
 
 import org.testng.annotations.Test;
 
@@ -21,288 +24,93 @@ public class EmblEntryTest
      * Make a (CDS) Feature with 4 locations
      */
     EmblFeature cds = new EmblFeature();
-    Vector<EmblFeatureLocations> locs = new Vector<EmblFeatureLocations>();
-    cds.setLocations(locs);
-
-    /*
-     * single range [10-20]
-     */
-    EmblFeatureLocations loc = new EmblFeatureLocations();
-    loc.setLocationType("single");
-    loc.setLocationComplement(false);
-    Vector<EmblFeatureLocElement> elements = new Vector<EmblFeatureLocElement>();
-    EmblFeatureLocElement locElement = new EmblFeatureLocElement();
-    BasePosition b1 = new BasePosition();
-    b1.setPos("10");
-    BasePosition b2 = new BasePosition();
-    b2.setPos("20");
-    locElement.setBasePositions(new BasePosition[] { b1, b2 });
-    elements.add(locElement);
-    loc.setLocElements(elements);
-    locs.add(loc);
-
-    /*
-     * complement range [30-40]
-     */
-    loc = new EmblFeatureLocations();
-    loc.setLocationType("single");
-    loc.setLocationComplement(true);
-    elements = new Vector<EmblFeatureLocElement>();
-    locElement = new EmblFeatureLocElement();
-    b1 = new BasePosition();
-    b1.setPos("30");
-    b2 = new BasePosition();
-    b2.setPos("40");
-    locElement.setBasePositions(new BasePosition[] { b1, b2 });
-    elements.add(locElement);
-    loc.setLocElements(elements);
-    locs.add(loc);
-
-    /*
-     * join range [50-60], [70-80]
-     */
-    loc = new EmblFeatureLocations();
-    loc.setLocationType("join");
-    loc.setLocationComplement(false);
-    elements = new Vector<EmblFeatureLocElement>();
-    locElement = new EmblFeatureLocElement();
-    b1 = new BasePosition();
-    b1.setPos("50");
-    b2 = new BasePosition();
-    b2.setPos("60");
-    locElement.setBasePositions(new BasePosition[] { b1, b2 });
-    elements.add(locElement);
-    locElement = new EmblFeatureLocElement();
-    b1 = new BasePosition();
-    b1.setPos("70");
-    b2 = new BasePosition();
-    b2.setPos("80");
-    locElement.setBasePositions(new BasePosition[] { b1, b2 });
-    elements.add(locElement);
-    loc.setLocElements(elements);
-    locs.add(loc);
-
-    /*
-     * complement range [90-100], [110-120]
-     * this should be the same as complement(join(90..100,110.120))
-     * which is "join 90-100 and 110-120, then complement"
-     */
-    loc = new EmblFeatureLocations();
-    loc.setLocationType("join");
-    loc.setLocationComplement(true);
-    elements = new Vector<EmblFeatureLocElement>();
-    locElement = new EmblFeatureLocElement();
-    b1 = new BasePosition();
-    b1.setPos("90");
-    b2 = new BasePosition();
-    b2.setPos("100");
-    locElement.setBasePositions(new BasePosition[] { b1, b2 });
-    elements.add(locElement);
-    locElement = new EmblFeatureLocElement();
-    b1 = new BasePosition();
-    b1.setPos("110");
-    b2 = new BasePosition();
-    b2.setPos("120");
-    locElement.setBasePositions(new BasePosition[] { b1, b2 });
-    elements.add(locElement);
-    loc.setLocElements(elements);
-    locs.add(loc);
+    cds.setLocation("join(10..20,complement(30..40),50..60,70..80,complement(110..120))");
 
     int[] exons = testee.getCdsRanges(cds);
-    assertEquals("[10, 20, 40, 30, 50, 60, 70, 80, 120, 110, 100, 90]",
+    assertEquals("[10, 20, 40, 30, 50, 60, 70, 80, 120, 110]",
             Arrays.toString(exons));
   }
 
   @Test(groups = "Functional")
-  public void testGetCdsRanges_badData()
+  public void testParseCodingFeature()
   {
-    EmblEntry testee = new EmblEntry();
+    // not the whole sequence but enough for this test...
+    SequenceI dna = new Sequence("J03321", "GGATCCGTAAGTTAGACGAAATT");
+    List<SequenceI> peptides = new ArrayList<SequenceI>();
+    EmblFile ef = EmblTestHelper.getEmblFile();
 
     /*
-     * Make a (CDS) Feature with 4 locations
-     */
-    EmblFeature cds = new EmblFeature();
-    Vector<EmblFeatureLocations> locs = new Vector<EmblFeatureLocations>();
-    cds.setLocations(locs);
-
-    /*
-     * single range [10-20]
-     */
-    EmblFeatureLocations loc = new EmblFeatureLocations();
-    loc.setLocationType("single");
-    loc.setLocationComplement(false);
-    Vector<EmblFeatureLocElement> elements = new Vector<EmblFeatureLocElement>();
-    EmblFeatureLocElement locElement = new EmblFeatureLocElement();
-    BasePosition b1 = new BasePosition();
-    b1.setPos("10");
-    BasePosition b2 = new BasePosition();
-    b2.setPos("20");
-    locElement.setBasePositions(new BasePosition[] { b1, b2 });
-    elements.add(locElement);
-    loc.setLocElements(elements);
-    locs.add(loc);
-
-    /*
-     * single range with missing end position - should be skipped
-     */
-    loc = new EmblFeatureLocations();
-    loc.setLocationType("single");
-    loc.setLocationComplement(false);
-    elements = new Vector<EmblFeatureLocElement>();
-    locElement = new EmblFeatureLocElement();
-    b1 = new BasePosition();
-    b1.setPos("30");
-    locElement.setBasePositions(new BasePosition[] { b1 });
-    elements.add(locElement);
-    loc.setLocElements(elements);
-    locs.add(loc);
-
-    /*
-     * single range with extra base position - should be skipped
+     * parse two CDS features, one with two Uniprot cross-refs,
+     * the other with one
      */
-    loc = new EmblFeatureLocations();
-    loc.setLocationType("single");
-    loc.setLocationComplement(false);
-    elements = new Vector<EmblFeatureLocElement>();
-    locElement = new EmblFeatureLocElement();
-    b1 = new BasePosition();
-    b1.setPos("30");
-    locElement.setBasePositions(new BasePosition[] { b1, b1, b1 });
-    elements.add(locElement);
-    loc.setLocElements(elements);
-    locs.add(loc);
-
-    /*
-     * single valid range [50-60] to finish
-     */
-    loc = new EmblFeatureLocations();
-    loc.setLocationType("single");
-    loc.setLocationComplement(false);
-    elements = new Vector<EmblFeatureLocElement>();
-    locElement = new EmblFeatureLocElement();
-    b1 = new BasePosition();
-    b1.setPos("50");
-    b2 = new BasePosition();
-    b2.setPos("60");
-    locElement.setBasePositions(new BasePosition[] { b1, b2 });
-    elements.add(locElement);
-    loc.setLocElements(elements);
-    locs.add(loc);
-
-    int[] exons = testee.getCdsRanges(cds);
-    assertEquals("[10, 20, 50, 60]", Arrays.toString(exons));
-  }
-
-  /**
-   * Test retrieval of exon locations matching an accession id
-   */
-  @Test(groups = "Functional")
-  public void testGetCdsRanges_forAccession()
-  {
     EmblEntry testee = new EmblEntry();
-    String accession = "A1234";
-    testee.setAccession(accession);
-    /*
-     * Make a (CDS) Feature with 4 locations
-     */
-    EmblFeature cds = new EmblFeature();
-    Vector<EmblFeatureLocations> locs = new Vector<EmblFeatureLocations>();
-    cds.setLocations(locs);
-  
-    /*
-     * single range [10-20] for 'this' accession
-     */
-    EmblFeatureLocations loc = new EmblFeatureLocations();
-    loc.setLocationType("single");
-    loc.setLocationComplement(false);
-    Vector<EmblFeatureLocElement> elements = new Vector<EmblFeatureLocElement>();
-    EmblFeatureLocElement locElement = new EmblFeatureLocElement();
-    locElement.setAccession(accession);
-    BasePosition b1 = new BasePosition();
-    b1.setPos("10");
-    BasePosition b2 = new BasePosition();
-    b2.setPos("20");
-    locElement.setBasePositions(new BasePosition[] { b1, b2 });
-    elements.add(locElement);
-    loc.setLocElements(elements);
-    locs.add(loc);
-  
-    /*
-     * complement range [30-40] - no accession
-     */
-    loc = new EmblFeatureLocations();
-    loc.setLocationType("single");
-    loc.setLocationComplement(true);
-    elements = new Vector<EmblFeatureLocElement>();
-    locElement = new EmblFeatureLocElement();
-    b1 = new BasePosition();
-    b1.setPos("30");
-    b2 = new BasePosition();
-    b2.setPos("40");
-    locElement.setBasePositions(new BasePosition[] { b1, b2 });
-    elements.add(locElement);
-    loc.setLocElements(elements);
-    locs.add(loc);
-  
-    /*
-     * join range [50-60] this accession, [70-80] another
-     */
-    loc = new EmblFeatureLocations();
-    loc.setLocationType("join");
-    loc.setLocationComplement(false);
-    elements = new Vector<EmblFeatureLocElement>();
-    locElement = new EmblFeatureLocElement();
-    locElement.setAccession(accession);
-    b1 = new BasePosition();
-    b1.setPos("50");
-    b2 = new BasePosition();
-    b2.setPos("60");
-    locElement.setBasePositions(new BasePosition[] { b1, b2 });
-    elements.add(locElement);
-    locElement = new EmblFeatureLocElement();
-    locElement.setAccession("notme");
-    b1 = new BasePosition();
-    b1.setPos("70");
-    b2 = new BasePosition();
-    b2.setPos("80");
-    locElement.setBasePositions(new BasePosition[] { b1, b2 });
-    elements.add(locElement);
-    loc.setLocElements(elements);
-    locs.add(loc);
-  
-    /*
-     * complement range [90-100] wrong accession, [110-120] good 
-     * this should be the same as complement(join(90..100,110.120))
-     * which is "join 90-100 and 110-120, then complement"
-     */
-    loc = new EmblFeatureLocations();
-    loc.setLocationType("join");
-    loc.setLocationComplement(true);
-    elements = new Vector<EmblFeatureLocElement>();
-    locElement = new EmblFeatureLocElement();
-    locElement.setAccession("wrong");
-    b1 = new BasePosition();
-    b1.setPos("90");
-    b2 = new BasePosition();
-    b2.setPos("100");
-    locElement.setBasePositions(new BasePosition[] { b1, b2 });
-    elements.add(locElement);
-    locElement = new EmblFeatureLocElement();
-    locElement.setAccession(accession);
-    b1 = new BasePosition();
-    b1.setPos("110");
-    b2 = new BasePosition();
-    b2.setPos("120");
-    locElement.setBasePositions(new BasePosition[] { b1, b2 });
-    elements.add(locElement);
-    loc.setLocElements(elements);
-    locs.add(loc);
-  
-    /*
-     * verify we pick out only ranges for A1234
-     */
-    int[] exons = testee.getCdsRanges(cds);
-    assertEquals("[10, 20, 50, 60, 120, 110]",
-            Arrays.toString(exons));
+    for (EmblFeature feature : ef.getEntries().get(0).getFeatures())
+    {
+      if ("CDS".equals(feature.getName()))
+      {
+        testee.parseCodingFeature(feature, "EMBL", dna, peptides);
+      }
+    }
+
+    /*
+     * peptides should now have five entries:
+     * EMBL product and two Uniprot accessions for the first CDS / translation
+     * EMBL product and one Uniprot accession for the second CDS / translation
+     */
+    assertEquals(5, peptides.size());
+    assertEquals("CAA30420.1", peptides.get(0).getName());
+    assertEquals("MLCF", peptides.get(0).getSequenceAsString());
+    assertEquals("UNIPROT|B0BCM4", peptides.get(1).getName());
+    assertEquals("MLCF", peptides.get(1).getSequenceAsString());
+    assertEquals("UNIPROT|P0CE20", peptides.get(2).getName());
+    assertEquals("MLCF", peptides.get(2).getSequenceAsString());
+    assertEquals("CAA30421.1", peptides.get(3).getName());
+    assertEquals("MSSS", peptides.get(3).getSequenceAsString());
+    assertEquals("UNIPROT|B0BCM3", peptides.get(4).getName());
+    assertEquals("MSSS", peptides.get(4).getSequenceAsString());
+
+    /*
+     * verify dna sequence has dbrefs with mappings to the peptide 'products'
+     */
+    DBRefEntry[] dbrefs = dna.getDBRefs();
+    assertEquals(3, dbrefs.length);
+    DBRefEntry dbRefEntry = dbrefs[0];
+    assertEquals("UNIPROT", dbRefEntry.getSource());
+    assertEquals("B0BCM4", dbRefEntry.getAccessionId());
+    assertSame(peptides.get(1), dbRefEntry.getMap().getTo());
+    List<int[]> fromRanges = dbRefEntry.getMap().getMap().getFromRanges();
+    assertEquals(1, fromRanges.size());
+    assertEquals(57, fromRanges.get(0)[0]);
+    assertEquals(46, fromRanges.get(0)[1]);
+    List<int[]> toRanges = dbRefEntry.getMap().getMap().getToRanges();
+    assertEquals(1, toRanges.size());
+    assertEquals(1, toRanges.get(0)[0]);
+    assertEquals(4, toRanges.get(0)[1]);
+
+    dbRefEntry = dbrefs[1];
+    assertEquals("UNIPROT", dbRefEntry.getSource());
+    assertEquals("P0CE20", dbRefEntry.getAccessionId());
+    assertSame(peptides.get(2), dbRefEntry.getMap().getTo());
+    fromRanges = dbRefEntry.getMap().getMap().getFromRanges();
+    assertEquals(1, fromRanges.size());
+    assertEquals(57, fromRanges.get(0)[0]);
+    assertEquals(46, fromRanges.get(0)[1]);
+    toRanges = dbRefEntry.getMap().getMap().getToRanges();
+    assertEquals(1, toRanges.size());
+    assertEquals(1, toRanges.get(0)[0]);
+    assertEquals(4, toRanges.get(0)[1]);
+
+    dbRefEntry = dbrefs[2];
+    assertEquals("UNIPROT", dbRefEntry.getSource());
+    assertEquals("B0BCM3", dbRefEntry.getAccessionId());
+    assertSame(peptides.get(4), dbRefEntry.getMap().getTo());
+    fromRanges = dbRefEntry.getMap().getMap().getFromRanges();
+    assertEquals(1, fromRanges.size());
+    assertEquals(4, fromRanges.get(0)[0]);
+    assertEquals(15, fromRanges.get(0)[1]);
+    toRanges = dbRefEntry.getMap().getMap().getToRanges();
+    assertEquals(1, toRanges.size());
+    assertEquals(1, toRanges.get(0)[0]);
+    assertEquals(4, toRanges.get(0)[1]);
   }
 }
diff --git a/test/jalview/datamodel/xdb/embl/EmblFileTest.java b/test/jalview/datamodel/xdb/embl/EmblFileTest.java
index c6a94d7..6955833 100644
--- a/test/jalview/datamodel/xdb/embl/EmblFileTest.java
+++ b/test/jalview/datamodel/xdb/embl/EmblFileTest.java
@@ -21,61 +21,49 @@
 package jalview.datamodel.xdb.embl;
 
 import static org.testng.AssertJUnit.assertEquals;
-import static org.testng.AssertJUnit.assertFalse;
 import static org.testng.AssertJUnit.assertNull;
-import static org.testng.AssertJUnit.assertTrue;
 
 import jalview.datamodel.DBRefEntry;
 
-import java.io.StringReader;
 import java.util.Vector;
 
 import org.testng.annotations.Test;
 
 public class EmblFileTest
 {
-  // adapted from http://www.ebi.ac.uk/Tools/dbfetch/dbfetch/embl/x53828/emblxml
-  private static final String TESTDATA = "<?xml version=\"1.0\" encoding=\"UTF-8\" ?>"
-          + "<EMBL_Services>"
-          + "<entry accession=\"X53828\" version=\"3\" lastUpdated=\"2005-04-18\" releaseCreated=\"25\" releaseLastUpdated=\"83\">"
-          + "<description>Chicken LDH-A mRNA for lactate dehydrogenase A chain (EC 1.1.1.27)</description>"
-          + "<keyword>L-lactate dehydrogenase</keyword><keyword>chutney</keyword>"
-          + "<dbreference db=\"EuropePMC\" primary=\"PMC1460223\" secondary=\"9649548\" />"
-          + "<dbreference db=\"MD5\" primary=\"d3b68\" />"
-          + "<feature name=\"CDS\"><dbreference db=\"GOA\" primary=\"P00340\" secondary=\"2.1\" /><dbreference db=\"InterPro\" primary=\"IPR001236\" />"
-          + "<qualifier name=\"note\"><value>L-lactate dehydrogenase A-chain</value><value>pickle</value></qualifier>"
-          + "<qualifier name=\"translation\"><value>MSLKDHLIHN</value><evidence>Keith</evidence></qualifier>"
-          + "<location type=\"single\" complement=\"true\">"
-          + "<locationElement type=\"range\" accession=\"X53828\" version=\"1\" complement=\"false\">"
-          + "<basePosition type=\"simple\">60</basePosition><basePosition type=\"join\">1058</basePosition>"
-          + "</locationElement></location></feature>"
-          + "<sequence type=\"mRNA\" version=\"2\">GTGACG</sequence></entry></EMBL_Services>";
 
   @Test(groups = { "Functional" })
   public void testGetEmblFile()
   {
-    Vector<EmblEntry> entries = EmblFile.getEmblFile(
-            new StringReader(TESTDATA)).getEntries();
+    Vector<EmblEntry> entries = EmblTestHelper.getEmblFile().getEntries();
     assertEquals(1, entries.size());
     EmblEntry entry = entries.get(0);
 
-    assertEquals("X53828", entry.getAccession());
-    assertEquals(
-            "Chicken LDH-A mRNA for lactate dehydrogenase A chain (EC 1.1.1.27)",
-            entry.getDesc());
-    assertEquals("2005-04-18", entry.getLastUpdated());
+    assertEquals("X07547", entry.getAccession());
+    assertEquals("C. trachomatis plasmid", entry.getDescription());
+    assertEquals("STD", entry.getDataClass());
+    assertEquals("PRO", entry.getTaxonomicDivision());
+    assertEquals("1999-02-10", entry.getLastUpdatedDate());
+    assertEquals("58", entry.getLastUpdatedRelease());
+    assertEquals("1988-11-10", entry.getFirstPublicDate());
+    assertEquals("18", entry.getFirstPublicRelease());
+    assertEquals("genomic DNA", entry.getMoleculeType());
+    assertEquals("1", entry.getSequenceVersion());
+    assertEquals("8", entry.getEntryVersion());
+    assertEquals("linear", entry.getTopology());
+    assertEquals("7499", entry.getSequenceLength());
 
     /*
      * FIXME these assertions fail - values are null - why?? Adding or removing
      * attributes in the test XML modifies behaviour. eg. inserting an attribute
      * _before_ lastUpdated results in a null value in this field.
      */
-    // assertEquals("25", entry.getRCreated());
-    // assertEquals("83", entry.getRLastUpdated());
+    assertEquals("1988-11-10", entry.getFirstPublicDate());
+    assertEquals("18", entry.getFirstPublicRelease());
 
     assertEquals(2, entry.getKeywords().size());
-    assertEquals("L-lactate dehydrogenase", entry.getKeywords().get(0));
-    assertEquals("chutney", entry.getKeywords().get(1));
+    assertEquals("plasmid", entry.getKeywords().get(0));
+    assertEquals("unidentified reading frame", entry.getKeywords().get(1));
 
     /*
      * dbrefs
@@ -83,72 +71,81 @@ public class EmblFileTest
     assertEquals(2, entry.getDbRefs().size());
     DBRefEntry dbref = entry.getDbRefs().get(0);
     assertEquals("EuropePMC", dbref.getSource());
-    assertEquals("PMC1460223", dbref.getAccessionId());
-    assertEquals("9649548", dbref.getVersion());
+    assertEquals("PMC107176", dbref.getAccessionId());
+    assertEquals("9573186", dbref.getVersion());
     dbref = entry.getDbRefs().get(1);
     assertEquals("MD5", dbref.getSource());
-    assertEquals("d3b68", dbref.getAccessionId());
+    assertEquals("ac73317", dbref.getAccessionId());
     // blank version has been converted to "0"
     assertEquals("0", dbref.getVersion());
 
     /*
-     * sequence features
+     * two sequence features for CDS
+     */
+    assertEquals(2, entry.getFeatures().size());
+    /*
+     * first CDS
      */
-    assertEquals(1, entry.getFeatures().size());
     EmblFeature ef = entry.getFeatures().get(0);
     assertEquals("CDS", ef.getName());
+    assertEquals("complement(46..57)", ef.getLocation());
     assertEquals(2, ef.getDbRefs().size());
     dbref = ef.getDbRefs().get(0);
-    assertEquals("GOA", dbref.getSource());
-    assertEquals("P00340", dbref.getAccessionId());
+    assertEquals("UniProtKB/Swiss-Prot", dbref.getSource());
+    assertEquals("B0BCM4", dbref.getAccessionId());
     assertEquals("2.1", dbref.getVersion());
     dbref = ef.getDbRefs().get(1);
-    assertEquals("InterPro", dbref.getSource());
-    assertEquals("IPR001236", dbref.getAccessionId());
-    // blank version converted to "0":
+    assertEquals("UniProtKB/Swiss-Prot", dbref.getSource());
+    assertEquals("P0CE20", dbref.getAccessionId());
+    // blank version gets converted to "0":
     assertEquals("0", dbref.getVersion());
-    assertEquals(2, ef.getQualifiers().size());
-
-    // feature qualifiers
+    // CDS feature qualifiers
+    assertEquals(3, ef.getQualifiers().size());
     Qualifier q = ef.getQualifiers().get(0);
     assertEquals("note", q.getName());
     assertEquals(2, q.getValues().length);
-    assertEquals("L-lactate dehydrogenase A-chain", q.getValues()[0]);
+    assertEquals("ORF 8 (AA 1-330)", q.getValues()[0]);
     assertEquals("pickle", q.getValues()[1]);
     assertNull(q.getEvidence());
     q = ef.getQualifiers().get(1);
+    assertEquals("protein_id", q.getName());
+    assertEquals(1, q.getValues().length);
+    assertEquals("CAA30420.1", q.getValues()[0]);
+    q = ef.getQualifiers().get(2);
     assertEquals("translation", q.getName());
     assertEquals(1, q.getValues().length);
-    assertEquals("MSLKDHLIHN", q.getValues()[0]);
+    assertEquals("MLCF", q.getValues()[0]);
     assertEquals(1, q.getEvidence().length);
     assertEquals("Keith", q.getEvidence()[0]);
 
-    // feature locations
-    assertEquals(1, ef.getLocations().size());
-    EmblFeatureLocations fl = ef.getLocations().get(0);
-    assertEquals("single", fl.getLocationType());
-    assertTrue(fl.isLocationComplement());
-    assertEquals(1, fl.getLocElements().size());
-    EmblFeatureLocElement le = fl.getLocElements().get(0);
-    assertEquals("range", le.getType());
-    assertEquals("X53828", le.getAccession());
-    assertEquals("1", le.getVersion());
-    assertFalse(le.isComplement());
-    assertEquals(2, le.getBasePositions().length);
-    BasePosition bp = le.getBasePositions()[0];
-    assertEquals("simple", bp.getType());
-    assertEquals("60", bp.getPos());
-    bp = le.getBasePositions()[1];
-    assertEquals("join", bp.getType());
-    assertEquals("1058", bp.getPos());
+    /*
+     * second CDS
+     */
+    ef = entry.getFeatures().get(1);
+    assertEquals("CDS", ef.getName());
+    assertEquals("4..15", ef.getLocation());
+    assertEquals(1, ef.getDbRefs().size());
+    dbref = ef.getDbRefs().get(0);
+    assertEquals("UniProtKB/Swiss-Prot", dbref.getSource());
+    assertEquals("B0BCM3", dbref.getAccessionId());
+    assertEquals("0", dbref.getVersion());
+    assertEquals(2, ef.getQualifiers().size());
+    q = ef.getQualifiers().get(0);
+    assertEquals("protein_id", q.getName());
+    assertEquals(1, q.getValues().length);
+    assertEquals("CAA30421.1", q.getValues()[0]);
+    q = ef.getQualifiers().get(1);
+    assertEquals("translation", q.getName());
+    assertEquals(1, q.getValues().length);
+    assertEquals("MSSS", q.getValues()[0]);
 
     /*
-     * Sequence
+     * Sequence - verify newline not converted to space (JAL-2029)
      */
     EmblSequence seq = entry.getSequence();
-    assertEquals("mRNA", seq.getType());
-    assertEquals("2", seq.getVersion());
-    assertEquals("GTGACG", seq.getSequence());
+    assertEquals(
+            "GGTATGTCCTCTAGTACAAACACCCCCAATATTGTGATATAATTAAAAACATAGCAT",
+            seq.getSequence());
 
     /*
      * getSequence() converts empty DBRefEntry.version to "0"
diff --git a/test/jalview/datamodel/xdb/embl/EmblTestHelper.java b/test/jalview/datamodel/xdb/embl/EmblTestHelper.java
new file mode 100644
index 0000000..9957c72
--- /dev/null
+++ b/test/jalview/datamodel/xdb/embl/EmblTestHelper.java
@@ -0,0 +1,53 @@
+package jalview.datamodel.xdb.embl;
+
+import java.io.StringReader;
+
+public class EmblTestHelper
+{
+  // adapted from http://www.ebi.ac.uk/ena/data/view/X07547&display=xml
+  // dna and translations truncated for convenience
+  private static final String TESTDATA = "<?xml version=\"1.0\" encoding=\"UTF-8\" ?>"
+          + "<ROOT>"
+          + "<entry accession=\"X07547\" version=\"1\" entryVersion=\"8\""
+          + " dataClass=\"STD\" taxonomicDivision=\"PRO\""
+          + " moleculeType=\"genomic DNA\" sequenceLength=\"7499\" topology=\"linear\""
+          + " firstPublic=\"1988-11-10\" firstPublicRelease=\"18\""
+          + " lastUpdated=\"1999-02-10\" lastUpdatedRelease=\"58\">"
+          + "<secondaryAccession>X07574</secondaryAccession>"
+          + "<description>C. trachomatis plasmid</description>"
+          + "<keyword>plasmid</keyword><keyword>unidentified reading frame</keyword>"
+          + "<xref db=\"EuropePMC\" id=\"PMC107176\" secondaryId=\"9573186\" />"
+          + "<xref db=\"MD5\" id=\"ac73317\" />"
+          /*
+           * first CDS (range and translation changed to keep test data manageable)
+           */
+          + "<feature name=\"CDS\" location=\"complement(46..57)\">"
+          // test the case of >1 cross-ref to the same database (JAL-2029)
+          + "<xref db=\"UniProtKB/Swiss-Prot\" id=\"B0BCM4\" secondaryId=\"2.1\" />"
+          + "<xref db=\"UniProtKB/Swiss-Prot\" id=\"P0CE20\" />"
+          + "<qualifier name=\"note\"><value>ORF 8 (AA 1-330)</value><value>pickle</value></qualifier>"
+          + "<qualifier name=\"protein_id\"><value>CAA30420.1</value></qualifier>"
+          + "<qualifier name=\"translation\"><value>MLCF</value><evidence>Keith</evidence></qualifier>"
+          + "</feature>"
+          /*
+           * second CDS (range and translation changed to keep test data manageable)
+           */
+          + "<feature name=\"CDS\" location=\"4..15\">"
+          + "<xref db=\"UniProtKB/Swiss-Prot\" id=\"B0BCM3\" />"
+          + "<qualifier name=\"protein_id\"><value>CAA30421.1</value></qualifier>"
+          + "<qualifier name=\"translation\"><value>MSSS</value></qualifier>"
+          + "</feature>"
+          /*
+           * sequence (modified for test purposes)
+           * emulates EMBL XML 1.2 which splits sequence data every 60 characters
+           * see EmblSequence.setSequence
+           */
+          + "<sequence>GGTATGTCCTCTAGTACAAAC\n"
+          + "ACCCCCAATATTGTGATATAATTAAAAACATAGCAT"
+          + "</sequence></entry></ROOT>";
+
+  static EmblFile getEmblFile()
+  {
+    return EmblFile.getEmblFile(new StringReader(TESTDATA));
+  }
+}
diff --git a/test/jalview/ws/ebi/EBIFetchClientTest.java b/test/jalview/ws/ebi/EBIFetchClientTest.java
new file mode 100644
index 0000000..4eaa5b1
--- /dev/null
+++ b/test/jalview/ws/ebi/EBIFetchClientTest.java
@@ -0,0 +1,113 @@
+package jalview.ws.ebi;
+
+import static org.testng.AssertJUnit.assertEquals;
+import static org.testng.AssertJUnit.assertNull;
+
+import org.testng.annotations.Test;
+
+public class EBIFetchClientTest
+{
+  /**
+   * Test method that constructs URL to fetch from
+   */
+  @Test(groups = "Functional")
+  public void testBuildUrl()
+  {
+    /*
+     * EMBL
+     */
+    assertEquals("http://www.ebi.ac.uk/ena/data/view/x53838&display=xml",
+            EBIFetchClient.buildUrl("X53838", "EMBL", "display=xml"));
+
+    /*
+     * EMBLCDS
+     */
+    assertEquals("http://www.ebi.ac.uk/ena/data/view/caa37824&display=xml",
+            EBIFetchClient.buildUrl("CAA37824", "EMBL", "display=xml"));
+
+    /*
+     * Uniprot
+     */
+    assertEquals(
+            "http://www.ebi.ac.uk/Tools/dbfetch/dbfetch/uniprot/p00340/uniprotxml",
+            EBIFetchClient.buildUrl("P00340", "UNIPROT", "uniprotxml"));
+
+    /*
+     * PDB / pdb
+     */
+    assertEquals("http://www.ebi.ac.uk/Tools/dbfetch/dbfetch/pdb/3a6s/pdb",
+            EBIFetchClient.buildUrl("3A6S", "PDB", "pdb"));
+
+    /*
+     * PDB / mmCIF
+     */
+    assertEquals(
+            "http://www.ebi.ac.uk/Tools/dbfetch/dbfetch/pdb/3a6s/mmCIF",
+            EBIFetchClient.buildUrl("3A6S", "PDB", "mmCIF"));
+  }
+
+  /**
+   * Test method that parses db:id;id;id
+   */
+  @Test(groups = "Functional")
+  public void testParseIds()
+  {
+    /*
+     * pdb, two accessions
+     */
+    StringBuilder queries = new StringBuilder();
+    String db = EBIFetchClient.parseIds("pdb:3a6s;1A70", queries);
+    assertEquals("pdb", db);
+    assertEquals("3a6s,1A70", queries.toString());
+
+    /*
+     * pdb specified on second accession
+     */
+    queries.setLength(0);
+    queries = new StringBuilder();
+    db = EBIFetchClient.parseIds("3a6s;pdb:1A70", queries);
+    assertEquals("pdb", db);
+    assertEquals("3a6s,1A70", queries.toString());
+
+    /*
+     * uniprot, one accession
+     */
+    queries.setLength(0);
+    db = EBIFetchClient.parseIds("uniprot:P00340", queries);
+    assertEquals("uniprot", db);
+    assertEquals("P00340", queries.toString());
+
+    /*
+     * uniprot, one accession, appending to existing queries
+     */
+    queries.setLength(0);
+    queries.append("P30419");
+    db = EBIFetchClient.parseIds("uniprot:P00340", queries);
+    assertEquals("uniprot", db);
+    assertEquals("P30419,P00340", queries.toString());
+
+    /*
+     * pdb and uniprot mixed - rejected
+     */
+    queries.setLength(0);
+    db = EBIFetchClient.parseIds("pdb:3a6s;1a70;uniprot:P00340", queries);
+    assertNull(db);
+    assertEquals("3a6s,1a70", queries.toString());
+
+    /*
+     * pdb and PDB mixed - ok
+     */
+    queries.setLength(0);
+    db = EBIFetchClient.parseIds("pdb:3a6s;pdb:1a70;PDB:1QIP", queries);
+    assertEquals("PDB", db);
+    assertEquals("3a6s,1a70,1QIP", queries.toString());
+
+    /*
+     * no database (improper format)
+     */
+    queries.setLength(0);
+    db = EBIFetchClient.parseIds("P00340", queries);
+    assertNull(db);
+    assertEquals("P00340", queries.toString());
+  }
+}