From: gmungoc Date: Fri, 20 Oct 2017 13:26:36 +0000 (+0100) Subject: Push 1793 latest to spike branch X-Git-Tag: Release_2_11_0~62^2~24 X-Git-Url: http://source.jalview.org/gitweb/?a=commitdiff_plain;h=353109c11d706b29ae5bc9606f0e12223aa45a98;p=jalview.git Push 1793 latest to spike branch --- diff --git a/.classpath b/.classpath index c4a2832..441ba60 100644 --- a/.classpath +++ b/.classpath @@ -48,11 +48,9 @@ - - @@ -69,5 +67,7 @@ + + diff --git a/.settings/org.eclipse.jdt.core.prefs b/.settings/org.eclipse.jdt.core.prefs index 8a5e7a7..5908bb2 100644 --- a/.settings/org.eclipse.jdt.core.prefs +++ b/.settings/org.eclipse.jdt.core.prefs @@ -1,15 +1,15 @@ eclipse.preferences.version=1 org.eclipse.jdt.core.compiler.codegen.inlineJsrBytecode=enabled org.eclipse.jdt.core.compiler.codegen.methodParameters=do not generate -org.eclipse.jdt.core.compiler.codegen.targetPlatform=1.7 +org.eclipse.jdt.core.compiler.codegen.targetPlatform=1.8 org.eclipse.jdt.core.compiler.codegen.unusedLocal=preserve -org.eclipse.jdt.core.compiler.compliance=1.7 +org.eclipse.jdt.core.compiler.compliance=1.8 org.eclipse.jdt.core.compiler.debug.lineNumber=generate org.eclipse.jdt.core.compiler.debug.localVariable=generate org.eclipse.jdt.core.compiler.debug.sourceFile=generate org.eclipse.jdt.core.compiler.problem.assertIdentifier=error org.eclipse.jdt.core.compiler.problem.enumIdentifier=error -org.eclipse.jdt.core.compiler.source=1.7 +org.eclipse.jdt.core.compiler.source=1.8 org.eclipse.jdt.core.formatter.align_type_members_on_columns=false org.eclipse.jdt.core.formatter.alignment_for_arguments_in_allocation_expression=16 org.eclipse.jdt.core.formatter.alignment_for_arguments_in_annotation=52 diff --git a/RELEASE b/RELEASE index e6b0cf8..cecefec 100644 --- a/RELEASE +++ b/RELEASE @@ -1,2 +1,2 @@ jalview.release=releases/Release_2_10_2b1_Branch -jalview.version=2.10.2b1 +jalview.version=2.10.2b2 diff --git a/build.xml b/build.xml index eb30ef0..f39fdf3 100755 --- a/build.xml +++ b/build.xml @@ -425,7 +425,7 @@ - + @@ -450,9 +450,9 @@ - + - j2se version="1.9+" + j2se version="1.7+" diff --git a/help/html/releases.html b/help/html/releases.html index 1b8ca87..8e55ca1 100755 --- a/help/html/releases.html +++ b/help/html/releases.html @@ -82,14 +82,34 @@ li:before { rendering of sequence features - +
  • Protein annotation panel too high in CDS/Protein view +
    • +
+ + + + +
+ 2.10.2b2
+ 2/10/2017 +
+ +
+ New features in Jalview Desktop +
    +
  • + Uniprot Sequence Fetcher now uses web API at uniprot.org +
    • +
  • HTTPS used for all connections to ebi.ac.uk
+
+
diff --git a/lib/htsjdk-2.12.0.jar b/lib/htsjdk-2.12.0.jar new file mode 100644 index 0000000..1df12b2 Binary files /dev/null and b/lib/htsjdk-2.12.0.jar differ diff --git a/src/jalview/datamodel/Sequence.java b/src/jalview/datamodel/Sequence.java index cd743d1..98b0fb3 100755 --- a/src/jalview/datamodel/Sequence.java +++ b/src/jalview/datamodel/Sequence.java @@ -89,7 +89,7 @@ public class Sequence extends ASequence implements SequenceI */ int index = -1; - private SequenceFeatures sequenceFeatureStore; + private SequenceFeaturesI sequenceFeatureStore; /* * A cursor holding the approximate current view position to the sequence, diff --git a/src/jalview/datamodel/SequenceI.java b/src/jalview/datamodel/SequenceI.java index 03fc545..28be85f 100755 --- a/src/jalview/datamodel/SequenceI.java +++ b/src/jalview/datamodel/SequenceI.java @@ -536,8 +536,21 @@ public interface SequenceI extends ASequenceI */ public int replace(char c1, char c2); + /** + * Answers the GeneLociI, or null if not known + * + * @return + */ GeneLociI getGeneLoci(); + /** + * Sets the mapping to gene loci for the sequence + * + * @param speciesId + * @param assemblyId + * @param chromosomeId + * @param map + */ void setGeneLoci(String speciesId, String assemblyId, String chromosomeId, MapList map); } diff --git a/src/jalview/ext/ensembl/EnsemblData.java b/src/jalview/ext/ensembl/EnsemblData.java new file mode 100644 index 0000000..47fe0fc --- /dev/null +++ b/src/jalview/ext/ensembl/EnsemblData.java @@ -0,0 +1,91 @@ +/* + * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$) + * Copyright (C) $$Year-Rel$$ The Jalview Authors + * + * This file is part of Jalview. + * + * Jalview is free software: you can redistribute it and/or + * modify it under the terms of the GNU General Public License + * as published by the Free Software Foundation, either version 3 + * of the License, or (at your option) any later version. + * + * Jalview is distributed in the hope that it will be useful, but + * WITHOUT ANY WARRANTY; without even the implied warranty + * of MERCHANTABILITY or FITNESS FOR A PARTICULAR + * PURPOSE. See the GNU General Public License for more details. + * + * You should have received a copy of the GNU General Public License + * along with Jalview. If not, see . + * The Jalview Authors are detailed in the 'AUTHORS' file. + */ +package jalview.ext.ensembl; + +/** + * A data class to model the data and rest version of one Ensembl domain, + * currently for rest.ensembl.org and rest.ensemblgenomes.org + * + * @author gmcarstairs + */ +class EnsemblData +{ + /* + * The http domain this object is holding data values for + */ + String domain; + + /* + * The latest version Jalview has tested for, e.g. "4.5"; a minor version change should be + * ok, a major version change may break stuff + */ + String expectedRestVersion; + + /* + * Major / minor / point version e.g. "4.5.1" + * @see http://rest.ensembl.org/info/rest/?content-type=application/json + */ + String restVersion; + + /* + * data version + * @see http://rest.ensembl.org/info/data/?content-type=application/json + */ + String dataVersion; + + /* + * true when http://rest.ensembl.org/info/ping/?content-type=application/json + * returns response code 200 and not {"error":"Database is unavailable"} + */ + boolean restAvailable; + + /* + * absolute time when availability was last checked + */ + long lastAvailableCheckTime; + + /* + * absolute time when version numbers were last checked + */ + long lastVersionCheckTime; + + // flag set to true if REST major version is not the one expected + boolean restMajorVersionMismatch; + + /* + * absolute time to wait till if we overloaded the REST service + */ + long retryAfter; + + /** + * Constructor given expected REST version number e.g 4.5 or 3.4.3 + * + * @param restExpected + */ + EnsemblData(String theDomain, String restExpected) + { + domain = theDomain; + expectedRestVersion = restExpected; + lastAvailableCheckTime = -1; + lastVersionCheckTime = -1; + } + +} diff --git a/src/jalview/ext/ensembl/EnsemblInfo.java b/src/jalview/ext/ensembl/EnsemblInfo.java index 3108194..de55a53 100644 --- a/src/jalview/ext/ensembl/EnsemblInfo.java +++ b/src/jalview/ext/ensembl/EnsemblInfo.java @@ -1,91 +1,185 @@ -/* - * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$) - * Copyright (C) $$Year-Rel$$ The Jalview Authors - * - * This file is part of Jalview. - * - * Jalview is free software: you can redistribute it and/or - * modify it under the terms of the GNU General Public License - * as published by the Free Software Foundation, either version 3 - * of the License, or (at your option) any later version. - * - * Jalview is distributed in the hope that it will be useful, but - * WITHOUT ANY WARRANTY; without even the implied warranty - * of MERCHANTABILITY or FITNESS FOR A PARTICULAR - * PURPOSE. See the GNU General Public License for more details. - * - * You should have received a copy of the GNU General Public License - * along with Jalview. If not, see . - * The Jalview Authors are detailed in the 'AUTHORS' file. - */ package jalview.ext.ensembl; -/** - * A data class to model the data and rest version of one Ensembl domain, - * currently for rest.ensembl.org and rest.ensemblgenomes.org - * - * @author gmcarstairs - */ -class EnsemblInfo +import jalview.datamodel.AlignmentI; +import jalview.datamodel.DBRefSource; + +import java.io.BufferedReader; +import java.io.IOException; +import java.net.MalformedURLException; +import java.net.URL; +import java.util.HashMap; +import java.util.Iterator; +import java.util.List; +import java.util.Map; +import java.util.Set; + +import org.json.simple.JSONArray; +import org.json.simple.parser.JSONParser; +import org.json.simple.parser.ParseException; + +public class EnsemblInfo extends EnsemblRestClient { - /* - * The http domain this object is holding data values for - */ - String domain; /* - * The latest version Jalview has tested for, e.g. "4.5"; a minor version change should be - * ok, a major version change may break stuff + * cached results of REST /info/divisions service, currently + * 
+   * { 
+   *  { "ENSEMBLFUNGI", "http://rest.ensemblgenomes.org"},
+   *    "ENSEMBLBACTERIA", "http://rest.ensemblgenomes.org"},
+   *    "ENSEMBLPROTISTS", "http://rest.ensemblgenomes.org"},
+   *    "ENSEMBLMETAZOA", "http://rest.ensemblgenomes.org"},
+   *    "ENSEMBLPLANTS",  "http://rest.ensemblgenomes.org"},
+   *    "ENSEMBL", "http://rest.ensembl.org" }
+   *  }
+   *
+ * The values for EnsemblGenomes are retrieved by a REST call, that for + * Ensembl is added programmatically for convenience of lookup */ - String expectedRestVersion; + private static Map divisions; - /* - * Major / minor / point version e.g. "4.5.1" - * @see http://rest.ensembl.org/info/rest/?content-type=application/json - */ - String restVersion; + @Override + public String getDbName() + { + return "ENSEMBL"; + } - /* - * data version - * @see http://rest.ensembl.org/info/data/?content-type=application/json - */ - String dataVersion; + @Override + public AlignmentI getSequenceRecords(String queries) throws Exception + { + return null; + } - /* - * true when http://rest.ensembl.org/info/ping/?content-type=application/json - * returns response code 200 and not {"error":"Database is unavailable"} - */ - boolean restAvailable; + @Override + protected URL getUrl(List ids) throws MalformedURLException + { + return null; + } - /* - * absolute time when availability was last checked + @Override + protected boolean useGetRequest() + { + return true; + } + + @Override + protected String getRequestMimeType(boolean multipleIds) + { + return "application/json"; + } + + @Override + protected String getResponseMimeType() + { + return "application/json"; + } + + /** + * Answers the domain (http://rest.ensembl.org or + * http://rest.ensemblgenomes.org) for the given division, or null if not + * recognised by Ensembl. + * + * @param division + * @return */ - long lastAvailableCheckTime; + public String getDomain(String division) + { + if (divisions == null) + { + fetchDivisions(); + } + return divisions.get(division.toUpperCase()); + } - /* - * absolute time when version numbers were last checked + /** + * On first request only, populate the lookup map by fetching the list of + * divisions known to EnsemblGenomes. */ - long lastVersionCheckTime; + void fetchDivisions() + { + divisions = new HashMap<>(); - // flag set to true if REST major version is not the one expected - boolean restMajorVersionMismatch; + /* + * for convenience, pre-fill ensembl.org as the domain for "ENSEMBL" + */ + divisions.put(DBRefSource.ENSEMBL.toUpperCase(), ENSEMBL_REST); - /* - * absolute time to wait till if we overloaded the REST service + BufferedReader br = null; + try + { + URL url = getDivisionsUrl(ENSEMBL_GENOMES_REST); + if (url != null) + { + br = getHttpResponse(url, null); + } + parseResponse(br, ENSEMBL_GENOMES_REST); + } catch (IOException e) + { + // ignore + } finally + { + if (br != null) + { + try + { + br.close(); + } catch (IOException e) + { + // ignore + } + } + } + } + + /** + * Parses the JSON response to /info/divisions, and add each to the lookup map + * + * @param br + * @param domain */ - long retryAfter; + void parseResponse(BufferedReader br, String domain) + { + JSONParser jp = new JSONParser(); + + try + { + JSONArray parsed = (JSONArray) jp.parse(br); + + Iterator rvals = parsed.iterator(); + while (rvals.hasNext()) + { + String division = rvals.next().toString(); + divisions.put(division.toUpperCase(), domain); + } + } catch (IOException | ParseException | NumberFormatException e) + { + // ignore + } + } /** - * Constructor given expected REST version number e.g 4.5 or 3.4.3 + * Constructs the URL for the EnsemblGenomes /info/divisions REST service + * @param domain TODO * - * @param restExpected + * @return + * @throws MalformedURLException */ - EnsemblInfo(String theDomain, String restExpected) + URL getDivisionsUrl(String domain) throws MalformedURLException { - domain = theDomain; - expectedRestVersion = restExpected; - lastAvailableCheckTime = -1; - lastVersionCheckTime = -1; + return new URL(domain + + "/info/divisions?content-type=application/json"); } + /** + * Returns the set of 'divisions' recognised by Ensembl or EnsemblGenomes + * + * @return + */ + public Set getDivisions() { + if (divisions == null) + { + fetchDivisions(); + } + + return divisions.keySet(); + } } diff --git a/src/jalview/ext/ensembl/EnsemblLookup.java b/src/jalview/ext/ensembl/EnsemblLookup.java index eb8f90e..0968663 100644 --- a/src/jalview/ext/ensembl/EnsemblLookup.java +++ b/src/jalview/ext/ensembl/EnsemblLookup.java @@ -42,6 +42,9 @@ import org.json.simple.parser.ParseException; */ public class EnsemblLookup extends EnsemblRestClient { + private static final String SPECIES = "species"; + + private static final String PARENT = "Parent"; /** * Default constructor (to use rest.ensembl.org) @@ -124,6 +127,28 @@ public class EnsemblLookup extends EnsemblRestClient */ public String getParent(String identifier) { + return getAttribute(identifier, PARENT); + } + + /** + * Calls the Ensembl lookup REST endpoint and retrieves the 'species' for the + * given identifier, or null if not found + * + * @param identifier + * @return + */ + public String getSpecies(String identifier) + { + return getAttribute(identifier, SPECIES); + } + + /** + * @param identifier + * @param attribute + * @return + */ + protected String getAttribute(String identifier, String attribute) + { List ids = Arrays.asList(new String[] { identifier }); BufferedReader br = null; @@ -134,7 +159,7 @@ public class EnsemblLookup extends EnsemblRestClient { br = getHttpResponse(url, ids); } - return (parseResponse(br)); + return (parseResponse(br, attribute)); } catch (IOException e) { // ignore @@ -155,22 +180,23 @@ public class EnsemblLookup extends EnsemblRestClient } /** - * Parses "Parent" from the JSON response and returns the value, or null if - * not found + * Parses the value of 'attribute' from the JSON response and returns the + * value, or null if not found * * @param br + * @param attribute * @return * @throws IOException */ - protected String parseResponse(BufferedReader br) throws IOException + protected String parseResponse(BufferedReader br, String attribute) throws IOException { String parent = null; JSONParser jp = new JSONParser(); try { JSONObject val = (JSONObject) jp.parse(br); - parent = val.get("Parent").toString(); - } catch (ParseException e) + parent = val.get(attribute).toString(); + } catch (ParseException | NullPointerException e) { // ignore } diff --git a/src/jalview/ext/ensembl/EnsemblMap.java b/src/jalview/ext/ensembl/EnsemblMap.java index 05cc897..56657e0 100644 --- a/src/jalview/ext/ensembl/EnsemblMap.java +++ b/src/jalview/ext/ensembl/EnsemblMap.java @@ -2,11 +2,15 @@ package jalview.ext.ensembl; import jalview.datamodel.AlignmentI; import jalview.datamodel.DBRefSource; +import jalview.datamodel.GeneLociI; +import jalview.util.MapList; import java.io.BufferedReader; import java.io.IOException; import java.net.MalformedURLException; import java.net.URL; +import java.util.ArrayList; +import java.util.Collections; import java.util.Iterator; import java.util.List; @@ -17,6 +21,13 @@ import org.json.simple.parser.ParseException; public class EnsemblMap extends EnsemblRestClient { + private static final String MAPPED = "mapped"; + + private static final String MAPPINGS = "mappings"; + + private static final String CDS = "cds"; + + private static final String CDNA = "cdna"; /** * Default constructor (to use rest.ensembl.org) @@ -62,7 +73,7 @@ public class EnsemblMap extends EnsemblRestClient * @return * @throws MalformedURLException */ - protected URL getUrl(String species, String chromosome, String fromRef, + protected URL getAssemblyMapUrl(String species, String chromosome, String fromRef, String toRef, int startPos, int endPos) throws MalformedURLException { @@ -77,13 +88,7 @@ public class EnsemblMap extends EnsemblRestClient "%s/map/%s/%s/%s:%d..%d:%s/%s?content-type=application/json", getDomain(), species, fromRef, chromosome, start, end, strand, toRef); - try - { - return new URL(url); - } catch (MalformedURLException e) - { - return null; - } + return new URL(url); } @Override @@ -110,7 +115,19 @@ public class EnsemblMap extends EnsemblRestClient return null; // not used } - public int[] getMapping(String species, String chromosome, + /** + * Calls the REST /map service to get the chromosomal coordinates (start/end) + * in 'toRef' that corresponding to the (start/end) queryRange in 'fromRef' + * + * @param species + * @param chromosome + * @param fromRef + * @param toRef + * @param queryRange + * @return + * @see http://rest.ensemblgenomes.org/documentation/info/assembly_map + */ + public int[] getAssemblyMapping(String species, String chromosome, String fromRef, String toRef, int[] queryRange) { URL url = null; @@ -118,21 +135,32 @@ public class EnsemblMap extends EnsemblRestClient try { - url = getUrl(species, chromosome, fromRef, toRef, queryRange[0], + url = getAssemblyMapUrl(species, chromosome, fromRef, toRef, queryRange[0], queryRange[1]); - // System.out.println("Calling " + url); br = getHttpResponse(url, null); - return (parseResponse(br)); + return (parseAssemblyMappingResponse(br)); } catch (Throwable t) { System.out.println("Error calling " + url + ": " + t.getMessage()); return null; + } finally + { + if (br != null) + { + try + { + br.close(); + } catch (IOException e) + { + // ignore + } + } } } /** - * Parses the JSON response from the /map REST service. The format is (with - * some fields omitted) + * Parses the JSON response from the /map/<species>/ REST service. The + * format is (with some fields omitted) * * 
    *  {"mappings": 
@@ -145,7 +173,7 @@ public class EnsemblMap extends EnsemblRestClient
    * @param br
    * @return
    */
-  protected int[] parseResponse(BufferedReader br)
+  protected int[] parseAssemblyMappingResponse(BufferedReader br)
   {
     int[] result = null;
     JSONParser jp = new JSONParser();
@@ -153,14 +181,14 @@ public class EnsemblMap extends EnsemblRestClient
     try
     {
       JSONObject parsed = (JSONObject) jp.parse(br);
-      JSONArray mappings = (JSONArray) parsed.get("mappings");
+      JSONArray mappings = (JSONArray) parsed.get(MAPPINGS);
 
       Iterator rvals = mappings.iterator();
       while (rvals.hasNext())
       {
         // todo check for "mapped"
         JSONObject val = (JSONObject) rvals.next();
-        JSONObject mapped = (JSONObject) val.get("mapped");
+        JSONObject mapped = (JSONObject) val.get(MAPPED);
         int start = Integer.parseInt(mapped.get("start").toString());
         int end = Integer.parseInt(mapped.get("end").toString());
         String strand = mapped.get("strand").toString();
@@ -180,4 +208,215 @@ public class EnsemblMap extends EnsemblRestClient
     return result;
   }
 
+  /**
+   * Calls the REST /map/cds/id service, and returns a DBRefEntry holding the
+   * returned chromosomal coordinates, or returns null if the call fails
+   * 
+   * @param division
+   *          e.g. Ensembl, EnsemblMetazoa
+   * @param accession
+   *          e.g. ENST00000592782, Y55B1AR.1.1
+   * @param start
+   * @param end
+   * @return
+   */
+  public GeneLociI getCdsMapping(String division, String accession,
+          int start, int end)
+  {
+    return getIdMapping(division, accession, start, end, CDS);
+  }
+
+  /**
+   * Calls the REST /map/cdna/id service, and returns a DBRefEntry holding the
+   * returned chromosomal coordinates, or returns null if the call fails
+   * 
+   * @param division
+   *          e.g. Ensembl, EnsemblMetazoa
+   * @param accession
+   *          e.g. ENST00000592782, Y55B1AR.1.1
+   * @param start
+   * @param end
+   * @return
+   */
+  public GeneLociI getCdnaMapping(String division, String accession,
+          int start, int end)
+  {
+    return getIdMapping(division, accession, start, end, CDNA);
+  }
+
+  GeneLociI getIdMapping(String division, String accession, int start,
+          int end, String cdsOrCdna)
+  {
+    URL url = null;
+    BufferedReader br = null;
+
+    try
+    {
+      String domain = new EnsemblInfo().getDomain(division);
+      if (domain != null)
+      {
+        url = getIdMapUrl(domain, accession, start, end, cdsOrCdna);
+        br = getHttpResponse(url, null);
+        return (parseIdMappingResponse(br, accession, domain));
+      }
+      return null;
+    } catch (Throwable t)
+    {
+      System.out.println("Error calling " + url + ": " + t.getMessage());
+      return null;
+    } finally
+    {
+      if (br != null)
+      {
+        try
+        {
+          br.close();
+        } catch (IOException e)
+        {
+          // ignore
+        }
+      }
+    }
+  }
+
+  /**
+   * Constructs a URL to the /map/cds/ or /map/cdna/ REST service. The
+   * REST call is to either ensembl or ensemblgenomes, as determined from the
+   * division, e.g. Ensembl or EnsemblProtists.
+   * 
+   * @param domain
+   * @param accession
+   * @param start
+   * @param end
+   * @param cdsOrCdna
+   * @return
+   * @throws MalformedURLException
+   */
+  URL getIdMapUrl(String domain, String accession, int start, int end,
+          String cdsOrCdna) throws MalformedURLException
+  {
+    String url = String
+            .format("%s/map/%s/%s/%d..%d?include_original_region=1&content-type=application/json",
+                    domain, cdsOrCdna, accession, start, end);
+    return new URL(url);
+  }
+
+  /**
+   * Parses the JSON response from the /map/cds/ or /map/cdna REST service. The
+   * format is
+   * 
+   * 
+   * {"mappings":
+   *   [
+   *    {"assembly_name":"TAIR10","end":2501311,"seq_region_name":"1","gap":0,
+   *     "strand":-1,"coord_system":"chromosome","rank":0,"start":2501114},
+   *    {"assembly_name":"TAIR10","end":2500815,"seq_region_name":"1","gap":0,
+   *     "strand":-1,"coord_system":"chromosome","rank":0,"start":2500714}
+   *   ]
+   * }
+   * 

+   * 
+   * @param br
+   * @param accession
+   * @param domain
+   * @return
+   */
+  GeneLociI parseIdMappingResponse(BufferedReader br, String accession,
+          String domain)
+  {
+    JSONParser jp = new JSONParser();
+
+    try
+    {
+      JSONObject parsed = (JSONObject) jp.parse(br);
+      JSONArray mappings = (JSONArray) parsed.get(MAPPINGS);
+
+      Iterator rvals = mappings.iterator();
+      String assembly = null;
+      String chromosome = null;
+      int fromEnd = 0;
+      List regions = new ArrayList<>();
+
+      while (rvals.hasNext())
+      {
+        JSONObject val = (JSONObject) rvals.next();
+        JSONObject original = (JSONObject) val.get("original");
+        fromEnd = Integer.parseInt(original.get("end").toString());
+
+        JSONObject mapped = (JSONObject) val.get(MAPPED);
+        int start = Integer.parseInt(mapped.get("start").toString());
+        int end = Integer.parseInt(mapped.get("end").toString());
+        String ass = mapped.get("assembly_name").toString();
+        if (assembly != null && !assembly.equals(ass))
+        {
+          System.err
+                  .println("EnsemblMap found multiple assemblies - can't resolve");
+          return null;
+        }
+        assembly = ass;
+        String chr = mapped.get("seq_region_name").toString();
+        if (chromosome != null && !chromosome.equals(chr))
+        {
+          System.err
+                  .println("EnsemblMap found multiple chromosomes - can't resolve");
+          return null;
+        }
+        chromosome = chr;
+        String strand = mapped.get("strand").toString();
+        if ("-1".equals(strand))
+        {
+          regions.add(new int[] { end, start });
+        }
+        else
+        {
+          regions.add(new int[] { start, end });
+        }
+      }
+
+      /*
+       * processed all mapped regions on chromosome, assemble the result,
+       * having first fetched the species id for the accession
+       */
+      final String species = new EnsemblLookup(domain)
+              .getSpecies(accession);
+      final String as = assembly;
+      final String chr = chromosome;
+      List fromRange = Collections.singletonList(new int[] { 1,
+          fromEnd });
+      final MapList map = new MapList(fromRange, regions, 1, 1);
+      return new GeneLociI()
+      {
+
+        @Override
+        public String getSpeciesId()
+        {
+          return species == null ? "" : species;
+        }
+
+        @Override
+        public String getAssemblyId()
+        {
+          return as;
+        }
+
+        @Override
+        public String getChromosomeId()
+        {
+          return chr;
+        }
+
+        @Override
+        public MapList getMap()
+        {
+          return map;
+        }
+      };
+    } catch (IOException | ParseException | NumberFormatException e)
+    {
+      // ignore
+    }
+
+    return null;
+  }
+
 }
diff --git a/src/jalview/ext/ensembl/EnsemblRestClient.java b/src/jalview/ext/ensembl/EnsemblRestClient.java
index ad6c70c..7cabfbb 100644
--- a/src/jalview/ext/ensembl/EnsemblRestClient.java
+++ b/src/jalview/ext/ensembl/EnsemblRestClient.java
@@ -67,7 +67,7 @@ abstract class EnsemblRestClient extends EnsemblSequenceFetcher
 
   private static final String REST_CHANGE_LOG = "https://github.com/Ensembl/ensembl-rest/wiki/Change-log";
 
-  private static Map domainData;
+  private static Map domainData;
 
   // @see https://github.com/Ensembl/ensembl-rest/wiki/Output-formats
   private static final String PING_URL = "http://rest.ensembl.org/info/ping.json";
@@ -87,10 +87,10 @@ abstract class EnsemblRestClient extends EnsemblSequenceFetcher
 
   static
   {
-    domainData = new HashMap();
+    domainData = new HashMap();
     domainData.put(ENSEMBL_REST,
-            new EnsemblInfo(ENSEMBL_REST, LATEST_ENSEMBL_REST_VERSION));
-    domainData.put(ENSEMBL_GENOMES_REST, new EnsemblInfo(
+            new EnsemblData(ENSEMBL_REST, LATEST_ENSEMBL_REST_VERSION));
+    domainData.put(ENSEMBL_GENOMES_REST, new EnsemblData(
             ENSEMBL_GENOMES_REST, LATEST_ENSEMBLGENOMES_REST_VERSION));
   }
 
@@ -368,7 +368,7 @@ abstract class EnsemblRestClient extends EnsemblSequenceFetcher
     // to test:
     // retryDelay = "5";
 
-    EnsemblInfo info = domainData.get(getDomain());
+    EnsemblData info = domainData.get(getDomain());
     if (retryDelay != null)
     {
       System.err.println("Ensembl REST service rate limit exceeded, wait "
@@ -403,7 +403,7 @@ abstract class EnsemblRestClient extends EnsemblSequenceFetcher
    */
   protected boolean isEnsemblAvailable()
   {
-    EnsemblInfo info = domainData.get(getDomain());
+    EnsemblData info = domainData.get(getDomain());
 
     long now = System.currentTimeMillis();
 
@@ -491,7 +491,7 @@ abstract class EnsemblRestClient extends EnsemblSequenceFetcher
    */
   private void checkEnsemblRestVersion()
   {
-    EnsemblInfo info = domainData.get(getDomain());
+    EnsemblData info = domainData.get(getDomain());
 
     JSONParser jp = new JSONParser();
     URL url = null;
diff --git a/src/jalview/gui/AlignFrame.java b/src/jalview/gui/AlignFrame.java
index 95cabcd..f6b8392 100644
--- a/src/jalview/gui/AlignFrame.java
+++ b/src/jalview/gui/AlignFrame.java
@@ -4261,7 +4261,7 @@ public class AlignFrame extends GAlignFrame implements DropTargetListener,
   protected void showProductsFor(final SequenceI[] sel, final boolean _odna,
           final String source)
   {
-    new Thread(CrossRefAction.showProductsFor(sel, _odna, source, this))
+    new Thread(CrossRefAction.getHandlerFor(sel, _odna, source, this))
             .start();
   }
 
diff --git a/src/jalview/gui/CrossRefAction.java b/src/jalview/gui/CrossRefAction.java
index 2d1dfd4..21a0a84 100644
--- a/src/jalview/gui/CrossRefAction.java
+++ b/src/jalview/gui/CrossRefAction.java
@@ -27,17 +27,25 @@ import jalview.api.FeatureSettingsModelI;
 import jalview.bin.Cache;
 import jalview.datamodel.Alignment;
 import jalview.datamodel.AlignmentI;
+import jalview.datamodel.DBRefEntry;
 import jalview.datamodel.DBRefSource;
+import jalview.datamodel.GeneLociI;
 import jalview.datamodel.SequenceI;
+import jalview.ext.ensembl.EnsemblInfo;
+import jalview.ext.ensembl.EnsemblMap;
 import jalview.io.gff.SequenceOntologyI;
 import jalview.structure.StructureSelectionManager;
+import jalview.util.DBRefUtils;
+import jalview.util.MapList;
+import jalview.util.MappingUtils;
 import jalview.util.MessageManager;
 import jalview.ws.SequenceFetcher;
 
 import java.util.ArrayList;
+import java.util.HashMap;
 import java.util.List;
-
-import javax.swing.JOptionPane;
+import java.util.Map;
+import java.util.Set;
 
 /**
  * Factory constructor and runnable for discovering and displaying
@@ -52,13 +60,13 @@ public class CrossRefAction implements Runnable
 
   private SequenceI[] sel;
 
-  private boolean _odna;
+  private final boolean _odna;
 
   private String source;
 
-  List xrefViews = new ArrayList();
+  List xrefViews = new ArrayList<>();
 
-  public List getXrefViews()
+  List getXrefViews()
   {
     return xrefViews;
   }
@@ -90,6 +98,13 @@ public class CrossRefAction implements Runnable
       {
         return;
       }
+
+      /*
+       * try to look up chromosomal coordinates for nucleotide
+       * sequences (if not already retrieved)
+       */
+      findGeneLoci(xrefs.getSequences());
+
       /*
        * get display scheme (if any) to apply to features
        */
@@ -113,75 +128,14 @@ public class CrossRefAction implements Runnable
 
       if (Cache.getDefault(Preferences.ENABLE_SPLIT_FRAME, true))
       {
-        boolean copyAlignmentIsAligned = false;
-        if (dna)
-        {
-          copyAlignment = AlignmentUtils.makeCdsAlignment(sel, dataset,
-                  xrefsAlignment.getSequencesArray());
-          if (copyAlignment.getHeight() == 0)
-          {
-            JvOptionPane.showMessageDialog(alignFrame,
-                    MessageManager.getString("label.cant_map_cds"),
-                    MessageManager.getString("label.operation_failed"),
-                    JvOptionPane.OK_OPTION);
-            System.err.println("Failed to make CDS alignment");
-          }
-
-          /*
-           * pending getting Embl transcripts to 'align', 
-           * we are only doing this for Ensembl
-           */
-          // TODO proper criteria for 'can align as cdna'
-          if (DBRefSource.ENSEMBL.equalsIgnoreCase(source)
-                  || AlignmentUtils.looksLikeEnsembl(alignment))
-          {
-            copyAlignment.alignAs(alignment);
-            copyAlignmentIsAligned = true;
-          }
-        }
-        else
+        copyAlignment = copyAlignmentForSplitFrame(alignment, dataset, dna,
+                xrefs, xrefsAlignment);
+        if (copyAlignment == null)
         {
-          copyAlignment = AlignmentUtils.makeCopyAlignment(sel,
-                  xrefs.getSequencesArray(), dataset);
-        }
-        copyAlignment
-                .setGapCharacter(alignFrame.viewport.getGapCharacter());
-
-        StructureSelectionManager ssm = StructureSelectionManager
-                .getStructureSelectionManager(Desktop.instance);
-
-        /*
-         * register any new mappings for sequence mouseover etc
-         * (will not duplicate any previously registered mappings)
-         */
-        ssm.registerMappings(dataset.getCodonFrames());
-
-        if (copyAlignment.getHeight() <= 0)
-        {
-          System.err.println(
-                  "No Sequences generated for xRef type " + source);
-          return;
-        }
-        /*
-         * align protein to dna
-         */
-        if (dna && copyAlignmentIsAligned)
-        {
-          xrefsAlignment.alignAs(copyAlignment);
-        }
-        else
-        {
-          /*
-           * align cdna to protein - currently only if 
-           * fetching and aligning Ensembl transcripts!
-           */
-          // TODO: generalise for other sources of locus/transcript/cds data
-          if (dna && DBRefSource.ENSEMBL.equalsIgnoreCase(source))
-          {
-            copyAlignment.alignAs(xrefsAlignment);
-          }
+          return; // failed
         }
       }
+
       /*
        * build AlignFrame(s) according to available alignment data
        */
@@ -207,6 +161,7 @@ public class CrossRefAction implements Runnable
         xrefViews.add(newFrame.alignPanel);
         return; // via finally clause
       }
+
       AlignFrame copyThis = new AlignFrame(copyAlignment,
               AlignFrame.DEFAULT_WIDTH, AlignFrame.DEFAULT_HEIGHT);
       copyThis.setTitle(alignFrame.getTitle());
@@ -263,6 +218,260 @@ public class CrossRefAction implements Runnable
   }
 
   /**
+   * Tries to add chromosomal coordinates to any nucleotide sequence which does
+   * not already have them. Coordinates are retrieved from Ensembl given an
+   * Ensembl identifier, either on the sequence itself or on a peptide sequence
+   * it has a reference to.
+   * 
+   * 
+   * Example (human):
+   * - fetch EMBLCDS cross-references for Uniprot entry P30419
+   * - the EMBL sequences do not have xrefs to Ensembl
+   * - the Uniprot entry has xrefs to 
+   *    ENSP00000258960, ENSP00000468424, ENST00000258960, ENST00000592782
+   * - either of the transcript ids can be used to retrieve gene loci e.g.
+   *    http://rest.ensembl.org/map/cds/ENST00000592782/1..100000
+   * Example (invertebrate):
+   * - fetch EMBLCDS cross-references for Uniprot entry Q43517 (FER1_SOLLC)
+   * - the Uniprot entry has an xref to ENSEMBLPLANTS Solyc10g044520.1.1
+   * - can retrieve gene loci with
+   *    http://rest.ensemblgenomes.org/map/cds/Solyc10g044520.1.1/1..100000
+   * 

+   * 
+   * @param sequences
+   */
+  public static void findGeneLoci(List sequences)
+  {
+    Map retrievedLoci = new HashMap<>();
+    for (SequenceI seq : sequences)
+    {
+      findGeneLoci(seq, retrievedLoci);
+    }
+  }
+
+  /**
+   * Tres to find chromosomal coordinates for the sequence, by searching its
+   * direct and indirect cross-references for Ensembl. If the loci have already
+   * been retrieved, just reads them out of the map of retrievedLoci; this is
+   * the case of an alternative transcript for the same protein. Otherwise calls
+   * a REST service to retrieve the loci, and if successful, adds them to the
+   * sequence and to the retrievedLoci.
+   * 
+   * @param seq
+   * @param retrievedLoci
+   */
+  static void findGeneLoci(SequenceI seq,
+          Map retrievedLoci)
+  {
+    /*
+     * don't replace any existing chromosomal coordinates
+     */
+    if (seq == null || seq.isProtein() || seq.getGeneLoci() != null
+            || seq.getDBRefs() == null)
+    {
+      return;
+    }
+    
+    Set ensemblDivisions = new EnsemblInfo().getDivisions();
+    
+    /*
+     * first look for direct dbrefs from sequence to Ensembl
+     */
+    String[] divisionsArray = ensemblDivisions
+            .toArray(new String[ensemblDivisions.size()]);
+    DBRefEntry[] seqRefs = seq.getDBRefs();
+    DBRefEntry[] directEnsemblRefs = DBRefUtils.selectRefs(seqRefs,
+            divisionsArray);
+    if (directEnsemblRefs != null)
+    {
+      for (DBRefEntry ensemblRef : directEnsemblRefs)
+      {
+        if (fetchGeneLoci(seq, ensemblRef, retrievedLoci))
+        {
+          return;
+        }
+      }
+    }
+
+    /*
+     * else look for indirect dbrefs from sequence to Ensembl
+     */
+    for (DBRefEntry dbref : seq.getDBRefs())
+    {
+      if (dbref.getMap() != null && dbref.getMap().getTo() != null)
+      {
+        DBRefEntry[] dbrefs = dbref.getMap().getTo().getDBRefs();
+        DBRefEntry[] indirectEnsemblRefs = DBRefUtils.selectRefs(dbrefs,
+                divisionsArray);
+        if (indirectEnsemblRefs != null)
+        {
+          for (DBRefEntry ensemblRef : indirectEnsemblRefs)
+          {
+            if (fetchGeneLoci(seq, ensemblRef, retrievedLoci))
+            {
+              return;
+            }
+          }
+        }
+      }
+    }
+  }
+
+  /**
+   * Retrieves chromosomal coordinates for the Ensembl (or EnsemblGenomes)
+   * identifier in dbref. If successful, and the sequence length matches gene
+   * loci length, then add it to the sequence, and to the retrievedLoci map.
+   * Answers true if successful, else false.
+   * 
+   * @param seq
+   * @param dbref
+   * @param retrievedLoci
+   * @return
+   */
+  static boolean fetchGeneLoci(SequenceI seq, DBRefEntry dbref,
+          Map retrievedLoci)
+  {
+    String accession = dbref.getAccessionId();
+    String division = dbref.getSource();
+
+    /*
+     * hack: ignore cross-references to Ensembl protein ids
+     * (can't fetch chromosomal mapping for these)
+     * todo: is there an equivalent in EnsemblGenomes?
+     */
+    if (accession.startsWith("ENSP"))
+    {
+      return false;
+    }
+    EnsemblMap mapper = new EnsemblMap();
+
+    /*
+     * try CDS mapping first
+     */
+    GeneLociI geneLoci = mapper.getCdsMapping(division, accession, 1,
+            seq.getLength());
+    if (geneLoci != null)
+    {
+      MapList map = geneLoci.getMap();
+      int mappedFromLength = MappingUtils.getLength(map.getFromRanges());
+      if (mappedFromLength == seq.getLength())
+      {
+        seq.setGeneLoci(geneLoci.getSpeciesId(), geneLoci.getAssemblyId(),
+                geneLoci.getChromosomeId(), geneLoci.getMap());
+        retrievedLoci.put(dbref, geneLoci);
+        return true;
+      }
+    }
+
+    /*
+     * else try CDNA mapping
+     */
+    geneLoci = mapper.getCdnaMapping(division, accession, 1,
+            seq.getLength());
+    if (geneLoci != null)
+    {
+      MapList map = geneLoci.getMap();
+      int mappedFromLength = MappingUtils.getLength(map.getFromRanges());
+      if (mappedFromLength == seq.getLength())
+      {
+        seq.setGeneLoci(geneLoci.getSpeciesId(), geneLoci.getAssemblyId(),
+                geneLoci.getChromosomeId(), geneLoci.getMap());
+        retrievedLoci.put(dbref, geneLoci);
+        return true;
+      }
+    }
+
+    return false;
+  }
+
+  /**
+   * @param alignment
+   * @param dataset
+   * @param dna
+   * @param xrefs
+   * @param xrefsAlignment
+   * @return
+   */
+  protected AlignmentI copyAlignmentForSplitFrame(AlignmentI alignment,
+          AlignmentI dataset, boolean dna, AlignmentI xrefs,
+          AlignmentI xrefsAlignment)
+  {
+    AlignmentI copyAlignment;
+    boolean copyAlignmentIsAligned = false;
+    if (dna)
+    {
+      copyAlignment = AlignmentUtils.makeCdsAlignment(sel, dataset,
+              xrefsAlignment.getSequencesArray());
+      if (copyAlignment.getHeight() == 0)
+      {
+        JvOptionPane.showMessageDialog(alignFrame,
+                MessageManager.getString("label.cant_map_cds"),
+                MessageManager.getString("label.operation_failed"),
+                JvOptionPane.OK_OPTION);
+        System.err.println("Failed to make CDS alignment");
+        return null;
+      }
+
+      /*
+       * pending getting Embl transcripts to 'align', 
+       * we are only doing this for Ensembl
+       */
+      // TODO proper criteria for 'can align as cdna'
+      if (DBRefSource.ENSEMBL.equalsIgnoreCase(source)
+              || AlignmentUtils.looksLikeEnsembl(alignment))
+      {
+        copyAlignment.alignAs(alignment);
+        copyAlignmentIsAligned = true;
+      }
+    }
+    else
+    {
+      copyAlignment = AlignmentUtils.makeCopyAlignment(sel,
+              xrefs.getSequencesArray(), dataset);
+    }
+    copyAlignment
+            .setGapCharacter(alignFrame.viewport.getGapCharacter());
+
+    StructureSelectionManager ssm = StructureSelectionManager
+            .getStructureSelectionManager(Desktop.instance);
+
+    /*
+     * register any new mappings for sequence mouseover etc
+     * (will not duplicate any previously registered mappings)
+     */
+    ssm.registerMappings(dataset.getCodonFrames());
+
+    if (copyAlignment.getHeight() <= 0)
+    {
+      System.err.println(
+              "No Sequences generated for xRef type " + source);
+      return null;
+    }
+
+    /*
+     * align protein to dna
+     */
+    if (dna && copyAlignmentIsAligned)
+    {
+      xrefsAlignment.alignAs(copyAlignment);
+    }
+    else
+    {
+      /*
+       * align cdna to protein - currently only if 
+       * fetching and aligning Ensembl transcripts!
+       */
+      // TODO: generalise for other sources of locus/transcript/cds data
+      if (dna && DBRefSource.ENSEMBL.equalsIgnoreCase(source))
+      {
+        copyAlignment.alignAs(xrefsAlignment);
+      }
+    }
+
+    return copyAlignment;
+  }
+
+  /**
    * Makes an alignment containing the given sequences, and adds them to the
    * given dataset, which is also set as the dataset for the new alignment
    * 
@@ -291,20 +500,28 @@ public class CrossRefAction implements Runnable
     return al;
   }
 
-  public CrossRefAction(AlignFrame alignFrame, SequenceI[] sel,
-          boolean _odna, String source)
+  /**
+   * Constructor
+   * 
+   * @param af
+   * @param seqs
+   * @param fromDna
+   * @param dbSource
+   */
+  CrossRefAction(AlignFrame af, SequenceI[] seqs, boolean fromDna,
+          String dbSource)
   {
-    this.alignFrame = alignFrame;
-    this.sel = sel;
-    this._odna = _odna;
-    this.source = source;
+    this.alignFrame = af;
+    this.sel = seqs;
+    this._odna = fromDna;
+    this.source = dbSource;
   }
 
-  public static CrossRefAction showProductsFor(final SequenceI[] sel,
-          final boolean _odna, final String source,
+  public static CrossRefAction getHandlerFor(final SequenceI[] sel,
+          final boolean fromDna, final String source,
           final AlignFrame alignFrame)
   {
-    return new CrossRefAction(alignFrame, sel, _odna, source);
+    return new CrossRefAction(alignFrame, sel, fromDna, source);
   }
 
 }
diff --git a/src/jalview/io/SequenceAnnotationReport.java b/src/jalview/io/SequenceAnnotationReport.java
index f1ebcac..13f41d4 100644
--- a/src/jalview/io/SequenceAnnotationReport.java
+++ b/src/jalview/io/SequenceAnnotationReport.java
@@ -58,7 +58,7 @@ public class SequenceAnnotationReport
 
   /*
    * Comparator to order DBRefEntry by Source + accession id (case-insensitive),
-   * with 'Primary' sources placed before others
+   * with 'Primary' sources placed before others, and 'chromosome' first of all
    */
   private static Comparator comparator = new Comparator()
   {
@@ -66,6 +66,14 @@ public class SequenceAnnotationReport
     @Override
     public int compare(DBRefEntry ref1, DBRefEntry ref2)
     {
+      if (ref1.isChromosome())
+      {
+        return -1;
+      }
+      if (ref2.isChromosome())
+      {
+        return 1;
+      }
       String s1 = ref1.getSource();
       String s2 = ref2.getSource();
       boolean s1Primary = isPrimarySource(s1);
diff --git a/src/jalview/io/vcf/VCFLoader.java b/src/jalview/io/vcf/VCFLoader.java
index c1c84fb..e381b26 100644
--- a/src/jalview/io/vcf/VCFLoader.java
+++ b/src/jalview/io/vcf/VCFLoader.java
@@ -287,7 +287,7 @@ public class VCFLoader
 
   /**
    * Transfers VCF features to sequences to which this sequence has a mapping.
-   * If the mapping is 1:3, computes peptide variants from nucleotide variants.
+   * If the mapping is 3:1, computes peptide variants from nucleotide variants.
    * 
    * @param seq
    */
@@ -432,27 +432,21 @@ public class VCFLoader
        */
       VariantContext variant = variants.next();
 
-      /*
-       * we can only process SNP variants (which can be reported
-       * as part of a MIXED variant record
-       */
-      if (!variant.isSNP() && !variant.isMixed())
-      {
-        // continue;
-      }
-
       int start = variant.getStart() - offset;
       int end = variant.getEnd() - offset;
 
       /*
        * convert chromosomal location to sequence coordinates
+       * - may be reverse strand (convert to forward for sequence feature)
        * - null if a partially overlapping feature
        */
       int[] seqLocation = mapping.locateInFrom(start, end);
       if (seqLocation != null)
       {
-        count += addAlleleFeatures(seq, variant, seqLocation[0],
-                seqLocation[1], forwardStrand);
+        int featureStart = Math.min(seqLocation[0], seqLocation[1]);
+        int featureEnd = Math.max(seqLocation[0], seqLocation[1]);
+        count += addAlleleFeatures(seq, variant, featureStart, featureEnd,
+                forwardStrand);
       }
     }
 
@@ -564,13 +558,6 @@ public class VCFLoader
     String reference = variant.getReference().getBaseString();
     Allele alt = variant.getAlternateAllele(altAlleleIndex);
     String allele = alt.getBaseString();
-    if (allele.length() != 1)
-    {
-      /*
-       * not a SNP variant
-       */
-      // return 0;
-    }
 
     /*
      * build the ref,alt allele description e.g. "G,A", using the base
@@ -868,7 +855,8 @@ public class VCFLoader
      * call (e.g.) http://rest.ensembl.org/map/human/GRCh38/17:45051610..45109016:1/GRCh37
      */
     EnsemblMap mapper = new EnsemblMap();
-    int[] mapping = mapper.getMapping(species, chromosome, fromRef, toRef,
+    int[] mapping = mapper.getAssemblyMapping(species, chromosome, fromRef,
+            toRef,
             queryRange);
 
     if (mapping == null)
diff --git a/src/jalview/renderer/seqfeatures/FeatureRenderer.java b/src/jalview/renderer/seqfeatures/FeatureRenderer.java
index e81e519..f16522f 100644
--- a/src/jalview/renderer/seqfeatures/FeatureRenderer.java
+++ b/src/jalview/renderer/seqfeatures/FeatureRenderer.java
@@ -401,27 +401,6 @@ public class FeatureRenderer extends FeatureRendererModel
   }
 
   /**
-<<<<<<< HEAD
-=======
-   * Answers true if the feature belongs to a feature group which is not
-   * currently displayed, else false
-   * 
-   * @param sequenceFeature
-   * @return
-   */
-  @Override
-  protected boolean featureGroupNotShown(
-          final SequenceFeature sequenceFeature)
-  {
-    return featureGroups != null && sequenceFeature.featureGroup != null
-            && sequenceFeature.featureGroup.length() != 0
-            && featureGroups.containsKey(sequenceFeature.featureGroup)
-            && !featureGroups.get(sequenceFeature.featureGroup)
-                    .booleanValue();
-  }
-
-  /**
->>>>>>> refs/heads/develop
    * Called when alignment in associated view has new/modified features to
    * discover and display.
    * 
diff --git a/test/jalview/io/CrossRef2xmlTests.java b/test/jalview/io/CrossRef2xmlTests.java
index 0715857..b3db4de 100644
--- a/test/jalview/io/CrossRef2xmlTests.java
+++ b/test/jalview/io/CrossRef2xmlTests.java
@@ -39,6 +39,9 @@ import java.util.ArrayList;
 import java.util.Arrays;
 import java.util.HashMap;
 import java.util.List;
+import java.util.Map;
+
+import junit.extensions.PA;
 
 import org.testng.Assert;
 import org.testng.annotations.BeforeClass;
@@ -90,9 +93,9 @@ public class CrossRef2xmlTests extends Jalview2xmlBase
     // . codonframes
     //
     //
-    HashMap dbtoviewBit = new HashMap<>();
+    Map dbtoviewBit = new HashMap<>();
     List keyseq = new ArrayList<>();
-    HashMap savedProjects = new HashMap<>();
+    Map savedProjects = new HashMap<>();
 
     for (String[] did : new String[][] { { "UNIPROT", "P00338" } })
     {
@@ -186,15 +189,16 @@ public class CrossRef2xmlTests extends Jalview2xmlBase
 
             if (pass2 == 0)
             { // retrieve and show cross-refs in this thread
-              cra = new CrossRefAction(af, seqs, dna, db);
+              cra = CrossRefAction.getHandlerFor(seqs, dna, db, af);
               cra.run();
-              if (cra.getXrefViews().size() == 0)
+              cra_views = (List) PA.getValue(cra,
+                      "xrefViews");
+              if (cra_views.size() == 0)
               {
                 failedXrefMenuItems.add("No crossrefs retrieved for "
                         + first + " -> " + db);
                 continue;
               }
-              cra_views = cra.getXrefViews();
               assertNucleotide(cra_views.get(0),
                       "Nucleotide panel included proteins for " + first
                               + " -> " + db);
@@ -286,16 +290,18 @@ public class CrossRef2xmlTests extends Jalview2xmlBase
 
                   if (pass3 == 0)
                   {
-
                     SequenceI[] xrseqs = avp.getAlignment()
                             .getSequencesArray();
                     AlignFrame nextaf = Desktop.getAlignFrameFor(avp
                             .getAlignViewport());
 
-                    cra = new CrossRefAction(nextaf, xrseqs, avp
-                            .getAlignViewport().isNucleotide(), xrefdb);
+                    cra = CrossRefAction.getHandlerFor(xrseqs, avp
+                            .getAlignViewport().isNucleotide(), xrefdb,
+                            nextaf);
                     cra.run();
-                    if (cra.getXrefViews().size() == 0)
+                    cra_views2 = (List) PA.getValue(
+                            cra, "xrefViews");
+                    if (cra_views2.size() == 0)
                     {
                       failedXrefMenuItems
                               .add("No crossrefs retrieved for '"
@@ -303,7 +309,6 @@ public class CrossRef2xmlTests extends Jalview2xmlBase
                                       + " via '" + nextaf.getTitle() + "'");
                       continue;
                     }
-                    cra_views2 = cra.getXrefViews();
                     assertNucleotide(cra_views2.get(0),
                             "Nucleotide panel included proteins for '"
                                     + nextxref + "' to " + xrefdb
@@ -541,8 +546,8 @@ public class CrossRef2xmlTests extends Jalview2xmlBase
    *          viewpanel needs to be called with a distinct xrefpath to ensure
    *          each one's strings are compared)
    */
-  private void stringify(HashMap dbtoviewBit,
-          HashMap savedProjects, String xrefpath,
+  private void stringify(Map dbtoviewBit,
+          Map savedProjects, String xrefpath,
           AlignmentViewPanel avp)
   {
     if (savedProjects != null)
diff --git a/test/jalview/io/vcf/VCFLoaderTest.java b/test/jalview/io/vcf/VCFLoaderTest.java
index b01266e..4a254d2 100644
--- a/test/jalview/io/vcf/VCFLoaderTest.java
+++ b/test/jalview/io/vcf/VCFLoaderTest.java
@@ -1,7 +1,7 @@
 package jalview.io.vcf;
 
 import static org.testng.Assert.assertEquals;
-import static org.testng.Assert.fail;
+import static org.testng.Assert.assertTrue;
 
 import jalview.datamodel.AlignmentI;
 import jalview.datamodel.DBRefEntry;
@@ -9,6 +9,7 @@ import jalview.datamodel.Mapping;
 import jalview.datamodel.Sequence;
 import jalview.datamodel.SequenceFeature;
 import jalview.datamodel.SequenceI;
+import jalview.datamodel.features.SequenceFeatures;
 import jalview.gui.AlignFrame;
 import jalview.io.DataSourceType;
 import jalview.io.FileLoader;
@@ -25,30 +26,43 @@ import org.testng.annotations.Test;
 
 public class VCFLoaderTest
 {
-  // columns 9717- of gene P30419 from Ensembl (modified)
-  private static final String FASTA =
-  // forward strand 'gene'
-  ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n"
+  private static final float DELTA = 0.00001f;
+
+  // columns 9717- of gene P30419 from Ensembl (much modified)
+  private static final String FASTA = ""
+          +
+          /*
+           * forward strand 'gene' and 'transcript' with two exons
+           */
+          ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n"
           + "CAAGCTGGCGGACGAGAGTGTGACA\n"
-          // and a 'made up' mini-transcript with two exons
           + ">transcript1/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
-          +
-          // 'reverse strand' gene (reverse complement)
-          ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n"
+
+          /*
+           * reverse strand gene and transcript (reverse complement alleles!)
+           */
+          + ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n"
           + "TGTCACACTCTCGTCCGCCAGCTTG\n"
-          // and its 'transcript'
-          + ">transcript2/1-18\n"
-          + "-GTCACACTCT----CGCCAGCT--\n";
+          + ">transcript2/1-18\n" + "-GTCACACTCT----CGCCAGCT--\n"
+
+          /*
+           * 'gene' on chromosome 5 with two transcripts
+           */
+          + ">gene3/1-25 chromosome:GRCh38:5:45051610:45051634:1\n"
+          + "CAAGCTGGCGGACGAGAGTGTGACA\n"
+          + ">transcript3/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
+          + ">transcript4/1-18\n-----TGG-GGACGAGAGTGTGA-A\n";
 
   private static final String[] VCF = { "##fileformat=VCFv4.2",
       "##INFO=",
       "##reference=GRCh38",
       "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO",
-      // SNP A/T in position 2 of gene sequence (precedes transcript)
-      "17\t45051611\t.\tA\tT\t1666.64\tRF\tAC=15;AF=5.08130e-03",
+      // A/T,C variants in position 2 of gene sequence (precedes transcript)
+      // should create 2 variant features with respective scores
+      "17\t45051611\t.\tA\tT,C\t1666.64\tRF\tAC=15;AF=5.0e-03,4.0e-03",
       // SNP G/C in position 4 of gene sequence, position 2 of transcript
-      // this is a mixed variant, the insertion G/GA is not transferred
-      "17\t45051613\t.\tG\tGA,C\t1666.64\tRF\tAC=15;AF=3.08130e-03" };
+      // insertion G/GA is transferred to nucleotide but not to peptide
+      "17\t45051613\t.\tG\tGA,C\t1666.64\tRF\tAC=15;AF=3.0e-03,2.0e-03" };
 
   @Test(groups = "Functional")
   public void testDoLoad() throws IOException
@@ -62,42 +76,69 @@ public class VCFLoaderTest
 
     /*
      * verify variant feature(s) added to gene
+     * NB alleles at a locus may not be processed, and features added,
+     * in the order in which they appear in the VCF record as method
+     * VariantContext.getAlternateAlleles() does not guarantee order
+     * - order of assertions here matches what we find (is not important) 
      */
     List geneFeatures = al.getSequenceAt(0)
             .getSequenceFeatures();
-    assertEquals(geneFeatures.size(), 2);
+    SequenceFeatures.sortFeatures(geneFeatures, true);
+    assertEquals(geneFeatures.size(), 4);
     SequenceFeature sf = geneFeatures.get(0);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 2);
     assertEquals(sf.getEnd(), 2);
+    assertEquals(sf.getScore(), 4.0e-03, DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,C");
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    sf = geneFeatures.get(1);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 2);
+    assertEquals(sf.getEnd(), 2);
     assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
-    assertEquals(sf.getScore(), 5.08130e-03, 0.000001f);
+    assertEquals(sf.getScore(), 5.0e-03, DELTA);
     assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,T");
 
-    sf = geneFeatures.get(1);
+    sf = geneFeatures.get(2);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 4);
     assertEquals(sf.getEnd(), 4);
     assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
-    assertEquals(sf.getScore(), 3.08130e-03, 0.000001f);
+    assertEquals(sf.getScore(), 2.0e-03, DELTA);
     assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
 
+    sf = geneFeatures.get(3);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 4);
+    assertEquals(sf.getEnd(), 4);
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 3.0e-03, DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
+
     /*
      * verify variant feature(s) added to transcript
      */
     List transcriptFeatures = al.getSequenceAt(1)
             .getSequenceFeatures();
-    assertEquals(transcriptFeatures.size(), 1);
+    assertEquals(transcriptFeatures.size(), 2);
     sf = transcriptFeatures.get(0);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 2);
     assertEquals(sf.getEnd(), 2);
     assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
-    assertEquals(sf.getScore(), 3.08130e-03, 0.000001f);
+    assertEquals(sf.getScore(), 2.0e-03, DELTA);
     assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
+    sf = transcriptFeatures.get(1);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 2);
+    assertEquals(sf.getEnd(), 2);
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 3.0e-03, DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
 
     /*
-     * verify variant feature(s) computed and added to protein
+     * verify SNP variant feature(s) computed and added to protein
      * first codon AGC varies to ACC giving S/T
      */
     DBRefEntry[] dbRefs = al.getSequenceAt(1).getDBRefs();
@@ -147,7 +188,7 @@ public class VCFLoaderTest
      * from Ensembl and transcripts computed)
      */
     AlignmentI alignment = af.getViewport().getAlignment();
-    SequenceI gene1 = alignment.getSequenceAt(0);
+    SequenceI gene1 = alignment.findName("gene1");
     int[] to = new int[] { 45051610, 45051634 };
     int[] from = new int[] { gene1.getStart(), gene1.getEnd() };
     gene1.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, 1, 1));
@@ -158,7 +199,7 @@ public class VCFLoaderTest
      * which is chromosome 45051612-45051619,45051624-45051633
      */
     to = new int[] { 45051612, 45051619, 45051624, 45051633 };
-    SequenceI transcript1 = alignment.getSequenceAt(1);
+    SequenceI transcript1 = alignment.findName("transcript1");
     from = new int[] { transcript1.getStart(), transcript1.getEnd() };
     transcript1.setGeneLoci("human", "GRCh38", "17", new MapList(from, to,
             1, 1));
@@ -166,7 +207,7 @@ public class VCFLoaderTest
     /*
      * map gene2 to chromosome reverse strand
      */
-    SequenceI gene2 = alignment.getSequenceAt(2);
+    SequenceI gene2 = alignment.findName("gene2");
     to = new int[] { 45051634, 45051610 };
     from = new int[] { gene2.getStart(), gene2.getEnd() };
     gene2.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, 1, 1));
@@ -177,7 +218,7 @@ public class VCFLoaderTest
      * which is chromosome 45051633-45051624,45051619-45051612
      */
     to = new int[] { 45051633, 45051624, 45051619, 45051612 };
-    SequenceI transcript2 = alignment.getSequenceAt(3);
+    SequenceI transcript2 = alignment.findName("transcript2");
     from = new int[] { transcript2.getStart(), transcript2.getEnd() };
     transcript2.setGeneLoci("human", "GRCh38", "17", new MapList(from, to,
             1, 1));
@@ -201,6 +242,42 @@ public class VCFLoaderTest
     product = new DBRefEntry("", "", "ENSP002", map);
     transcript2.addDBRef(product);
 
+    /*
+     * map gene3 to chromosome 
+     */
+    SequenceI gene3 = alignment.findName("gene3");
+    to = new int[] { 45051610, 45051634 };
+    from = new int[] { gene3.getStart(), gene3.getEnd() };
+    gene3.setGeneLoci("human", "GRCh38", "5", new MapList(from, to, 1, 1));
+
+    /*
+     * map 'transcript3' to chromosome
+     */
+    SequenceI transcript3 = alignment.findName("transcript3");
+    to = new int[] { 45051612, 45051619, 45051624, 45051633 };
+    from = new int[] { transcript3.getStart(), transcript3.getEnd() };
+    transcript3.setGeneLoci("human", "GRCh38", "5", new MapList(from, to,
+            1, 1));
+
+    /*
+     * map 'transcript4' to chromosome
+     */
+    SequenceI transcript4 = alignment.findName("transcript4");
+    to = new int[] { 45051615, 45051617, 45051619, 45051632, 45051634,
+        45051634 };
+    from = new int[] { transcript4.getStart(), transcript4.getEnd() };
+    transcript4.setGeneLoci("human", "GRCh38", "5", new MapList(from, to,
+            1, 1));
+
+    /*
+     * add a protein product as a DBRef on transcript3
+     */
+    SequenceI peptide3 = new Sequence("ENSP003", "SWRECD");
+    mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
+    map = new Mapping(peptide3, mapList);
+    product = new DBRefEntry("", "", "ENSP003", map);
+    transcript3.addDBRef(product);
+
     return alignment;
   }
 
@@ -225,44 +302,69 @@ public class VCFLoaderTest
     /*
      * verify variant feature(s) added to gene2
      * gene/1-25 maps to chromosome 45051634- reverse strand
-     * variants A/T at 45051611 and G/C at 45051613 map to
-     * T/A and C/G at gene positions 24 and 22 respectively
+     * variants A/T, A/C at 45051611 and G/GA,G/C at 45051613 map to
+     * T/A, T/G and C/TC,C/G at gene positions 24 and 22 respectively
      */
     List geneFeatures = al.getSequenceAt(2)
             .getSequenceFeatures();
-    assertEquals(geneFeatures.size(), 2);
+    SequenceFeatures.sortFeatures(geneFeatures, true);
+    assertEquals(geneFeatures.size(), 4);
     SequenceFeature sf = geneFeatures.get(0);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 22);
     assertEquals(sf.getEnd(), 22);
     assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
-    assertEquals(sf.getScore(), 3.08130e-03, 0.000001f);
+    assertEquals(sf.getScore(), 2.0e-03, DELTA);
     assertEquals("C,G", sf.getValue(Gff3Helper.ALLELES));
 
     sf = geneFeatures.get(1);
     assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 22);
+    assertEquals(sf.getEnd(), 22);
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 3.0e-03, DELTA);
+    assertEquals("C,TC", sf.getValue(Gff3Helper.ALLELES));
+
+    sf = geneFeatures.get(2);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 24);
+    assertEquals(sf.getEnd(), 24);
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 4.0e-03, DELTA);
+    assertEquals("T,G", sf.getValue(Gff3Helper.ALLELES));
+
+    sf = geneFeatures.get(3);
+    assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 24);
     assertEquals(sf.getEnd(), 24);
     assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
-    assertEquals(sf.getScore(), 5.08130e-03, 0.000001f);
+    assertEquals(sf.getScore(), 5.0e-03, DELTA);
     assertEquals("T,A", sf.getValue(Gff3Helper.ALLELES));
 
     /*
      * verify variant feature(s) added to transcript2
-     * variant C/G at position 22 of gene overlaps and maps to
-     * position 17 of transcript
+     * variants G/GA,G/C at position 22 of gene overlap and map to
+     * C/TC,C/G at position 17 of transcript
      */
     List transcriptFeatures = al.getSequenceAt(3)
             .getSequenceFeatures();
-    assertEquals(transcriptFeatures.size(), 1);
+    assertEquals(transcriptFeatures.size(), 2);
     sf = transcriptFeatures.get(0);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 17);
     assertEquals(sf.getEnd(), 17);
     assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
-    assertEquals(sf.getScore(), 3.08130e-03, 0.000001f);
+    assertEquals(sf.getScore(), 2.0e-03, DELTA);
     assertEquals("C,G", sf.getValue(Gff3Helper.ALLELES));
 
+    sf = transcriptFeatures.get(1);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 17);
+    assertEquals(sf.getEnd(), 17);
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 3.0e-03, DELTA);
+    assertEquals("C,TC", sf.getValue(Gff3Helper.ALLELES));
+
     /*
      * verify variant feature(s) computed and added to protein
      * last codon GCT varies to GGT giving A/G in the last peptide position
@@ -287,18 +389,6 @@ public class VCFLoaderTest
   }
 
   /**
-   * Tests that where variant records have more than one SNP allele, a variant
-   * feature is created for each, and the corresponding data values set on it
-   * 
-   * @throws IOException
-   */
-  @Test(groups = "Functional")
-  public void testDoLoad_multipleAlleles() throws IOException
-  {
-    fail("todo");
-  }
-
-  /**
    * Tests that if VEP consequence (CSQ) data is present in the VCF data, then
    * it is added to the variant feature, but restricted where possible to the
    * consequences for a specific transcript
@@ -308,6 +398,174 @@ public class VCFLoaderTest
   @Test(groups = "Functional")
   public void testDoLoad_vepCsq() throws IOException
   {
-    fail("todo");
+    AlignmentI al = buildAlignment();
+
+    VCFLoader loader = new VCFLoader(al);
+
+    /*
+     * VCF data file with variants at gene3 positions
+     * 1 C/A
+     * 5 C/T
+     * 9 CGT/C (deletion)
+     * 13 C/G, C/T
+     * 17 A/AC (insertion), A/G
+     */
+    loader.doLoad("test/jalview/io/vcf/testVcf.dat", null);
+
+    /*
+     * verify variant feature(s) added to gene3
+     */
+    List geneFeatures = al.findName("gene3")
+            .getSequenceFeatures();
+    SequenceFeatures.sortFeatures(geneFeatures, true);
+    assertEquals(geneFeatures.size(), 7);
+    SequenceFeature sf = geneFeatures.get(0);
+    assertEquals(sf.getBegin(), 1);
+    assertEquals(sf.getEnd(), 1);
+    assertEquals(sf.getScore(), 0.1f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,A");
+    // gene features include Consequence for all transcripts
+    assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2);
+
+    sf = geneFeatures.get(1);
+    assertEquals(sf.getBegin(), 5);
+    assertEquals(sf.getEnd(), 5);
+    assertEquals(sf.getScore(), 0.2f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,T");
+    assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2);
+
+    sf = geneFeatures.get(2);
+    assertEquals(sf.getBegin(), 9);
+    assertEquals(sf.getEnd(), 11); // deletion over 3 positions
+    assertEquals(sf.getScore(), 0.3f, DELTA);
+    assertEquals(sf.getValue("alleles"), "CGG,C");
+    assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2);
+
+    sf = geneFeatures.get(3);
+    assertEquals(sf.getBegin(), 13);
+    assertEquals(sf.getEnd(), 13);
+    assertEquals(sf.getScore(), 0.5f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,T");
+    assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2);
+
+    sf = geneFeatures.get(4);
+    assertEquals(sf.getBegin(), 13);
+    assertEquals(sf.getEnd(), 13);
+    assertEquals(sf.getScore(), 0.4f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,G");
+    assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2);
+
+    sf = geneFeatures.get(5);
+    assertEquals(sf.getBegin(), 17);
+    assertEquals(sf.getEnd(), 17);
+    assertEquals(sf.getScore(), 0.7f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,G");
+    assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2);
+
+    sf = geneFeatures.get(6);
+    assertEquals(sf.getBegin(), 17);
+    assertEquals(sf.getEnd(), 17); // insertion
+    assertEquals(sf.getScore(), 0.6f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,AC");
+    assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2);
+
+    /*
+     * verify variant feature(s) added to transcript3
+     * at columns 5 (1), 17 (2), positions 3, 11
+     * note the deletion at columns 9-11 is not transferred since col 11
+     * has no mapping to transcript 3 
+     */
+    List transcriptFeatures = al.findName("transcript3")
+            .getSequenceFeatures();
+    SequenceFeatures.sortFeatures(transcriptFeatures, true);
+    assertEquals(transcriptFeatures.size(), 3);
+    sf = transcriptFeatures.get(0);
+    assertEquals(sf.getBegin(), 3);
+    assertEquals(sf.getEnd(), 3);
+    assertEquals(sf.getScore(), 0.2f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,T");
+    // transcript features only have Consequence for that transcripts
+    assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1);
+    assertTrue(sf.getValue("CSQ").toString().contains("transcript3"));
+
+    sf = transcriptFeatures.get(1);
+    assertEquals(sf.getBegin(), 11);
+    assertEquals(sf.getEnd(), 11);
+    assertEquals(sf.getScore(), 0.7f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,G");
+    assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1);
+    assertTrue(sf.getValue("CSQ").toString().contains("transcript3"));
+
+    sf = transcriptFeatures.get(2);
+    assertEquals(sf.getBegin(), 11);
+    assertEquals(sf.getEnd(), 11);
+    assertEquals(sf.getScore(), 0.6f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,AC");
+    assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1);
+    assertTrue(sf.getValue("CSQ").toString().contains("transcript3"));
+
+    /*
+     * verify variants computed on protein product for transcript3
+     * peptide is SWRECD
+     * codon variants are AGC/AGT position 1 which is synonymous
+     * and GAG/GGG which is E/G in position 4
+     * the insertion variant is not transferred to the peptide
+     */
+    DBRefEntry[] dbRefs = al.findName("transcript3").getDBRefs();
+    SequenceI peptide = null;
+    for (DBRefEntry dbref : dbRefs)
+    {
+      if (dbref.getMap().getMap().getFromRatio() == 3)
+      {
+        peptide = dbref.getMap().getTo();
+      }
+    }
+    List proteinFeatures = peptide.getSequenceFeatures();
+    assertEquals(proteinFeatures.size(), 1);
+    sf = proteinFeatures.get(0);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 4);
+    assertEquals(sf.getEnd(), 4);
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getDescription(), "p.Glu4Gly");
+
+    /*
+     * verify variant feature(s) added to transcript4
+     * at columns 13 (2) and 17 (2), positions 7 and 11
+     */
+    transcriptFeatures = al.findName("transcript4").getSequenceFeatures();
+    SequenceFeatures.sortFeatures(transcriptFeatures, true);
+    assertEquals(transcriptFeatures.size(), 4);
+    sf = transcriptFeatures.get(0);
+    assertEquals(sf.getBegin(), 7);
+    assertEquals(sf.getEnd(), 7);
+    assertEquals(sf.getScore(), 0.5f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,T");
+    assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1);
+    assertTrue(sf.getValue("CSQ").toString().contains("transcript4"));
+
+    sf = transcriptFeatures.get(1);
+    assertEquals(sf.getBegin(), 7);
+    assertEquals(sf.getEnd(), 7);
+    assertEquals(sf.getScore(), 0.4f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,G");
+    assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1);
+    assertTrue(sf.getValue("CSQ").toString().contains("transcript4"));
+
+    sf = transcriptFeatures.get(2);
+    assertEquals(sf.getBegin(), 11);
+    assertEquals(sf.getEnd(), 11);
+    assertEquals(sf.getScore(), 0.7f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,G");
+    assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1);
+    assertTrue(sf.getValue("CSQ").toString().contains("transcript4"));
+
+    sf = transcriptFeatures.get(3);
+    assertEquals(sf.getBegin(), 11);
+    assertEquals(sf.getEnd(), 11);
+    assertEquals(sf.getScore(), 0.6f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,AC");
+    assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1);
+    assertTrue(sf.getValue("CSQ").toString().contains("transcript4"));
   }
 }
diff --git a/test/jalview/io/vcf/testVcf.dat b/test/jalview/io/vcf/testVcf.dat
new file mode 100644
index 0000000..e9e6c22
--- /dev/null
+++ b/test/jalview/io/vcf/testVcf.dat
@@ -0,0 +1,13 @@
+##fileformat=VCFv4.2
+##INFO=
+##INFO=
+##INFO=
+##INFO=
+##INFO=
+##reference=GRCh38
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO
+5	45051610	.	C	A	81.96	RF;AC0	AC=1;AF=0.1;AN=0;AF_Female=2;AB_MEDIAN=6.00000e-01;CSQ=A|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,A|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad
+5	45051614	.	C	T	1666.64	RF	AC=1;AF=0.2;AN=0;AF_Female=2;AB_MEDIAN=6.00000e-01;CSQ=T|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,T|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad
+5	45051618	.	CGG	C	41.94	AC0	AC=1;AF=0.3;AN=0;AF_Female=2;AB_MEDIAN=6.00000e-01;CSQ=C|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,C|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad,CSQ=CGT|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,CGT|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad
+5	45051622	.	C	G,T	224.23	RF;AC0	AC=1,2;AF=0.4,0.5;AN=0;AF_Female=2;AB_MEDIAN=6.00000e-01;CSQ=G|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,G|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad,T|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,T|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad
+5	45051626	.	A	AC,G	433.35	RF;AC0	AC=3,4;AF=0.6,0.7;AN=0;AF_Female=2;AB_MEDIAN=6.00000e-01;CSQ=G|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,G|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad,AC|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,AC|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad
diff --git a/test/jalview/util/MapListTest.java b/test/jalview/util/MapListTest.java
index f3395ca..d2db258 100644
--- a/test/jalview/util/MapListTest.java
+++ b/test/jalview/util/MapListTest.java
@@ -931,5 +931,13 @@ public class MapListTest
     toRanges = compound.getToRanges();
     assertEquals(toRanges.size(), 1);
     assertArrayEquals(new int[] { 47, 50, 71, 126 }, toRanges.get(0));
+
+    /*
+     * method returns null if not all regions are mapped through
+     */
+    ml1 = new MapList(new int[] { 1, 50 }, new int[] { 101, 150 }, 1, 1);
+    ml2 = new MapList(new int[] { 131, 180 }, new int[] { 201, 250 }, 1, 3);
+    compound = ml1.traverse(ml2);
+    assertNull(compound);
   }
 }