From: gmungoc Date: Fri, 2 Feb 2018 15:55:11 +0000 (+0000) Subject: Merge branch 'feature/JAL-984splitAdjuster' into features/JAL-1793VCF X-Git-Tag: Release_2_11_0~63 X-Git-Url: http://source.jalview.org/gitweb/?a=commitdiff_plain;h=537da9c65518c52985308b67c499fe6a60a607ce;hp=c1abd9108f6a78bc4e900746ba2a4f3307a218fc;p=jalview.git Merge branch 'feature/JAL-984splitAdjuster' into features/JAL-1793VCF --- diff --git a/.classpath b/.classpath index d704f10..c85feaf 100644 --- a/.classpath +++ b/.classpath @@ -48,11 +48,9 @@ - - @@ -68,6 +66,8 @@ + + diff --git a/.settings/org.eclipse.jdt.core.prefs b/.settings/org.eclipse.jdt.core.prefs index 8a5e7a7..5908bb2 100644 --- a/.settings/org.eclipse.jdt.core.prefs +++ b/.settings/org.eclipse.jdt.core.prefs @@ -1,15 +1,15 @@ eclipse.preferences.version=1 org.eclipse.jdt.core.compiler.codegen.inlineJsrBytecode=enabled org.eclipse.jdt.core.compiler.codegen.methodParameters=do not generate -org.eclipse.jdt.core.compiler.codegen.targetPlatform=1.7 +org.eclipse.jdt.core.compiler.codegen.targetPlatform=1.8 org.eclipse.jdt.core.compiler.codegen.unusedLocal=preserve -org.eclipse.jdt.core.compiler.compliance=1.7 +org.eclipse.jdt.core.compiler.compliance=1.8 org.eclipse.jdt.core.compiler.debug.lineNumber=generate org.eclipse.jdt.core.compiler.debug.localVariable=generate org.eclipse.jdt.core.compiler.debug.sourceFile=generate org.eclipse.jdt.core.compiler.problem.assertIdentifier=error org.eclipse.jdt.core.compiler.problem.enumIdentifier=error -org.eclipse.jdt.core.compiler.source=1.7 +org.eclipse.jdt.core.compiler.source=1.8 org.eclipse.jdt.core.formatter.align_type_members_on_columns=false org.eclipse.jdt.core.formatter.alignment_for_arguments_in_allocation_expression=16 org.eclipse.jdt.core.formatter.alignment_for_arguments_in_annotation=52 diff --git a/build.xml b/build.xml index 4931cfb..89c3d24 100755 --- a/build.xml +++ b/build.xml @@ -106,8 +106,8 @@ - - + + @@ -425,7 +425,7 @@ - + @@ -451,10 +451,9 @@ - - j2se version="1.7+" - - + + j2se version="1.8+" + @@ -624,7 +623,7 @@ - + diff --git a/examples/exampleFeatures.txt b/examples/exampleFeatures.txt index 9e65534..99af214 100755 --- a/examples/exampleFeatures.txt +++ b/examples/exampleFeatures.txt @@ -26,6 +26,11 @@ BETA-TURN-IIL 8b5b50 ST-MOTIF ac25a1 kdHydrophobicity ccffcc|333300|-3.9|4.5|above|-2.0 +STARTFILTERS +GAMMA-TURN-INVERSE Label Contains PDB +kdHydrophobicity (Score LT 1.5) OR (Score GE 2.8) +ENDFILTERS + STARTGROUP uniprot Pfam family FER_CAPAA -1 0 0 Pfam Iron-sulfur (2Fe-2S) FER_CAPAA -1 39 39 METAL diff --git a/lib/htsjdk-2.12.0.jar b/lib/htsjdk-2.12.0.jar new file mode 100644 index 0000000..1df12b2 Binary files /dev/null and b/lib/htsjdk-2.12.0.jar differ diff --git a/resources/lang/Messages.properties b/resources/lang/Messages.properties index f526699..3f5aa94 100644 --- a/resources/lang/Messages.properties +++ b/resources/lang/Messages.properties @@ -242,7 +242,6 @@ label.documentation = Documentation label.about = About... label.show_sequence_limits = Show Sequence Limits action.feature_settings = Feature Settings... -label.feature_settings = Feature Settings label.all_columns = All Columns label.all_sequences = All Sequences label.selected_columns = Selected Columns @@ -274,6 +273,7 @@ label.chimera_missing = Chimera structure viewer not found.
Please enter the label.chimera_failed = Error opening Chimera - is it installed?\nCheck path in Preferences, Structure label.min_colour = Minimum Colour label.max_colour = Maximum Colour +label.no_colour = No Colour label.use_original_colours = Use Original Colours label.threshold_minmax = Threshold is min/max label.represent_group_with = Represent Group with {0} @@ -281,9 +281,9 @@ label.selection = Selection label.group_colour = Group Colour label.sequence = Sequence label.view_pdb_structure = View PDB Structure -label.min = Min: -label.max = Max: -label.colour_by_label = Colour by label +label.min_value = Min value +label.max_value = Max value +label.no_value = No value label.new_feature = New Feature label.match_case = Match Case label.view_alignment_editor = View in alignment editor @@ -368,6 +368,8 @@ label.optimise_order = Optimise Order label.seq_sort_by_score = Sequence sort by Score label.load_colours = Load Colours label.save_colours = Save Colours +label.load_colours_tooltip = Load feature colours and filters from file +label.save_colours_tooltip = Save feature colours and filters to file label.fetch_das_features = Fetch DAS Features label.selected_database_to_fetch_from = Selected {0} database {1} to fetch from {2} label.database_param = Database: {0} @@ -490,6 +492,10 @@ label.settings_for_type = Settings for {0} label.view_full_application = View in Full Application label.load_associated_tree = Load Associated Tree... label.load_features_annotations = Load Features/Annotations... +label.load_vcf = Load SNP variants from plain text or indexed VCF data +label.load_vcf_file = Load VCF File +label.searching_vcf = Loading VCF variants... +label.added_vcf = Added {0} VCF variants to {1} sequence(s) label.export_features = Export Features... label.export_annotations = Export Annotations... label.to_upper_case = To Upper Case @@ -528,7 +534,6 @@ label.threshold_feature_above_threshold = Above Threshold label.threshold_feature_below_threshold = Below Threshold label.adjust_threshold = Adjust threshold label.toggle_absolute_relative_display_threshold = Toggle between absolute and relative display threshold. -label.display_features_same_type_different_label_using_different_colour = Display features of the same type with a different label using a different colour. (e.g. domain features) label.select_colour_minimum_value = Select Colour for Minimum Value label.select_colour_maximum_value = Select Colour for Maximum Value label.open_url_param = Open URL {0} @@ -780,7 +785,7 @@ label.pairwise_aligned_sequences = Pairwise Aligned Sequences label.original_data_for_params = Original Data for {0} label.points_for_params = Points for {0} label.transformed_points_for_params = Transformed points for {0} -label.graduated_color_for_params = Graduated Feature Colour for {0} +label.variable_color_for = Variable Feature Colour for {0} label.select_background_colour = Select Background Colour label.invalid_font = Invalid Font label.separate_multiple_accession_ids = Enter one or more accession IDs separated by a semi-colon ";" @@ -867,7 +872,7 @@ label.msa_service_is_unknown = The Multiple Sequence Alignment Service named {0} label.service_called_is_not_seq_search_service = The Service called \n{0}\nis not a \nSequence Search Service\! label.seq_search_service_is_unknown = The Sequence Search Service named {0} is unknown label.feature_type = Feature Type -label.display = Display +label.show = Show label.service_url = Service URL label.copied_sequences = Copied sequences label.cut_sequences = Cut Sequences @@ -1320,9 +1325,41 @@ label.select_hidden_colour = Select hidden colour label.overview = Overview label.reset_to_defaults = Reset to defaults label.oview_calc = Recalculating overview... +label.feature_details = Feature details +label.matchCondition_contains = Contains +label.matchCondition_notcontains = Does not contain +label.matchCondition_matches = Matches +label.matchCondition_notmatches = Does not match +label.matchCondition_present = Is present +label.matchCondition_notpresent = Is not present +label.matchCondition_eq = = +label.matchCondition_ne = not = +label.matchCondition_lt = < +label.matchCondition_le = <= +label.matchCondition_gt = > +label.matchCondition_ge = >= +label.numeric_required = The value should be numeric +label.filter = Filter +label.filters = Filters +label.join_conditions = Join conditions with +label.score = Score +label.colour_by_label = Colour by label +label.variable_colour = Variable colour... +label.select_colour = Select colour option.enable_disable_autosearch = When ticked, search is performed automatically option.autosearch = Autosearch label.retrieve_ids = Retrieve IDs +label.display_settings_for = Display settings for {0} features +label.simple = Simple +label.simple_colour = Simple Colour +label.colour_by_text = Colour by text +label.graduated_colour = Graduated Colour +label.by_text_of = By text of +label.by_range_of = By range of +label.filters_tooltip = Click to set or amend filters +label.or = Or +label.and = And +label.sequence_feature_colours = Sequence Feature Colours label.best_quality = Best Quality label.best_resolution = Best Resolution label.most_protein_chain = Most Protein Chain diff --git a/resources/lang/Messages_es.properties b/resources/lang/Messages_es.properties index 77f053e..e42d6b8 100644 --- a/resources/lang/Messages_es.properties +++ b/resources/lang/Messages_es.properties @@ -226,7 +226,6 @@ label.automatic_scrolling = Desplazamiento autom label.documentation = Documentación label.about = Acerca de... label.show_sequence_limits = Mostrar los límites de la secuencia -label.feature_settings = Ajustar funciones... label.all_columns = Todas las columnas label.all_sequences = Todas las secuencias label.selected_columns = Columnas seleccionadas @@ -243,6 +242,7 @@ label.apply_all_groups = Aplicar a todos los grupos label.autocalculated_annotation = Anotación autocalculada label.min_colour = Color mínimo label.max_colour = Color máximo +label.no_colour = Sin color label.use_original_colours = Usar colores originales label.threshold_minmax = El umbral es mín/máx label.represent_group_with = Representar al grupo con @@ -250,8 +250,9 @@ label.selection = Seleccionar label.group_colour = Color del grupo label.sequence = Secuencia label.view_pdb_structure = Ver estructura PDB -label.min = Mín: -label.max = Máx: +label.max_value = Valor máximo +label.min_value = Valor mínimo +label.no_value = Sin valor label.colour_by_label = Color por etiquetas label.new_feature = Nueva función label.match_case = Hacer corresponder mayúsculas y minúsculas @@ -336,6 +337,8 @@ label.optimise_order = Optimizar orden label.seq_sort_by_score = Ordenar las secuencias por puntuación label.load_colours = Cargar colores label.save_colours = Guardar colores +label.load_colours_tooltip = Cargar colores y filtros desde fichero +label.save_colours_tooltip = Guardar colores y filtros en fichero label.fetch_das_features = Recuperar funciones DAS label.selected_database_to_fetch_from = Seleccionada {0} Base de datos {1} para buscar de {2} label.database_param = Base de datos: {0} @@ -456,6 +459,10 @@ label.settings_for_type = Ajustes para {0} label.view_full_application = Ver en la aplicación completa label.load_associated_tree = Cargar árbol asociado ... label.load_features_annotations = Cargar características/anotaciones ... +label.load_vcf = Cargar variantes SNP desde fichero VCF texto o tab-indexado +label.load_vcf_file = Cargar fichero VCF +label.searching_vcf = Cargando variantes VCF... +label.added_vcf= {0} variantes VCF añadidas a {1} secuencia(s) label.export_features = Exportar características... label.export_annotations = Exportar anotaciones ... label.to_upper_case = Pasar a mayúsculas @@ -489,7 +496,6 @@ label.threshold_feature_above_threshold = Por encima del umbral label.threshold_feature_below_threshold = Por debajo del umbral label.adjust_threshold = Ajustar umbral label.toggle_absolute_relative_display_threshold = Cambiar entre mostrar el umbral absoluto y el relativo. -label.display_features_same_type_different_label_using_different_colour = Mostrar las características del mismo tipo con una etiqueta diferente y empleando un color distinto (p.e. características del dominio) label.select_colour_minimum_value = Seleccionar el color para el valor mínimo label.select_colour_maximum_value = Seleccionar el color para el valor máximo label.open_url_param = Abrir URL {0} @@ -709,7 +715,7 @@ label.pairwise_aligned_sequences = Secuencias alineadas a pares label.original_data_for_params = Datos originales de {0} label.points_for_params = Puntos de {0} label.transformed_points_for_params = Puntos transformados de {0} -label.graduated_color_for_params = Color graduado para la característica de {0} +label.variable_color_for = Color variable para la característica de {0} label.select_background_colour = Seleccionar color de fondo label.invalid_font = Fuente no válida label.separate_multiple_accession_ids = Separar los accession id con un punto y coma ";" @@ -792,7 +798,7 @@ label.msa_service_is_unknown = El Servicio de Alineamiento M label.service_called_is_not_seq_search_service = El Servicio llamando \n{0}\nno es un \nServicio de B\u00FAsqueda de Secuencias\! label.seq_search_service_is_unknown = El Servicio de Búsqueda de Sencuencias llamado {0} es desconocido label.feature_type = Tipo de característisca -label.display = Representación +label.show = Mostrar label.service_url = URL del servicio label.copied_sequences = Secuencias copiadas label.cut_sequences = Cortar secuencias @@ -1320,9 +1326,41 @@ label.select_hidden_colour = Seleccionar color de las regiones ocultas label.overview = Resumen label.reset_to_defaults = Restablecen a los predeterminados label.oview_calc = Recalculando resumen +label.feature_details = Detalles de característica +label.matchCondition_contains = Contiene +label.matchCondition_notcontains = No contiene +label.matchCondition_matches = Es igual a +label.matchCondition_notmatches = No es igual a +label.matchCondition_present = Está presente +label.matchCondition_notpresent = No está presente +label.matchCondition_eq = = +label.matchCondition_ne = not = +label.matchCondition_lt = < +label.matchCondition_le = <= +label.matchCondition_gt = > +label.matchCondition_ge = >= +label.numeric_required = Valor numérico requerido +label.filter = Filtro +label.filters = Filtros +label.join_conditions = Combinar condiciones con +label.score = Puntuación +label.colour_by_label = Colorear por texto +label.variable_colour = Color variable... +label.select_colour = Seleccionar color option.enable_disable_autosearch = Marcar para buscar automáticamente option.autosearch = Auto búsqueda label.retrieve_ids = Recuperar IDs +label.display_settings_for = Visualización de características {0} +label.simple = Simple +label.simple_colour = Color simple +label.colour_by_text = Colorear por texto +label.graduated_colour = Color graduado +label.by_text_of = Por texto de +label.by_range_of = Por rango de +label.filters_tooltip = Haga clic para configurar o modificar los filtros +label.or = O +label.and = Y +label.sequence_feature_colours = Colores de características de las secuencias label.best_quality = Mejor Calidad label.best_resolution = Mejor Resolución label.most_protein_chain = Más Cadena de Proteína diff --git a/schemas/JalviewUserColours.xsd b/schemas/JalviewUserColours.xsd index bd43e9d..3934d66 100755 --- a/schemas/JalviewUserColours.xsd +++ b/schemas/JalviewUserColours.xsd @@ -16,8 +16,7 @@ You should have received a copy of the GNU General Public License along with Jalview. If not, see . --> - - + @@ -29,13 +28,29 @@ - + + + + name of feature attribute to colour by, or attribute and sub-attribute + + + + + + Single letter residue code for an alignment colour scheme, or feature type for a feature colour scheme + + - - - loosely specified enumeration: NONE,ABOVE, or BELOW - + + + + + + + + + @@ -44,7 +59,68 @@ + + + + + + + + + + + + A feature match condition, which may be simple or compound + + + + + + + + + + + If true, matchers are AND-ed, if false they are OR-ed + + + + + + + + + + + + name of feature attribute to filter on, or attribute and sub-attribute + + + + + + + + + + + + + + + + + + + Graduated feature colour if no score (or attribute) value + + + + + + + diff --git a/schemas/jalview.xsd b/schemas/jalview.xsd index f0bd638..48824e7 100755 --- a/schemas/jalview.xsd +++ b/schemas/jalview.xsd @@ -500,6 +500,18 @@ + + + + name of feature attribute to colour by, or attribute and sub-attribute + + + + + optional filter(s) applied to the feature type + + + + @@ -559,6 +572,11 @@ + + + key2 may be used for a sub-attribute of key + + diff --git a/src/jalview/analysis/AlignmentUtils.java b/src/jalview/analysis/AlignmentUtils.java index 90d9197..bdc5fc1 100644 --- a/src/jalview/analysis/AlignmentUtils.java +++ b/src/jalview/analysis/AlignmentUtils.java @@ -29,6 +29,7 @@ import jalview.datamodel.Alignment; import jalview.datamodel.AlignmentAnnotation; import jalview.datamodel.AlignmentI; import jalview.datamodel.DBRefEntry; +import jalview.datamodel.GeneLociI; import jalview.datamodel.IncompleteCodonException; import jalview.datamodel.Mapping; import jalview.datamodel.Sequence; @@ -36,6 +37,7 @@ import jalview.datamodel.SequenceFeature; import jalview.datamodel.SequenceGroup; import jalview.datamodel.SequenceI; import jalview.datamodel.features.SequenceFeatures; +import jalview.io.gff.Gff3Helper; import jalview.io.gff.SequenceOntologyI; import jalview.schemes.ResidueProperties; import jalview.util.Comparison; @@ -105,6 +107,15 @@ public class AlignmentUtils { return variant == null ? null : variant.getFeatureGroup(); } + + /** + * toString for aid in the debugger only + */ + @Override + public String toString() + { + return base + ":" + (variant == null ? "" : variant.getDescription()); + } } /** @@ -117,7 +128,7 @@ public class AlignmentUtils */ public static AlignmentI expandContext(AlignmentI core, int flankSize) { - List sq = new ArrayList(); + List sq = new ArrayList<>(); int maxoffset = 0; for (SequenceI s : core.getSequences()) { @@ -247,7 +258,7 @@ public class AlignmentUtils public static Map> getSequencesByName( AlignmentI al) { - Map> theMap = new LinkedHashMap>(); + Map> theMap = new LinkedHashMap<>(); for (SequenceI seq : al.getSequences()) { String name = seq.getName(); @@ -256,7 +267,7 @@ public class AlignmentUtils List seqs = theMap.get(name); if (seqs == null) { - seqs = new ArrayList(); + seqs = new ArrayList<>(); theMap.put(name, seqs); } seqs.add(seq); @@ -283,8 +294,8 @@ public class AlignmentUtils return false; } - Set mappedDna = new HashSet(); - Set mappedProtein = new HashSet(); + Set mappedDna = new HashSet<>(); + Set mappedProtein = new HashSet<>(); /* * First pass - map sequences where cross-references exist. This include @@ -384,7 +395,7 @@ public class AlignmentUtils * Answers true if the mappings include one between the given (dataset) * sequences. */ - public static boolean mappingExists(List mappings, + protected static boolean mappingExists(List mappings, SequenceI aaSeq, SequenceI cdnaSeq) { if (mappings != null) @@ -454,7 +465,7 @@ public class AlignmentUtils { String lastCodon = String.valueOf(cdnaSeqChars, cdnaLength - CODON_LENGTH, CODON_LENGTH).toUpperCase(); - for (String stop : ResidueProperties.STOP) + for (String stop : ResidueProperties.STOP_CODONS) { if (lastCodon.equals(stop)) { @@ -525,7 +536,8 @@ public class AlignmentUtils * allow * in protein to match untranslatable in dna */ final char aaRes = aaSeqChars[aaPos]; - if ((translated == null || "STOP".equals(translated)) && aaRes == '*') + if ((translated == null || ResidueProperties.STOP.equals(translated)) + && aaRes == '*') { continue; } @@ -557,7 +569,8 @@ public class AlignmentUtils if (dnaPos == cdnaSeqChars.length - CODON_LENGTH) { String codon = String.valueOf(cdnaSeqChars, dnaPos, CODON_LENGTH); - if ("STOP".equals(ResidueProperties.codonTranslate(codon))) + if (ResidueProperties.STOP + .equals(ResidueProperties.codonTranslate(codon))) { return true; } @@ -870,7 +883,7 @@ public class AlignmentUtils System.err.println("Wrong alignment type in alignProteinAsDna"); return 0; } - List unmappedProtein = new ArrayList(); + List unmappedProtein = new ArrayList<>(); Map> alignedCodons = buildCodonColumnsMap( protein, dna, unmappedProtein); return alignProteinAs(protein, alignedCodons, unmappedProtein); @@ -1081,7 +1094,7 @@ public class AlignmentUtils * {dnaSequence, {proteinSequence, codonProduct}} at that position. The * comparator keeps the codon positions ordered. */ - Map> alignedCodons = new TreeMap>( + Map> alignedCodons = new TreeMap<>( new CodonComparator()); for (SequenceI dnaSeq : dna.getSequences()) @@ -1127,9 +1140,9 @@ public class AlignmentUtils // TODO delete this ugly hack once JAL-2022 is resolved // i.e. we can model startPhase > 0 (incomplete start codon) - List sequencesChecked = new ArrayList(); + List sequencesChecked = new ArrayList<>(); AlignedCodon lastCodon = null; - Map toAdd = new HashMap(); + Map toAdd = new HashMap<>(); for (Entry> entry : alignedCodons .entrySet()) @@ -1308,7 +1321,7 @@ public class AlignmentUtils Map seqProduct = alignedCodons.get(codon); if (seqProduct == null) { - seqProduct = new HashMap(); + seqProduct = new HashMap<>(); alignedCodons.put(codon, seqProduct); } seqProduct.put(protein, codon); @@ -1445,7 +1458,7 @@ public class AlignmentUtils { continue; } - final List result = new ArrayList(); + final List result = new ArrayList<>(); for (AlignmentAnnotation dsann : datasetAnnotations) { /* @@ -1627,17 +1640,17 @@ public class AlignmentUtils throw new IllegalArgumentException( "IMPLEMENTATION ERROR: dataset.getDataset() must be null!"); } - List foundSeqs = new ArrayList(); - List cdsSeqs = new ArrayList(); + List foundSeqs = new ArrayList<>(); + List cdsSeqs = new ArrayList<>(); List mappings = dataset.getCodonFrames(); HashSet productSeqs = null; if (products != null) { - productSeqs = new HashSet(); + productSeqs = new HashSet<>(); for (SequenceI seq : products) { - productSeqs.add(seq.getDatasetSequence() == null ? seq - : seq.getDatasetSequence()); + productSeqs.add(seq.getDatasetSequence() == null ? seq : seq + .getDatasetSequence()); } } @@ -1730,9 +1743,8 @@ public class AlignmentUtils /* * add a mapping from CDS to the (unchanged) mapped to range */ - List cdsRange = Collections - .singletonList(new int[] - { 1, cdsSeq.getLength() }); + List cdsRange = Collections.singletonList(new int[] { 1, + cdsSeq.getLength() }); MapList cdsToProteinMap = new MapList(cdsRange, mapList.getToRanges(), mapList.getFromRatio(), mapList.getToRatio()); @@ -1754,7 +1766,7 @@ public class AlignmentUtils * add another mapping from original 'from' range to CDS */ AlignedCodonFrame dnaToCdsMapping = new AlignedCodonFrame(); - MapList dnaToCdsMap = new MapList(mapList.getFromRanges(), + final MapList dnaToCdsMap = new MapList(mapList.getFromRanges(), cdsRange, 1, 1); dnaToCdsMapping.addMap(dnaSeq.getDatasetSequence(), cdsSeqDss, dnaToCdsMap); @@ -1764,6 +1776,13 @@ public class AlignmentUtils } /* + * transfer dna chromosomal loci (if known) to the CDS + * sequence (via the mapping) + */ + final MapList cdsToDnaMap = dnaToCdsMap.getInverse(); + transferGeneLoci(dnaSeq, cdsToDnaMap, cdsSeq); + + /* * add DBRef with mapping from protein to CDS * (this enables Get Cross-References from protein alignment) * This is tricky because we can't have two DBRefs with the @@ -1782,26 +1801,30 @@ public class AlignmentUtils for (DBRefEntry primRef : dnaDss.getPrimaryDBRefs()) { - // creates a complementary cross-reference to the source sequence's - // primary reference. - - DBRefEntry cdsCrossRef = new DBRefEntry(primRef.getSource(), - primRef.getSource() + ":" + primRef.getVersion(), - primRef.getAccessionId()); - cdsCrossRef - .setMap(new Mapping(dnaDss, new MapList(dnaToCdsMap))); + /* + * create a cross-reference from CDS to the source sequence's + * primary reference and vice versa + */ + String source = primRef.getSource(); + String version = primRef.getVersion(); + DBRefEntry cdsCrossRef = new DBRefEntry(source, source + ":" + + version, primRef.getAccessionId()); + cdsCrossRef.setMap(new Mapping(dnaDss, new MapList(cdsToDnaMap))); cdsSeqDss.addDBRef(cdsCrossRef); + dnaSeq.addDBRef(new DBRefEntry(source, version, cdsSeq + .getName(), new Mapping(cdsSeqDss, dnaToCdsMap))); + // problem here is that the cross-reference is synthesized - // cdsSeq.getName() may be like 'CDS|dnaaccession' or // 'CDS|emblcdsacc' // assuming cds version same as dna ?!? - DBRefEntry proteinToCdsRef = new DBRefEntry(primRef.getSource(), - primRef.getVersion(), cdsSeq.getName()); + DBRefEntry proteinToCdsRef = new DBRefEntry(source, version, + cdsSeq.getName()); // - proteinToCdsRef.setMap( - new Mapping(cdsSeqDss, cdsToProteinMap.getInverse())); + proteinToCdsRef.setMap(new Mapping(cdsSeqDss, cdsToProteinMap + .getInverse())); proteinProduct.addDBRef(proteinToCdsRef); } @@ -1814,14 +1837,46 @@ public class AlignmentUtils } } - AlignmentI cds = new Alignment( - cdsSeqs.toArray(new SequenceI[cdsSeqs.size()])); + AlignmentI cds = new Alignment(cdsSeqs.toArray(new SequenceI[cdsSeqs + .size()])); cds.setDataset(dataset); return cds; } /** + * Tries to transfer gene loci (dbref to chromosome positions) from fromSeq to + * toSeq, mediated by the given mapping between the sequences + * + * @param fromSeq + * @param targetToFrom + * Map + * @param targetSeq + */ + protected static void transferGeneLoci(SequenceI fromSeq, + MapList targetToFrom, SequenceI targetSeq) + { + if (targetSeq.getGeneLoci() != null) + { + // already have - don't override + return; + } + GeneLociI fromLoci = fromSeq.getGeneLoci(); + if (fromLoci == null) + { + return; + } + + MapList newMap = targetToFrom.traverse(fromLoci.getMap()); + + if (newMap != null) + { + targetSeq.setGeneLoci(fromLoci.getSpeciesId(), + fromLoci.getAssemblyId(), fromLoci.getChromosomeId(), newMap); + } + } + + /** * A helper method that finds a CDS sequence in the alignment dataset that is * mapped to the given protein sequence, and either is, or has a mapping from, * the given dna sequence. @@ -1989,21 +2044,21 @@ public class AlignmentUtils } /** - * add any DBRefEntrys to cdsSeq from contig that have a Mapping congruent to + * Adds any DBRefEntrys to cdsSeq from contig that have a Mapping congruent to * the given mapping. * * @param cdsSeq * @param contig + * @param proteinProduct * @param mapping - * @return list of DBRefEntrys added. + * @return list of DBRefEntrys added */ - public static List propagateDBRefsToCDS(SequenceI cdsSeq, + protected static List propagateDBRefsToCDS(SequenceI cdsSeq, SequenceI contig, SequenceI proteinProduct, Mapping mapping) { - - // gather direct refs from contig congrent with mapping - List direct = new ArrayList(); - HashSet directSources = new HashSet(); + // gather direct refs from contig congruent with mapping + List direct = new ArrayList<>(); + HashSet directSources = new HashSet<>(); if (contig.getDBRefs() != null) { for (DBRefEntry dbr : contig.getDBRefs()) @@ -2023,7 +2078,7 @@ public class AlignmentUtils DBRefEntry[] onSource = DBRefUtils.selectRefs( proteinProduct.getDBRefs(), directSources.toArray(new String[0])); - List propagated = new ArrayList(); + List propagated = new ArrayList<>(); // and generate appropriate mappings for (DBRefEntry cdsref : direct) @@ -2081,7 +2136,7 @@ public class AlignmentUtils * subtypes in the Sequence Ontology) * @param omitting */ - public static int transferFeatures(SequenceI fromSeq, SequenceI toSeq, + protected static int transferFeatures(SequenceI fromSeq, SequenceI toSeq, MapList mapping, String select, String... omitting) { SequenceI copyTo = toSeq; @@ -2202,7 +2257,7 @@ public class AlignmentUtils proteinStart++; proteinLength--; } - List proteinRange = new ArrayList(); + List proteinRange = new ArrayList<>(); /* * dna length should map to protein (or protein plus stop codon) @@ -2235,9 +2290,9 @@ public class AlignmentUtils * @param dnaSeq * @return */ - public static List findCdsPositions(SequenceI dnaSeq) + protected static List findCdsPositions(SequenceI dnaSeq) { - List result = new ArrayList(); + List result = new ArrayList<>(); List sfs = dnaSeq.getFeatures().getFeaturesByOntology( SequenceOntologyI.CDS); @@ -2370,15 +2425,19 @@ public class AlignmentUtils { if (var.variant != null) { - String alleles = (String) var.variant.getValue("alleles"); + String alleles = (String) var.variant.getValue(Gff3Helper.ALLELES); if (alleles != null) { for (String base : alleles.split(",")) { - String codon = base + base2 + base3; - if (addPeptideVariant(peptide, peptidePos, residue, var, codon)) + if (!base1.equals(base)) { - count++; + String codon = base + base2 + base3; + if (addPeptideVariant(peptide, peptidePos, residue, var, + codon)) + { + count++; + } } } } @@ -2392,15 +2451,19 @@ public class AlignmentUtils { if (var.variant != null) { - String alleles = (String) var.variant.getValue("alleles"); + String alleles = (String) var.variant.getValue(Gff3Helper.ALLELES); if (alleles != null) { for (String base : alleles.split(",")) { - String codon = base1 + base + base3; - if (addPeptideVariant(peptide, peptidePos, residue, var, codon)) + if (!base2.equals(base)) { - count++; + String codon = base1 + base + base3; + if (addPeptideVariant(peptide, peptidePos, residue, var, + codon)) + { + count++; + } } } } @@ -2414,15 +2477,19 @@ public class AlignmentUtils { if (var.variant != null) { - String alleles = (String) var.variant.getValue("alleles"); + String alleles = (String) var.variant.getValue(Gff3Helper.ALLELES); if (alleles != null) { for (String base : alleles.split(",")) { - String codon = base1 + base2 + base; - if (addPeptideVariant(peptide, peptidePos, residue, var, codon)) + if (!base3.equals(base)) { - count++; + String codon = base1 + base2 + base; + if (addPeptideVariant(peptide, peptidePos, residue, var, + codon)) + { + count++; + } } } } @@ -2454,62 +2521,79 @@ public class AlignmentUtils * e.g. multibase variants or HGMD_MUTATION etc * are currently ignored here */ - String trans = codon.contains("-") ? "-" + String trans = codon.contains("-") ? null : (codon.length() > CODON_LENGTH ? null : ResidueProperties.codonTranslate(codon)); - if (trans != null && !trans.equals(residue)) + if (trans == null) + { + return false; + } + String desc = codon; + String featureType = ""; + if (trans.equals(residue)) + { + featureType = SequenceOntologyI.SYNONYMOUS_VARIANT; + } + else if (ResidueProperties.STOP.equals(trans)) + { + featureType = SequenceOntologyI.STOP_GAINED; + } + else { String residue3Char = StringUtils .toSentenceCase(ResidueProperties.aa2Triplet.get(residue)); String trans3Char = StringUtils .toSentenceCase(ResidueProperties.aa2Triplet.get(trans)); - String desc = "p." + residue3Char + peptidePos + trans3Char; - SequenceFeature sf = new SequenceFeature( - SequenceOntologyI.SEQUENCE_VARIANT, desc, peptidePos, - peptidePos, var.getSource()); - StringBuilder attributes = new StringBuilder(32); - String id = (String) var.variant.getValue(ID); - if (id != null) - { - if (id.startsWith(SEQUENCE_VARIANT)) - { - id = id.substring(SEQUENCE_VARIANT.length()); - } - sf.setValue(ID, id); - attributes.append(ID).append("=").append(id); - // TODO handle other species variants JAL-2064 - StringBuilder link = new StringBuilder(32); - try - { - link.append(desc).append(" ").append(id).append( - "|http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=") - .append(URLEncoder.encode(id, "UTF-8")); - sf.addLink(link.toString()); - } catch (UnsupportedEncodingException e) - { - // as if - } - } - String clinSig = (String) var.variant.getValue(CLINICAL_SIGNIFICANCE); - if (clinSig != null) + desc = "p." + residue3Char + peptidePos + trans3Char; + featureType = SequenceOntologyI.NONSYNONYMOUS_VARIANT; + } + SequenceFeature sf = new SequenceFeature(featureType, desc, peptidePos, + peptidePos, var.getSource()); + + StringBuilder attributes = new StringBuilder(32); + String id = (String) var.variant.getValue(ID); + if (id != null) + { + if (id.startsWith(SEQUENCE_VARIANT)) { - sf.setValue(CLINICAL_SIGNIFICANCE, clinSig); - attributes.append(";").append(CLINICAL_SIGNIFICANCE).append("=") - .append(clinSig); + id = id.substring(SEQUENCE_VARIANT.length()); } - peptide.addSequenceFeature(sf); - if (attributes.length() > 0) + sf.setValue(ID, id); + attributes.append(ID).append("=").append(id); + // TODO handle other species variants JAL-2064 + StringBuilder link = new StringBuilder(32); + try + { + link.append(desc).append(" ").append(id).append( + "|http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=") + .append(URLEncoder.encode(id, "UTF-8")); + sf.addLink(link.toString()); + } catch (UnsupportedEncodingException e) { - sf.setAttributes(attributes.toString()); + // as if } - return true; } - return false; + String clinSig = (String) var.variant.getValue(CLINICAL_SIGNIFICANCE); + if (clinSig != null) + { + sf.setValue(CLINICAL_SIGNIFICANCE, clinSig); + attributes.append(";").append(CLINICAL_SIGNIFICANCE).append("=") + .append(clinSig); + } + peptide.addSequenceFeature(sf); + if (attributes.length() > 0) + { + sf.setAttributes(attributes.toString()); + } + return true; } /** * Builds a map whose key is position in the protein sequence, and value is a - * list of the base and all variants for each corresponding codon position + * list of the base and all variants for each corresponding codon position. + *

+ * This depends on dna variants being held as a comma-separated list as + * property "alleles" on variant features. * * @param dnaSeq * @param dnaToProtein @@ -2523,7 +2607,7 @@ public class AlignmentUtils * map from peptide position to all variants of the codon which codes for it * LinkedHashMap ensures we keep the peptide features in sequence order */ - LinkedHashMap[]> variants = new LinkedHashMap[]>(); + LinkedHashMap[]> variants = new LinkedHashMap<>(); List dnaFeatures = dnaSeq.getFeatures() .getFeaturesByOntology(SequenceOntologyI.SEQUENCE_VARIANT); @@ -2547,6 +2631,30 @@ public class AlignmentUtils // not handling multi-locus variant features continue; } + + /* + * ignore variant if not a SNP + */ + String alls = (String) sf.getValue(Gff3Helper.ALLELES); + if (alls == null) + { + continue; // non-SNP VCF variant perhaps - can't process this + } + + String[] alleles = alls.toUpperCase().split(","); + boolean isSnp = true; + for (String allele : alleles) + { + if (allele.trim().length() > 1) + { + isSnp = false; + } + } + if (!isSnp) + { + continue; + } + int[] mapsTo = dnaToProtein.locateInTo(dnaCol, dnaCol); if (mapsTo == null) { @@ -2558,28 +2666,13 @@ public class AlignmentUtils if (codonVariants == null) { codonVariants = new ArrayList[CODON_LENGTH]; - codonVariants[0] = new ArrayList(); - codonVariants[1] = new ArrayList(); - codonVariants[2] = new ArrayList(); + codonVariants[0] = new ArrayList<>(); + codonVariants[1] = new ArrayList<>(); + codonVariants[2] = new ArrayList<>(); variants.put(peptidePosition, codonVariants); } /* - * extract dna variants to a string array - */ - String alls = (String) sf.getValue("alleles"); - if (alls == null) - { - continue; - } - String[] alleles = alls.toUpperCase().split(","); - int i = 0; - for (String allele : alleles) - { - alleles[i++] = allele.trim(); // lose any space characters "A, G" - } - - /* * get this peptide's codon positions e.g. [3, 4, 5] or [4, 7, 10] */ int[] codon = peptidePosition == lastPeptidePostion ? lastCodon @@ -2699,7 +2792,7 @@ public class AlignmentUtils /* * fancy case - aligning via mappings between sequences */ - List unmapped = new ArrayList(); + List unmapped = new ArrayList<>(); Map> columnMap = buildMappedColumnsMap( unaligned, aligned, unmapped); int width = columnMap.size(); @@ -2774,7 +2867,7 @@ public class AlignmentUtils } // map from dataset sequence to alignment sequence(s) - Map> alignedDatasets = new HashMap>(); + Map> alignedDatasets = new HashMap<>(); for (SequenceI seq : aligned.getSequences()) { SequenceI ds = seq.getDatasetSequence(); @@ -2837,7 +2930,7 @@ public class AlignmentUtils * {unalignedSequence, characterPerSequence} at that position. * TreeMap keeps the entries in ascending column order. */ - SortedMap> map = new TreeMap>(); + SortedMap> map = new TreeMap<>(); /* * record any sequences that have no mapping so can't be realigned @@ -2942,7 +3035,7 @@ public class AlignmentUtils Map seqsMap = map.get(fromCol); if (seqsMap == null) { - seqsMap = new HashMap(); + seqsMap = new HashMap<>(); map.put(fromCol, seqsMap); } seqsMap.put(seq, seq.getCharAt(mappedCharPos - toStart)); diff --git a/src/jalview/analysis/Dna.java b/src/jalview/analysis/Dna.java index a10b037..ef05a58 100644 --- a/src/jalview/analysis/Dna.java +++ b/src/jalview/analysis/Dna.java @@ -161,7 +161,7 @@ public class Dna int s; int sSize = selection.size(); - List pepseqs = new ArrayList(); + List pepseqs = new ArrayList<>(); for (s = 0; s < sSize; s++) { SequenceI newseq = translateCodingRegion(selection.get(s), @@ -213,7 +213,7 @@ public class Dna if (dnarefs != null) { // intersect with pep - List mappedrefs = new ArrayList(); + List mappedrefs = new ArrayList<>(); DBRefEntry[] refs = dna.getDBRefs(); for (int d = 0; d < refs.length; d++) { @@ -391,7 +391,7 @@ public class Dna String seqstring, AlignedCodonFrame acf, List proteinSeqs) { - List skip = new ArrayList(); + List skip = new ArrayList<>(); int skipint[] = null; ShiftList vismapping = new ShiftList(); // map from viscontigs to seqstring // intervals @@ -544,7 +544,7 @@ public class Dna skip.add(skipint); skipint = null; } - if (aa.equals("STOP")) + if (aa.equals(ResidueProperties.STOP)) { aa = STOP_ASTERIX; } @@ -800,7 +800,7 @@ public class Dna public AlignmentI reverseCdna(boolean complement) { int sSize = selection.size(); - List reversed = new ArrayList(); + List reversed = new ArrayList<>(); for (int s = 0; s < sSize; s++) { SequenceI newseq = reverseSequence(selection.get(s).getName(), @@ -851,6 +851,23 @@ public class Dna } /** + * Answers the reverse complement of the input string + * + * @see #getComplement(char) + * @param s + * @return + */ + public static String reverseComplement(String s) + { + StringBuilder sb = new StringBuilder(s.length()); + for (int i = s.length() - 1; i >= 0; i--) + { + sb.append(Dna.getComplement(s.charAt(i))); + } + return sb.toString(); + } + + /** * Returns dna complement (preserving case) for aAcCgGtTuU. Ambiguity codes * are treated as on http://reverse-complement.com/. Anything else is left * unchanged. diff --git a/src/jalview/api/FeatureColourI.java b/src/jalview/api/FeatureColourI.java index 0ded079..4dbb1bb 100644 --- a/src/jalview/api/FeatureColourI.java +++ b/src/jalview/api/FeatureColourI.java @@ -56,6 +56,14 @@ public interface FeatureColourI Color getMaxColour(); /** + * Returns the 'no value' colour (used when a feature lacks score, or the + * attribute, being used for colouring) + * + * @return + */ + Color getNoColour(); + + /** * Answers true if the feature has a single colour, i.e. if isColourByLabel() * and isGraduatedColour() both answer false * @@ -64,7 +72,8 @@ public interface FeatureColourI boolean isSimpleColour(); /** - * Answers true if the feature is coloured by label (description) + * Answers true if the feature is coloured by label (description) or by text + * value of an attribute * * @return */ @@ -93,18 +102,6 @@ public interface FeatureColourI void setAboveThreshold(boolean b); /** - * Answers true if the threshold is the minimum value (when - * isAboveThreshold()) or maximum value (when isBelowThreshold()) of the - * colour range; only applicable when isGraduatedColour and either - * isAboveThreshold() or isBelowThreshold() answers true - * - * @return - */ - boolean isThresholdMinMax(); - - void setThresholdMinMax(boolean b); - - /** * Returns the threshold value (if any), else zero * * @return @@ -156,7 +153,10 @@ public interface FeatureColourI Color getColor(SequenceFeature feature); /** - * Update the min-max range for a graduated colour scheme + * Update the min-max range for a graduated colour scheme. Note that the + * colour scheme may be configured to colour by feature score, or a + * (numeric-valued) attribute - the caller should ensure that the correct + * range is being set. * * @param min * @param max @@ -169,4 +169,27 @@ public interface FeatureColourI * @return */ String toJalviewFormat(String featureType); + + /** + * Answers true if colour is by attribute text or numerical value + * + * @return + */ + boolean isColourByAttribute(); + + /** + * Answers the name of the attribute (and optional sub-attribute...) used for + * colouring if any, or null + * + * @return + */ + String[] getAttributeName(); + + /** + * Sets the name of the attribute (and optional sub-attribute...) used for + * colouring if any, or null to remove this property + * + * @return + */ + void setAttributeName(String... name); } diff --git a/src/jalview/api/FeatureRenderer.java b/src/jalview/api/FeatureRenderer.java index 9d2d7f4..cf3c8da 100644 --- a/src/jalview/api/FeatureRenderer.java +++ b/src/jalview/api/FeatureRenderer.java @@ -22,6 +22,7 @@ package jalview.api; import jalview.datamodel.SequenceFeature; import jalview.datamodel.SequenceI; +import jalview.datamodel.features.FeatureMatcherSetI; import java.awt.Color; import java.awt.Graphics; @@ -132,7 +133,7 @@ public interface FeatureRenderer List getGroups(boolean visible); /** - * change visibility for a range of groups + * Set visibility for a list of groups * * @param toset * @param visible @@ -140,7 +141,7 @@ public interface FeatureRenderer void setGroupVisibility(List toset, boolean visible); /** - * change visibiilty of given group + * Set visibility of the given feature group * * @param group * @param visible @@ -148,9 +149,9 @@ public interface FeatureRenderer void setGroupVisibility(String group, boolean visible); /** - * Returns features at the specified aligned column on the given sequence. - * Non-positional features are not included. If the column has a gap, then - * enclosing features are included (but not contact features). + * Returns visible features at the specified aligned column on the given + * sequence. Non-positional features are not included. If the column has a gap, + * then enclosing features are included (but not contact features). * * @param sequence * @param column @@ -215,4 +216,53 @@ public interface FeatureRenderer */ float getTransparency(); + /** + * Answers the filters applied to the given feature type, or null if none is + * set + * + * @param featureType + * @return + */ + FeatureMatcherSetI getFeatureFilter(String featureType); + + /** + * Answers the feature filters map + * + * @return + */ + public Map getFeatureFilters(); + + /** + * Sets the filters for the feature type, or removes them if a null or empty + * filter is passed + * + * @param featureType + * @param filter + */ + void setFeatureFilter(String featureType, FeatureMatcherSetI filter); + + /** + * Replaces all feature filters with the given map + * + * @param filters + */ + void setFeatureFilters(Map filters); + + /** + * Returns the colour for a particular feature instance. This includes + * calculation of 'colour by label', or of a graduated score colour, if + * applicable. + *

+ * Returns null if + *

feature type is not visible, or
feature group is not visible, or
feature values lie outside any colour threshold, or
feature is excluded by filter conditions

+ * + * @param feature + * @return + */ + Color getColour(SequenceFeature feature); } diff --git a/src/jalview/appletgui/APopupMenu.java b/src/jalview/appletgui/APopupMenu.java index 46bd4fd..76f2705 100644 --- a/src/jalview/appletgui/APopupMenu.java +++ b/src/jalview/appletgui/APopupMenu.java @@ -901,10 +901,7 @@ public class APopupMenu extends java.awt.PopupMenu .formatMessage("label.annotation_for_displayid", new Object[] { seq.getDisplayId(true) })); new SequenceAnnotationReport(null).createSequenceAnnotationReport( - contents, seq, true, true, - (ap.seqPanel.seqCanvas.fr != null) - ? ap.seqPanel.seqCanvas.fr.getMinMax() - : null); + contents, seq, true, true, ap.seqPanel.seqCanvas.fr); contents.append("

"); } Frame frame = new Frame(); diff --git a/src/jalview/appletgui/AlignFrame.java b/src/jalview/appletgui/AlignFrame.java index ef87671..fe6b8d9 100644 --- a/src/jalview/appletgui/AlignFrame.java +++ b/src/jalview/appletgui/AlignFrame.java @@ -1445,9 +1445,10 @@ public class AlignFrame extends EmbmenuFrame implements ActionListener, FeaturesFile formatter = new FeaturesFile(); if (format.equalsIgnoreCase("Jalview")) { - features = formatter.printJalviewFormat(viewport.getAlignment() - .getSequencesArray(), getDisplayedFeatureCols(), - getDisplayedFeatureGroups(), true); + features = formatter.printJalviewFormat( + viewport.getAlignment().getSequencesArray(), + getDisplayedFeatureCols(), null, getDisplayedFeatureGroups(), + true); } else { diff --git a/src/jalview/appletgui/FeatureColourChooser.java b/src/jalview/appletgui/FeatureColourChooser.java index 5a073c6..d9eae11 100644 --- a/src/jalview/appletgui/FeatureColourChooser.java +++ b/src/jalview/appletgui/FeatureColourChooser.java @@ -58,6 +58,8 @@ public class FeatureColourChooser extends Panel implements ActionListener, */ private static final int SCALE_FACTOR_1K = 1000; + private static final String COLON = ":"; + private JVDialog frame; private Frame owner; @@ -167,9 +169,9 @@ public class FeatureColourChooser extends Panel implements ActionListener, slider.addAdjustmentListener(this); slider.addMouseListener(this); owner = (af != null) ? af : fs.frame; - frame = new JVDialog(owner, MessageManager - .formatMessage("label.graduated_color_for_params", new String[] - { type }), true, 480, 248); + frame = new JVDialog(owner, MessageManager.formatMessage( + "label.variable_color_for", new String[] { type }), true, 480, + 248); frame.setMainPanel(this); validate(); frame.setVisible(true); @@ -198,8 +200,10 @@ public class FeatureColourChooser extends Panel implements ActionListener, private void jbInit() throws Exception { - Label minLabel = new Label(MessageManager.getString("label.min")), - maxLabel = new Label(MessageManager.getString("label.max")); + Label minLabel = new Label( + MessageManager.getString("label.min_value") + COLON); + Label maxLabel = new Label( + MessageManager.getString("label.max_value") + COLON); minLabel.setFont(new java.awt.Font("Verdana", Font.PLAIN, 11)); maxLabel.setFont(new java.awt.Font("Verdana", Font.PLAIN, 11)); // minColour.setFont(new java.awt.Font("Verdana", Font.PLAIN, 11)); diff --git a/src/jalview/appletgui/FeatureSettings.java b/src/jalview/appletgui/FeatureSettings.java index 9a67499..ad04171 100755 --- a/src/jalview/appletgui/FeatureSettings.java +++ b/src/jalview/appletgui/FeatureSettings.java @@ -25,6 +25,7 @@ import jalview.api.FeatureSettingsControllerI; import jalview.datamodel.AlignmentI; import jalview.datamodel.SequenceI; import jalview.util.MessageManager; +import jalview.viewmodel.seqfeatures.FeatureRendererModel.FeatureSettingsBean; import java.awt.BorderLayout; import java.awt.Button; @@ -583,22 +584,19 @@ public class FeatureSettings extends Panel { Component[] comps = featurePanel.getComponents(); int cSize = comps.length; - - Object[][] tmp = new Object[cSize][3]; - int tmpSize = 0; - for (int i = 0; i < cSize; i++) - { - MyCheckbox check = (MyCheckbox) comps[i]; - tmp[tmpSize][0] = check.type; - tmp[tmpSize][1] = fr.getFeatureStyle(check.type); - tmp[tmpSize][2] = new Boolean(check.getState()); - tmpSize++; + FeatureSettingsBean[] rowData = new FeatureSettingsBean[cSize]; + int i = 0; + for (Component comp : comps) + { + MyCheckbox check = (MyCheckbox) comp; + // feature filter set to null as not (yet) offered in applet + FeatureColourI colour = fr.getFeatureStyle(check.type); + rowData[i] = new FeatureSettingsBean(check.type, colour, null, + check.getState()); + i++; } - Object[][] data = new Object[tmpSize][3]; - System.arraycopy(tmp, 0, data, 0, tmpSize); - - fr.setFeaturePriority(data); + fr.setFeaturePriority(rowData); ap.paintAlignment(updateOverview, updateOverview); } diff --git a/src/jalview/binding/Colour.java b/src/jalview/binding/Colour.java index 25cf9bf..f51e9af 100644 --- a/src/jalview/binding/Colour.java +++ b/src/jalview/binding/Colour.java @@ -27,7 +27,8 @@ public class Colour implements java.io.Serializable // --------------------------/ /** - * Field _name. + * Single letter residue code for an alignment colour scheme, or feature type + * for a feature colour scheme */ private java.lang.String _name; @@ -42,9 +43,15 @@ public class Colour implements java.io.Serializable private java.lang.String _minRGB; /** - * loosely specified enumeration: NONE,ABOVE, or BELOW + * Field _noValueColour. */ - private java.lang.String _threshType; + private jalview.binding.types.NoValueColour _noValueColour = jalview.binding.types.NoValueColour + .valueOf("Min"); + + /** + * Field _threshType. + */ + private jalview.binding.types.ColourThreshTypeType _threshType; /** * Field _threshold. @@ -96,6 +103,11 @@ public class Colour implements java.io.Serializable */ private boolean _has_autoScale; + /** + * name of feature attribute to colour by, or attribute and sub-attribute + */ + private java.util.Vector _attributeNameList; + // ----------------/ // - Constructors -/ // ----------------/ @@ -103,6 +115,8 @@ public class Colour implements java.io.Serializable public Colour() { super(); + setNoValueColour(jalview.binding.types.NoValueColour.valueOf("Min")); + this._attributeNameList = new java.util.Vector(); } // -----------/ @@ -110,41 +124,140 @@ public class Colour implements java.io.Serializable // -----------/ /** - */ + * + * + * @param vAttributeName + * @throws java.lang.IndexOutOfBoundsException + * if the index given is outside the bounds of the collection + */ + public void addAttributeName(final java.lang.String vAttributeName) + throws java.lang.IndexOutOfBoundsException + { + // check for the maximum size + if (this._attributeNameList.size() >= 2) + { + throw new IndexOutOfBoundsException( + "addAttributeName has a maximum of 2"); + } + + this._attributeNameList.addElement(vAttributeName); + } + + /** + * + * + * @param index + * @param vAttributeName + * @throws java.lang.IndexOutOfBoundsException + * if the index given is outside the bounds of the collection + */ + public void addAttributeName(final int index, + final java.lang.String vAttributeName) + throws java.lang.IndexOutOfBoundsException + { + // check for the maximum size + if (this._attributeNameList.size() >= 2) + { + throw new IndexOutOfBoundsException( + "addAttributeName has a maximum of 2"); + } + + this._attributeNameList.add(index, vAttributeName); + } + + /** + */ public void deleteAutoScale() { this._has_autoScale = false; } /** - */ + */ public void deleteColourByLabel() { this._has_colourByLabel = false; } /** - */ + */ public void deleteMax() { this._has_max = false; } /** - */ + */ public void deleteMin() { this._has_min = false; } /** - */ + */ public void deleteThreshold() { this._has_threshold = false; } /** + * Method enumerateAttributeName. + * + * @return an Enumeration over all java.lang.String elements + */ + public java.util.Enumeration enumerateAttributeName() + { + return this._attributeNameList.elements(); + } + + /** + * Method getAttributeName. + * + * @param index + * @throws java.lang.IndexOutOfBoundsException + * if the index given is outside the bounds of the collection + * @return the value of the java.lang.String at the given index + */ + public java.lang.String getAttributeName(final int index) + throws java.lang.IndexOutOfBoundsException + { + // check bounds for index + if (index < 0 || index >= this._attributeNameList.size()) + { + throw new IndexOutOfBoundsException("getAttributeName: Index value '" + + index + "' not in range [0.." + + (this._attributeNameList.size() - 1) + "]"); + } + + return (java.lang.String) _attributeNameList.get(index); + } + + /** + * Method getAttributeName.Returns the contents of the collection in an Array. + *

+ * Note: Just in case the collection contents are changing in another thread, + * we pass a 0-length Array of the correct type into the API call. This way we + * know that the Array returned is of exactly the correct length. + * + * @return this collection as an Array + */ + public Filter[] getFilter() + { + Filter[] array = new Filter[0]; + return (Filter[]) this._filterList.toArray(array); + } + + /** + * Method getFilterCount. + * + * @return the size of this collection + */ + public int getFilterCount() + { + return this._filterList.size(); + } + + /** * Returns the value of field 'schemeName'. * * @return the value of field 'SchemeName'. @@ -217,13 +307,20 @@ public class JalviewUserColours implements java.io.Serializable } /** - */ + */ public void removeAllColour() { this._colourList.clear(); } /** + */ + public void removeAllFilter() + { + this._filterList.clear(); + } + + /** * Method removeColour. * * @param vColour @@ -248,6 +345,30 @@ public class JalviewUserColours implements java.io.Serializable } /** + * Method removeFilter. + * + * @param vFilter + * @return true if the object was removed from the collection. + */ + public boolean removeFilter(final Filter vFilter) + { + boolean removed = _filterList.remove(vFilter); + return removed; + } + + /** + * Method removeFilterAt. + * + * @param index + * @return the element removed from the collection + */ + public Filter removeFilterAt(final int index) + { + java.lang.Object obj = this._filterList.remove(index); + return (Filter) obj; + } + + /** * * * @param index @@ -286,6 +407,44 @@ public class JalviewUserColours implements java.io.Serializable } /** + * + * + * @param index + * @param vFilter + * @throws java.lang.IndexOutOfBoundsException + * if the index given is outside the bounds of the collection + */ + public void setFilter(final int index, final Filter vFilter) + throws java.lang.IndexOutOfBoundsException + { + // check bounds for index + if (index < 0 || index >= this._filterList.size()) + { + throw new IndexOutOfBoundsException( + "setFilter: Index value '" + index + "' not in range [0.." + + (this._filterList.size() - 1) + "]"); + } + + this._filterList.set(index, vFilter); + } + + /** + * + * + * @param vFilterArray + */ + public void setFilter(final Filter[] vFilterArray) + { + // -- copy array + _filterList.clear(); + + for (int i = 0; i < vFilterArray.length; i++) + { + this._filterList.add(vFilterArray[i]); + } + } + + /** * Sets the value of field 'schemeName'. * * @param schemeName diff --git a/src/jalview/binding/MatchCondition.java b/src/jalview/binding/MatchCondition.java new file mode 100644 index 0000000..44a3d3e --- /dev/null +++ b/src/jalview/binding/MatchCondition.java @@ -0,0 +1,125 @@ +/* + * This class was automatically generated with + * Castor 1.1, using an XML + * Schema. + * $Id$ + */ + +package jalview.binding; + +//---------------------------------/ +//- Imported classes and packages -/ +//---------------------------------/ + +import org.exolab.castor.xml.Marshaller; +import org.exolab.castor.xml.Unmarshaller; + +/** + * Class MatchCondition. + * + * @version $Revision$ $Date$ + */ +public class MatchCondition extends FeatureMatcher + implements java.io.Serializable +{ + + // ----------------/ + // - Constructors -/ + // ----------------/ + + public MatchCondition() + { + super(); + } + + // -----------/ + // - Methods -/ + // -----------/ + + /** + * Method isValid. + * + * @return true if this object is valid according to the schema + */ + public boolean isValid() + { + try + { + validate(); + } catch (org.exolab.castor.xml.ValidationException vex) + { + return false; + } + return true; + } + + /** + * + * + * @param out + * @throws org.exolab.castor.xml.MarshalException + * if object is null or if any SAXException is thrown during + * marshaling + * @throws org.exolab.castor.xml.ValidationException + * if this object is an invalid instance according to the schema + */ + public void marshal(final java.io.Writer out) + throws org.exolab.castor.xml.MarshalException, + org.exolab.castor.xml.ValidationException + { + Marshaller.marshal(this, out); + } + + /** + * + * + * @param handler + * @throws java.io.IOException + * if an IOException occurs during marshaling + * @throws org.exolab.castor.xml.ValidationException + * if this object is an invalid instance according to the schema + * @throws org.exolab.castor.xml.MarshalException + * if object is null or if any SAXException is thrown during + * marshaling + */ + public void marshal(final org.xml.sax.ContentHandler handler) + throws java.io.IOException, + org.exolab.castor.xml.MarshalException, + org.exolab.castor.xml.ValidationException + { + Marshaller.marshal(this, handler); + } + + /** + * Method unmarshal. + * + * @param reader + * @throws org.exolab.castor.xml.MarshalException + * if object is null or if any SAXException is thrown during + * marshaling + * @throws org.exolab.castor.xml.ValidationException + * if this object is an invalid instance according to the schema + * @return the unmarshaled jalview.binding.FeatureMatcher + */ + public static jalview.binding.FeatureMatcher unmarshal( + final java.io.Reader reader) + throws org.exolab.castor.xml.MarshalException, + org.exolab.castor.xml.ValidationException + { + return (jalview.binding.FeatureMatcher) Unmarshaller + .unmarshal(jalview.binding.MatchCondition.class, reader); + } + + /** + * + * + * @throws org.exolab.castor.xml.ValidationException + * if this object is an invalid instance according to the schema + */ + public void validate() throws org.exolab.castor.xml.ValidationException + { + org.exolab.castor.xml.Validator validator = new org.exolab.castor.xml.Validator(); + validator.validate(this); + } + +} diff --git a/src/jalview/binding/MatcherSet.java b/src/jalview/binding/MatcherSet.java new file mode 100644 index 0000000..756d93a --- /dev/null +++ b/src/jalview/binding/MatcherSet.java @@ -0,0 +1,125 @@ +/* + * This class was automatically generated with + * Castor 1.1, using an XML + * Schema. + * $Id$ + */ + +package jalview.binding; + +//---------------------------------/ +//- Imported classes and packages -/ +//---------------------------------/ + +import org.exolab.castor.xml.Marshaller; +import org.exolab.castor.xml.Unmarshaller; + +/** + * Class MatcherSet. + * + * @version $Revision$ $Date$ + */ +public class MatcherSet extends FeatureMatcherSet + implements java.io.Serializable +{ + + // ----------------/ + // - Constructors -/ + // ----------------/ + + public MatcherSet() + { + super(); + } + + // -----------/ + // - Methods -/ + // -----------/ + + /** + * Method isValid. + * + * @return true if this object is valid according to the schema + */ + public boolean isValid() + { + try + { + validate(); + } catch (org.exolab.castor.xml.ValidationException vex) + { + return false; + } + return true; + } + + /** + * + * + * @param out + * @throws org.exolab.castor.xml.MarshalException + * if object is null or if any SAXException is thrown during + * marshaling + * @throws org.exolab.castor.xml.ValidationException + * if this object is an invalid instance according to the schema + */ + public void marshal(final java.io.Writer out) + throws org.exolab.castor.xml.MarshalException, + org.exolab.castor.xml.ValidationException + { + Marshaller.marshal(this, out); + } + + /** + * + * + * @param handler + * @throws java.io.IOException + * if an IOException occurs during marshaling + * @throws org.exolab.castor.xml.ValidationException + * if this object is an invalid instance according to the schema + * @throws org.exolab.castor.xml.MarshalException + * if object is null or if any SAXException is thrown during + * marshaling + */ + public void marshal(final org.xml.sax.ContentHandler handler) + throws java.io.IOException, + org.exolab.castor.xml.MarshalException, + org.exolab.castor.xml.ValidationException + { + Marshaller.marshal(this, handler); + } + + /** + * Method unmarshal. + * + * @param reader + * @throws org.exolab.castor.xml.MarshalException + * if object is null or if any SAXException is thrown during + * marshaling + * @throws org.exolab.castor.xml.ValidationException + * if this object is an invalid instance according to the schema + * @return the unmarshaled jalview.binding.FeatureMatcherSet + */ + public static jalview.binding.FeatureMatcherSet unmarshal( + final java.io.Reader reader) + throws org.exolab.castor.xml.MarshalException, + org.exolab.castor.xml.ValidationException + { + return (jalview.binding.FeatureMatcherSet) Unmarshaller + .unmarshal(jalview.binding.MatcherSet.class, reader); + } + + /** + * + * + * @throws org.exolab.castor.xml.ValidationException + * if this object is an invalid instance according to the schema + */ + public void validate() throws org.exolab.castor.xml.ValidationException + { + org.exolab.castor.xml.Validator validator = new org.exolab.castor.xml.Validator(); + validator.validate(this); + } + +} diff --git a/src/jalview/binding/types/ColourThreshTypeType.java b/src/jalview/binding/types/ColourThreshTypeType.java new file mode 100644 index 0000000..024f2c0 --- /dev/null +++ b/src/jalview/binding/types/ColourThreshTypeType.java @@ -0,0 +1,168 @@ +/* + * This class was automatically generated with + * Castor 1.1, using an XML + * Schema. + * $Id$ + */ + +package jalview.binding.types; + + //---------------------------------/ + //- Imported classes and packages -/ +//---------------------------------/ + +import java.util.Hashtable; + +/** + * Class ColourThreshTypeType. + * + * @version $Revision$ $Date$ + */ +public class ColourThreshTypeType implements java.io.Serializable { + + + //--------------------------/ + //- Class/Member Variables -/ + //--------------------------/ + + /** + * The NONE type + */ + public static final int NONE_TYPE = 0; + + /** + * The instance of the NONE type + */ + public static final ColourThreshTypeType NONE = new ColourThreshTypeType(NONE_TYPE, "NONE"); + + /** + * The ABOVE type + */ + public static final int ABOVE_TYPE = 1; + + /** + * The instance of the ABOVE type + */ + public static final ColourThreshTypeType ABOVE = new ColourThreshTypeType(ABOVE_TYPE, "ABOVE"); + + /** + * The BELOW type + */ + public static final int BELOW_TYPE = 2; + + /** + * The instance of the BELOW type + */ + public static final ColourThreshTypeType BELOW = new ColourThreshTypeType(BELOW_TYPE, "BELOW"); + + /** + * Field _memberTable. + */ + private static java.util.Hashtable _memberTable = init(); + + /** + * Field type. + */ + private int type = -1; + + /** + * Field stringValue. + */ + private java.lang.String stringValue = null; + + + //----------------/ + //- Constructors -/ + //----------------/ + + private ColourThreshTypeType(final int type, final java.lang.String value) { + super(); + this.type = type; + this.stringValue = value; + } + + + //-----------/ + //- Methods -/ + //-----------/ + + /** + * Method enumerate.Returns an enumeration of all possible + * instances of ColourThreshTypeType + * + * @return an Enumeration over all possible instances of + * ColourThreshTypeType + */ + public static java.util.Enumeration enumerate( + ) { + return _memberTable.elements(); + } + + /** + * Method getType.Returns the type of this ColourThreshTypeType + * + * @return the type of this ColourThreshTypeType + */ + public int getType( + ) { + return this.type; + } + + /** + * Method init. + * + * @return the initialized Hashtable for the member table + */ + private static java.util.Hashtable init( + ) { + Hashtable members = new Hashtable(); + members.put("NONE", NONE); + members.put("ABOVE", ABOVE); + members.put("BELOW", BELOW); + return members; + } + + /** + * Method readResolve. will be called during deserialization to + * replace the deserialized object with the correct constant + * instance. + * + * @return this deserialized object + */ + private java.lang.Object readResolve( + ) { + return valueOf(this.stringValue); + } + + /** + * Method toString.Returns the String representation of this + * ColourThreshTypeType + * + * @return the String representation of this ColourThreshTypeTyp + */ + public java.lang.String toString( + ) { + return this.stringValue; + } + + /** + * Method valueOf.Returns a new ColourThreshTypeType based on + * the given String value. + * + * @param string + * @return the ColourThreshTypeType value of parameter 'string' + */ + public static jalview.binding.types.ColourThreshTypeType valueOf( + final java.lang.String string) { + java.lang.Object obj = null; + if (string != null) { + obj = _memberTable.get(string); + } + if (obj == null) { + String err = "" + string + " is not a valid ColourThreshTypeType"; + throw new IllegalArgumentException(err); + } + return (ColourThreshTypeType) obj; + } + +} diff --git a/src/jalview/binding/types/FeatureMatcherByType.java b/src/jalview/binding/types/FeatureMatcherByType.java new file mode 100644 index 0000000..2185bba --- /dev/null +++ b/src/jalview/binding/types/FeatureMatcherByType.java @@ -0,0 +1,168 @@ +/* + * This class was automatically generated with + * Castor 1.1, using an XML + * Schema. + * $Id$ + */ + +package jalview.binding.types; + + //---------------------------------/ + //- Imported classes and packages -/ +//---------------------------------/ + +import java.util.Hashtable; + +/** + * Class FeatureMatcherByType. + * + * @version $Revision$ $Date$ + */ +public class FeatureMatcherByType implements java.io.Serializable { + + + //--------------------------/ + //- Class/Member Variables -/ + //--------------------------/ + + /** + * The byLabel type + */ + public static final int BYLABEL_TYPE = 0; + + /** + * The instance of the byLabel type + */ + public static final FeatureMatcherByType BYLABEL = new FeatureMatcherByType(BYLABEL_TYPE, "byLabel"); + + /** + * The byScore type + */ + public static final int BYSCORE_TYPE = 1; + + /** + * The instance of the byScore type + */ + public static final FeatureMatcherByType BYSCORE = new FeatureMatcherByType(BYSCORE_TYPE, "byScore"); + + /** + * The byAttribute type + */ + public static final int BYATTRIBUTE_TYPE = 2; + + /** + * The instance of the byAttribute type + */ + public static final FeatureMatcherByType BYATTRIBUTE = new FeatureMatcherByType(BYATTRIBUTE_TYPE, "byAttribute"); + + /** + * Field _memberTable. + */ + private static java.util.Hashtable _memberTable = init(); + + /** + * Field type. + */ + private int type = -1; + + /** + * Field stringValue. + */ + private java.lang.String stringValue = null; + + + //----------------/ + //- Constructors -/ + //----------------/ + + private FeatureMatcherByType(final int type, final java.lang.String value) { + super(); + this.type = type; + this.stringValue = value; + } + + + //-----------/ + //- Methods -/ + //-----------/ + + /** + * Method enumerate.Returns an enumeration of all possible + * instances of FeatureMatcherByType + * + * @return an Enumeration over all possible instances of + * FeatureMatcherByType + */ + public static java.util.Enumeration enumerate( + ) { + return _memberTable.elements(); + } + + /** + * Method getType.Returns the type of this FeatureMatcherByType + * + * @return the type of this FeatureMatcherByType + */ + public int getType( + ) { + return this.type; + } + + /** + * Method init. + * + * @return the initialized Hashtable for the member table + */ + private static java.util.Hashtable init( + ) { + Hashtable members = new Hashtable(); + members.put("byLabel", BYLABEL); + members.put("byScore", BYSCORE); + members.put("byAttribute", BYATTRIBUTE); + return members; + } + + /** + * Method readResolve. will be called during deserialization to + * replace the deserialized object with the correct constant + * instance. + * + * @return this deserialized object + */ + private java.lang.Object readResolve( + ) { + return valueOf(this.stringValue); + } + + /** + * Method toString.Returns the String representation of this + * FeatureMatcherByType + * + * @return the String representation of this FeatureMatcherByTyp + */ + public java.lang.String toString( + ) { + return this.stringValue; + } + + /** + * Method valueOf.Returns a new FeatureMatcherByType based on + * the given String value. + * + * @param string + * @return the FeatureMatcherByType value of parameter 'string' + */ + public static jalview.binding.types.FeatureMatcherByType valueOf( + final java.lang.String string) { + java.lang.Object obj = null; + if (string != null) { + obj = _memberTable.get(string); + } + if (obj == null) { + String err = "" + string + " is not a valid FeatureMatcherByType"; + throw new IllegalArgumentException(err); + } + return (FeatureMatcherByType) obj; + } + +} diff --git a/src/jalview/binding/types/NoValueColour.java b/src/jalview/binding/types/NoValueColour.java new file mode 100644 index 0000000..c1540f6 --- /dev/null +++ b/src/jalview/binding/types/NoValueColour.java @@ -0,0 +1,169 @@ +/* + * This class was automatically generated with + * Castor 1.1, using an XML + * Schema. + * $Id$ + */ + +package jalview.binding.types; + +//---------------------------------/ +//- Imported classes and packages -/ +//---------------------------------/ + +import java.util.Hashtable; + +/** + * Graduated feature colour if no score (or attribute) value + * + * @version $Revision$ $Date$ + */ +public class NoValueColour implements java.io.Serializable +{ + + // --------------------------/ + // - Class/Member Variables -/ + // --------------------------/ + + /** + * The None type + */ + public static final int NONE_TYPE = 0; + + /** + * The instance of the None type + */ + public static final NoValueColour NONE = new NoValueColour(NONE_TYPE, + "None"); + + /** + * The Min type + */ + public static final int MIN_TYPE = 1; + + /** + * The instance of the Min type + */ + public static final NoValueColour MIN = new NoValueColour(MIN_TYPE, + "Min"); + + /** + * The Max type + */ + public static final int MAX_TYPE = 2; + + /** + * The instance of the Max type + */ + public static final NoValueColour MAX = new NoValueColour(MAX_TYPE, + "Max"); + + /** + * Field _memberTable. + */ + private static java.util.Hashtable _memberTable = init(); + + /** + * Field type. + */ + private int type = -1; + + /** + * Field stringValue. + */ + private java.lang.String stringValue = null; + + // ----------------/ + // - Constructors -/ + // ----------------/ + + private NoValueColour(final int type, final java.lang.String value) + { + super(); + this.type = type; + this.stringValue = value; + } + + // -----------/ + // - Methods -/ + // -----------/ + + /** + * Method enumerate.Returns an enumeration of all possible instances of + * NoValueColour + * + * @return an Enumeration over all possible instances of NoValueColour + */ + public static java.util.Enumeration enumerate() + { + return _memberTable.elements(); + } + + /** + * Method getType.Returns the type of this NoValueColour + * + * @return the type of this NoValueColour + */ + public int getType() + { + return this.type; + } + + /** + * Method init. + * + * @return the initialized Hashtable for the member table + */ + private static java.util.Hashtable init() + { + Hashtable members = new Hashtable(); + members.put("None", NONE); + members.put("Min", MIN); + members.put("Max", MAX); + return members; + } + + /** + * Method readResolve. will be called during deserialization to replace the + * deserialized object with the correct constant instance. + * + * @return this deserialized object + */ + private java.lang.Object readResolve() + { + return valueOf(this.stringValue); + } + + /** + * Method toString.Returns the String representation of this NoValueColour + * + * @return the String representation of this NoValueColour + */ + public java.lang.String toString() + { + return this.stringValue; + } + + /** + * Method valueOf.Returns a new NoValueColour based on the given String value. + * + * @param string + * @return the NoValueColour value of parameter 'string' + */ + public static jalview.binding.types.NoValueColour valueOf( + final java.lang.String string) + { + java.lang.Object obj = null; + if (string != null) + { + obj = _memberTable.get(string); + } + if (obj == null) + { + String err = "" + string + " is not a valid NoValueColour"; + throw new IllegalArgumentException(err); + } + return (NoValueColour) obj; + } + +} diff --git a/src/jalview/controller/AlignViewController.java b/src/jalview/controller/AlignViewController.java index 460c2b3..d992e4e 100644 --- a/src/jalview/controller/AlignViewController.java +++ b/src/jalview/controller/AlignViewController.java @@ -53,20 +53,19 @@ public class AlignViewController implements AlignViewControllerI private AlignViewControllerGuiI avcg; public AlignViewController(AlignViewControllerGuiI alignFrame, - AlignViewportI viewport, AlignmentViewPanel alignPanel) + AlignViewportI vp, AlignmentViewPanel ap) { this.avcg = alignFrame; - this.viewport = viewport; - this.alignPanel = alignPanel; + this.viewport = vp; + this.alignPanel = ap; } @Override - public void setViewportAndAlignmentPanel(AlignViewportI viewport, - AlignmentViewPanel alignPanel) + public void setViewportAndAlignmentPanel(AlignViewportI vp, + AlignmentViewPanel ap) { - this.alignPanel = alignPanel; - this.viewport = viewport; - + this.alignPanel = ap; + this.viewport = vp; } @Override @@ -215,17 +214,21 @@ public class AlignViewController implements AlignViewControllerI /** * Sets a bit in the BitSet for each column (base 0) in the sequence - * collection which includes the specified feature type. Returns the number of - * sequences which have the feature in the selected range. + * collection which includes a visible feature of the specified feature type. + * Returns the number of sequences which have the feature visible in the + * selected range. * * @param featureType * @param sqcol * @param bs * @return */ - static int findColumnsWithFeature(String featureType, + int findColumnsWithFeature(String featureType, SequenceCollectionI sqcol, BitSet bs) { + FeatureRenderer fr = alignPanel == null ? null : alignPanel + .getFeatureRenderer(); + final int startColumn = sqcol.getStartRes() + 1; // converted to base 1 final int endColumn = sqcol.getEndRes() + 1; List seqs = sqcol.getSequences(); @@ -238,13 +241,19 @@ public class AlignViewController implements AlignViewControllerI List sfs = sq.findFeatures(startColumn, endColumn, featureType); - if (!sfs.isEmpty()) - { - nseq++; - } - + boolean found = false; for (SequenceFeature sf : sfs) { + if (fr.getColour(sf) == null) + { + continue; + } + if (!found) + { + nseq++; + } + found = true; + int sfStartCol = sq.findIndex(sf.getBegin()); int sfEndCol = sq.findIndex(sf.getEnd()); @@ -343,25 +352,25 @@ public class AlignViewController implements AlignViewControllerI public boolean parseFeaturesFile(String file, DataSourceType protocol, boolean relaxedIdMatching) { - boolean featuresFile = false; + boolean featuresAdded = false; + FeatureRenderer fr = alignPanel.getFeatureRenderer(); try { - featuresFile = new FeaturesFile(false, file, protocol).parse( - viewport.getAlignment().getDataset(), - alignPanel.getFeatureRenderer().getFeatureColours(), false, - relaxedIdMatching); + featuresAdded = new FeaturesFile(false, file, protocol).parse( + viewport.getAlignment().getDataset(), fr.getFeatureColours(), + fr.getFeatureFilters(), false, relaxedIdMatching); } catch (Exception ex) { ex.printStackTrace(); } - if (featuresFile) + if (featuresAdded) { avcg.refreshFeatureUI(true); - if (alignPanel.getFeatureRenderer() != null) + if (fr != null) { // update the min/max ranges where necessary - alignPanel.getFeatureRenderer().findAllFeatures(true); + fr.findAllFeatures(true); } if (avcg.getFeatureSettingsUI() != null) { @@ -370,7 +379,7 @@ public class AlignViewController implements AlignViewControllerI alignPanel.paintAlignment(true, true); } - return featuresFile; + return featuresAdded; } diff --git a/src/jalview/datamodel/DBRefEntry.java b/src/jalview/datamodel/DBRefEntry.java index f7837f7..98868ce 100755 --- a/src/jalview/datamodel/DBRefEntry.java +++ b/src/jalview/datamodel/DBRefEntry.java @@ -27,7 +27,20 @@ import java.util.List; public class DBRefEntry implements DBRefEntryI { - String source = "", version = "", accessionId = ""; + /* + * the mapping to chromosome (genome) is held as an instance with + * source = speciesId + * version = assemblyId + * accessionId = "chromosome:" + chromosomeId + * map = mapping from sequence to reference assembly + */ + public static final String CHROMOSOME = "chromosome"; + + String source = ""; + + String version = ""; + + String accessionId = ""; /** * maps from associated sequence to the database sequence's coordinate system @@ -331,4 +344,14 @@ public class DBRefEntry implements DBRefEntryI } return true; } + + /** + * Mappings to chromosome are held with accessionId as "chromosome:id" + * + * @return + */ + public boolean isChromosome() + { + return accessionId != null && accessionId.startsWith(CHROMOSOME + ":"); + } } diff --git a/src/jalview/datamodel/GeneLociI.java b/src/jalview/datamodel/GeneLociI.java new file mode 100644 index 0000000..f8c7ec5 --- /dev/null +++ b/src/jalview/datamodel/GeneLociI.java @@ -0,0 +1,38 @@ +package jalview.datamodel; + +import jalview.util.MapList; + +/** + * An interface to model one or more contiguous regions on one chromosome + */ +public interface GeneLociI +{ + /** + * Answers the species identifier + * + * @return + */ + String getSpeciesId(); + + /** + * Answers the reference assembly identifier + * + * @return + */ + String getAssemblyId(); + + /** + * Answers the chromosome identifier e.g. "2", "Y", "II" + * + * @return + */ + String getChromosomeId(); + + /** + * Answers the mapping from sequence to chromosome loci. For a reverse strand + * mapping, the chromosomal ranges will have start > end. + * + * @return + */ + MapList getMap(); +} diff --git a/src/jalview/datamodel/Sequence.java b/src/jalview/datamodel/Sequence.java index 15d1378..441d8d0 100755 --- a/src/jalview/datamodel/Sequence.java +++ b/src/jalview/datamodel/Sequence.java @@ -657,10 +657,10 @@ public class Sequence extends ASequence implements SequenceI } /** - * DOCUMENT ME! + * Sets the sequence description, and also parses out any special formats of + * interest * * @param desc - * DOCUMENT ME! */ @Override public void setDescription(String desc) @@ -668,10 +668,67 @@ public class Sequence extends ASequence implements SequenceI this.description = desc; } + @Override + public void setGeneLoci(String speciesId, String assemblyId, + String chromosomeId, MapList map) + { + addDBRef(new DBRefEntry(speciesId, assemblyId, DBRefEntry.CHROMOSOME + + ":" + chromosomeId, new Mapping(map))); + } + /** - * DOCUMENT ME! + * Returns the gene loci mapping for the sequence (may be null) * - * @return DOCUMENT ME! + * @return + */ + @Override + public GeneLociI getGeneLoci() + { + DBRefEntry[] refs = getDBRefs(); + if (refs != null) + { + for (final DBRefEntry ref : refs) + { + if (ref.isChromosome()) + { + return new GeneLociI() + { + @Override + public String getSpeciesId() + { + return ref.getSource(); + } + + @Override + public String getAssemblyId() + { + return ref.getVersion(); + } + + @Override + public String getChromosomeId() + { + // strip off "chromosome:" prefix to chrId + return ref.getAccessionId().substring( + DBRefEntry.CHROMOSOME.length() + 1); + } + + @Override + public MapList getMap() + { + return ref.getMap().getMap(); + } + }; + } + } + } + return null; + } + + /** + * Answers the description + * + * @return */ @Override public String getDescription() diff --git a/src/jalview/datamodel/SequenceFeature.java b/src/jalview/datamodel/SequenceFeature.java index 9c4087e..34565c6 100755 --- a/src/jalview/datamodel/SequenceFeature.java +++ b/src/jalview/datamodel/SequenceFeature.java @@ -20,18 +20,24 @@ */ package jalview.datamodel; +import jalview.datamodel.features.FeatureAttributeType; +import jalview.datamodel.features.FeatureAttributes; import jalview.datamodel.features.FeatureLocationI; +import jalview.datamodel.features.FeatureSourceI; +import jalview.datamodel.features.FeatureSources; +import jalview.util.StringUtils; import java.util.HashMap; import java.util.Map; import java.util.Map.Entry; +import java.util.SortedMap; +import java.util.TreeMap; import java.util.Vector; /** - * DOCUMENT ME! - * - * @author $author$ - * @version $Revision$ + * A class that models a single contiguous feature on a sequence. If flag + * 'contactFeature' is true, the start and end positions are interpreted instead + * as two contact points. */ public class SequenceFeature implements FeatureLocationI { @@ -51,6 +57,8 @@ public class SequenceFeature implements FeatureLocationI // private key for ENA location designed not to conflict with real GFF data private static final String LOCATION = "!Location"; + private static final String ROW_DATA = "%s%s%s"; + /* * ATTRIBUTES is reserved for the GFF 'column 9' data, formatted as * name1=value1;name2=value2,value3;...etc @@ -84,6 +92,12 @@ public class SequenceFeature implements FeatureLocationI public Vector links; + /* + * the identifier (if known) for the FeatureSource held in FeatureSources, + * as a provider of metadata about feature attributes + */ + private String source; + /** * Constructs a duplicate feature. Note: Uses makes a shallow copy of the * otherDetails map, so the new and original SequenceFeature may reference the @@ -155,9 +169,11 @@ public class SequenceFeature implements FeatureLocationI this(newType, sf.getDescription(), newBegin, newEnd, newScore, newGroup); + this.source = sf.source; + if (sf.otherDetails != null) { - otherDetails = new HashMap(); + otherDetails = new HashMap<>(); for (Entry entry : sf.otherDetails.entrySet()) { otherDetails.put(entry.getKey(), entry.getValue()); @@ -165,7 +181,7 @@ public class SequenceFeature implements FeatureLocationI } if (sf.links != null && sf.links.size() > 0) { - links = new Vector(); + links = new Vector<>(); for (int i = 0, iSize = sf.links.size(); i < iSize; i++) { links.addElement(sf.links.elementAt(i)); @@ -332,7 +348,7 @@ public class SequenceFeature implements FeatureLocationI { if (links == null) { - links = new Vector(); + links = new Vector<>(); } if (!links.contains(labelLink)) @@ -366,6 +382,30 @@ public class SequenceFeature implements FeatureLocationI } /** + * Answers the value of the specified attribute as string, or null if no such + * value. If more than one attribute name is provided, tries to resolve as keys + * to nested maps. For example, if attribute "CSQ" holds a map of key-value + * pairs, then getValueAsString("CSQ", "Allele") returns the value of "Allele" + * in that map. + * + * @param key + * @return + */ + public String getValueAsString(String... key) + { + if (otherDetails == null) + { + return null; + } + Object value = otherDetails.get(key[0]); + if (key.length > 1 && value instanceof Map) + { + value = ((Map) value).get(key[1]); + } + return value == null ? null : value.toString(); + } + + /** * Returns a property value for the given key if known, else the specified * default value * @@ -394,13 +434,35 @@ public class SequenceFeature implements FeatureLocationI { if (otherDetails == null) { - otherDetails = new HashMap(); + otherDetails = new HashMap<>(); } otherDetails.put(key, value); + recordAttribute(key, value); } } + /** + * Notifies the addition of a feature attribute. This lets us keep track of + * which attributes are present on each feature type, and also the range of + * numerical-valued attributes. + * + * @param key + * @param value + */ + protected void recordAttribute(String key, Object value) + { + String attDesc = null; + if (source != null) + { + attDesc = FeatureSources.getInstance().getSource(source) + .getAttributeName(key); + } + + FeatureAttributes.getInstance().addAttribute(this.type, attDesc, value, + key); + } + /* * The following methods are added to maintain the castor Uniprot mapping file * for the moment. @@ -535,4 +597,142 @@ public class SequenceFeature implements FeatureLocationI { return begin == 0 && end == 0; } + + /** + * Answers an html-formatted report of feature details + * + * @return + */ + public String getDetailsReport() + { + FeatureSourceI metadata = FeatureSources.getInstance() + .getSource(source); + + StringBuilder sb = new StringBuilder(128); + sb.append("
"); + sb.append(""); + sb.append(String.format(ROW_DATA, "Type", type, "")); + sb.append(String.format(ROW_DATA, "Start/end", begin == end ? begin + : begin + (isContactFeature() ? ":" : "-") + end, "")); + String desc = StringUtils.stripHtmlTags(description); + sb.append(String.format(ROW_DATA, "Description", desc, "")); + if (!Float.isNaN(score) && score != 0f) + { + sb.append(String.format(ROW_DATA, "Score", score, "")); + } + if (featureGroup != null) + { + sb.append(String.format(ROW_DATA, "Group", featureGroup, "")); + } + + if (otherDetails != null) + { + TreeMap ordered = new TreeMap<>( + String.CASE_INSENSITIVE_ORDER); + ordered.putAll(otherDetails); + + for (Entry entry : ordered.entrySet()) + { + String key = entry.getKey(); + if (ATTRIBUTES.equals(key)) + { + continue; // to avoid double reporting + } + + Object value = entry.getValue(); + if (value instanceof Map) + { + /* + * expand values in a Map attribute across separate lines + * copy to a TreeMap for alphabetical ordering + */ + Map values = (Map) value; + SortedMap sm = new TreeMap<>( + String.CASE_INSENSITIVE_ORDER); + sm.putAll(values); + for (Entry e : sm.entrySet()) + { + sb.append(String.format(ROW_DATA, key, e.getKey().toString(), e + .getValue().toString())); + } + } + else + { + // tried
but it failed to provide a tooltip :-( + String attDesc = null; + if (metadata != null) + { + attDesc = metadata.getAttributeName(key); + } + String s = entry.getValue().toString(); + if (isValueInteresting(key, s, metadata)) + { + sb.append(String.format(ROW_DATA, key, attDesc == null ? "" + : attDesc, s)); + } + } + } + } + sb.append("
"); + + String text = sb.toString(); + return text; + } + + /** + * Answers true if we judge the value is worth displaying, by some heuristic + * rules, else false + * + * @param key + * @param value + * @param metadata + * @return + */ + boolean isValueInteresting(String key, String value, + FeatureSourceI metadata) + { + /* + * currently suppressing zero values as well as null or empty + */ + if (value == null || "".equals(value) || ".".equals(value) + || "0".equals(value)) + { + return false; + } + + if (metadata == null) + { + return true; + } + + FeatureAttributeType attType = metadata.getAttributeType(key); + if (attType != null + && (attType == FeatureAttributeType.Float || attType + .equals(FeatureAttributeType.Integer))) + { + try + { + float fval = Float.valueOf(value); + if (fval == 0f) + { + return false; + } + } catch (NumberFormatException e) + { + // ignore + } + } + + return true; // default to interesting + } + + /** + * Sets the feature source identifier + * + * @param theSource + */ + public void setSource(String theSource) + { + source = theSource; + } } diff --git a/src/jalview/datamodel/SequenceI.java b/src/jalview/datamodel/SequenceI.java index 2f3e925..fb723e6 100755 --- a/src/jalview/datamodel/SequenceI.java +++ b/src/jalview/datamodel/SequenceI.java @@ -21,6 +21,7 @@ package jalview.datamodel; import jalview.datamodel.features.SequenceFeaturesI; +import jalview.util.MapList; import java.util.BitSet; import java.util.List; @@ -524,4 +525,22 @@ public interface SequenceI extends ASequenceI * @param c2 */ public int replace(char c1, char c2); + + /** + * Answers the GeneLociI, or null if not known + * + * @return + */ + GeneLociI getGeneLoci(); + + /** + * Sets the mapping to gene loci for the sequence + * + * @param speciesId + * @param assemblyId + * @param chromosomeId + * @param map + */ + void setGeneLoci(String speciesId, String assemblyId, + String chromosomeId, MapList map); } diff --git a/src/jalview/datamodel/features/FeatureAttributeType.java b/src/jalview/datamodel/features/FeatureAttributeType.java new file mode 100644 index 0000000..fd3069d --- /dev/null +++ b/src/jalview/datamodel/features/FeatureAttributeType.java @@ -0,0 +1,12 @@ +package jalview.datamodel.features; + +/** + * A class to model the datatype of feature attributes. + * + * @author gmcarstairs + * + */ +public enum FeatureAttributeType +{ + String, Integer, Float, Character, Flag; +} diff --git a/src/jalview/datamodel/features/FeatureAttributes.java b/src/jalview/datamodel/features/FeatureAttributes.java new file mode 100644 index 0000000..e359b62 --- /dev/null +++ b/src/jalview/datamodel/features/FeatureAttributes.java @@ -0,0 +1,360 @@ +package jalview.datamodel.features; + +import java.util.ArrayList; +import java.util.Collections; +import java.util.Comparator; +import java.util.HashMap; +import java.util.List; +import java.util.Map; +import java.util.Map.Entry; +import java.util.TreeMap; + +/** + * A singleton class to hold the set of attributes known for each feature type + */ +public class FeatureAttributes +{ + public enum Datatype + { + Character, Number, Mixed + } + + private static FeatureAttributes instance = new FeatureAttributes(); + + /* + * map, by feature type, of a map, by attribute name, of + * attribute description and min-max range (if known) + */ + private Map> attributes; + + /* + * a case-insensitive comparator so that attributes are ordered e.g. + * AC + * af + * CSQ:AFR_MAF + * CSQ:Allele + */ + private Comparator comparator = new Comparator() + { + @Override + public int compare(String[] o1, String[] o2) + { + int i = 0; + while (i < o1.length || i < o2.length) + { + if (o2.length <= i) + { + return o1.length <= i ? 0 : 1; + } + if (o1.length <= i) + { + return -1; + } + int comp = String.CASE_INSENSITIVE_ORDER.compare(o1[i], o2[i]); + if (comp != 0) + { + return comp; + } + i++; + } + return 0; // same length and all matched + } + }; + + private class AttributeData + { + /* + * description(s) for this attribute, if known + * (different feature source might have differing descriptions) + */ + List description; + + /* + * minimum value (of any numeric values recorded) + */ + float min = 0f; + + /* + * maximum value (of any numeric values recorded) + */ + float max = 0f; + + /* + * flag is set true if any numeric value is detected for this attribute + */ + boolean hasValue = false; + + Datatype type; + + /** + * Note one instance of this attribute, recording unique, non-null names, + * and the min/max of any numerical values + * + * @param desc + * @param value + */ + void addInstance(String desc, String value) + { + addDescription(desc); + + if (value != null) + { + try + { + float f = Float.valueOf(value); + min = hasValue ? Float.min(min, f) : f; + max = hasValue ? Float.max(max, f) : f; + hasValue = true; + type = (type == null || type == Datatype.Number) ? Datatype.Number + : Datatype.Mixed; + } catch (NumberFormatException e) + { + // not a number, ignore for min-max purposes + type = (type == null || type == Datatype.Character) + ? Datatype.Character + : Datatype.Mixed; + } + } + } + + /** + * Answers the description of the attribute, if recorded and unique, or null if either no, or more than description is recorded + * @return + */ + public String getDescription() + { + if (description != null && description.size() == 1) + { + return description.get(0); + } + return null; + } + + public Datatype getType() + { + return type; + } + + /** + * Adds the given description to the list of known descriptions (without + * duplication) + * + * @param desc + */ + public void addDescription(String desc) + { + if (desc != null) + { + if (description == null) + { + description = new ArrayList<>(); + } + if (!description.contains(desc)) + { + description.add(desc); + } + } + } + } + + /** + * Answers the singleton instance of this class + * + * @return + */ + public static FeatureAttributes getInstance() + { + return instance; + } + + private FeatureAttributes() + { + attributes = new HashMap<>(); + } + + /** + * Answers the attribute names known for the given feature type, in + * alphabetical order (not case sensitive), or an empty set if no attributes + * are known. An attribute name is typically 'simple' e.g. "AC", but may be + * 'compound' e.g. {"CSQ", "Allele"} where a feature has map-valued attributes + * + * @param featureType + * @return + */ + public List getAttributes(String featureType) + { + if (!attributes.containsKey(featureType)) + { + return Collections. emptyList(); + } + + return new ArrayList<>(attributes.get(featureType).keySet()); + } + + /** + * Answers true if at least one attribute is known for the given feature type, + * else false + * + * @param featureType + * @return + */ + public boolean hasAttributes(String featureType) + { + if (attributes.containsKey(featureType)) + { + if (!attributes.get(featureType).isEmpty()) + { + return true; + } + } + return false; + } + + /** + * Records the given attribute name and description for the given feature + * type, and updates the min-max for any numeric value + * + * @param featureType + * @param description + * @param value + * @param attName + */ + public void addAttribute(String featureType, String description, + Object value, String... attName) + { + if (featureType == null || attName == null) + { + return; + } + + /* + * if attribute value is a map, drill down one more level to + * record its sub-fields + */ + if (value instanceof Map) + { + for (Entry entry : ((Map) value).entrySet()) + { + String[] attNames = new String[attName.length + 1]; + System.arraycopy(attName, 0, attNames, 0, attName.length); + attNames[attName.length] = entry.getKey().toString(); + addAttribute(featureType, description, entry.getValue(), attNames); + } + return; + } + + String valueAsString = value.toString(); + Map atts = attributes.get(featureType); + if (atts == null) + { + atts = new TreeMap<>(comparator); + attributes.put(featureType, atts); + } + AttributeData attData = atts.get(attName); + if (attData == null) + { + attData = new AttributeData(); + atts.put(attName, attData); + } + attData.addInstance(description, valueAsString); + } + + /** + * Answers the description of the given attribute for the given feature type, + * if known and unique, else null + * + * @param featureType + * @param attName + * @return + */ + public String getDescription(String featureType, String... attName) + { + String desc = null; + Map atts = attributes.get(featureType); + if (atts != null) + { + AttributeData attData = atts.get(attName); + if (attData != null) + { + desc = attData.getDescription(); + } + } + return desc; + } + + /** + * Answers the [min, max] value range of the given attribute for the given + * feature type, if known, else null. Attributes which only have text values + * would normally return null, however text values which happen to be numeric + * could result in a 'min-max' range. + * + * @param featureType + * @param attName + * @return + */ + public float[] getMinMax(String featureType, String... attName) + { + Map atts = attributes.get(featureType); + if (atts != null) + { + AttributeData attData = atts.get(attName); + if (attData != null && attData.hasValue) + { + return new float[] { attData.min, attData.max }; + } + } + return null; + } + + /** + * Records the given attribute description for the given feature type + * + * @param featureType + * @param attName + * @param description + */ + public void addDescription(String featureType, String description, + String... attName) + { + if (featureType == null || attName == null) + { + return; + } + + Map atts = attributes.get(featureType); + if (atts == null) + { + atts = new TreeMap<>(comparator); + attributes.put(featureType, atts); + } + AttributeData attData = atts.get(attName); + if (attData == null) + { + attData = new AttributeData(); + atts.put(attName, attData); + } + attData.addDescription(description); + } + + /** + * Answers the datatype of the feature, which is one of Character, Number or + * Mixed (or null if not known), as discovered from values recorded. + * + * @param featureType + * @param attName + * @return + */ + public Datatype getDatatype(String featureType, String... attName) + { + Map atts = attributes.get(featureType); + if (atts != null) + { + AttributeData attData = atts.get(attName); + if (attData != null) + { + return attData.getType(); + } + } + return null; + } +} diff --git a/src/jalview/datamodel/features/FeatureMatcher.java b/src/jalview/datamodel/features/FeatureMatcher.java new file mode 100644 index 0000000..f844141 --- /dev/null +++ b/src/jalview/datamodel/features/FeatureMatcher.java @@ -0,0 +1,417 @@ +package jalview.datamodel.features; + +import jalview.datamodel.SequenceFeature; +import jalview.util.MessageManager; +import jalview.util.matcher.Condition; +import jalview.util.matcher.Matcher; +import jalview.util.matcher.MatcherI; + +/** + * An immutable class that models one or more match conditions, each of which is + * applied to the value obtained by lookup given the match key. + *

+ * For example, the value provider could be a SequenceFeature's attributes map, + * and the conditions might be + *

CSQ contains "pathological"
AND
AF <= 1.0e-5

+ * + * @author gmcarstairs + * + */ +public class FeatureMatcher implements FeatureMatcherI +{ + private static final String SCORE = "Score"; + + private static final String LABEL = "Label"; + + private static final String SPACE = " "; + + private static final String QUOTE = "'"; + + /* + * a dummy matcher that comes in useful for the 'add a filter' gui row + */ + public static final FeatureMatcherI NULL_MATCHER = FeatureMatcher + .byLabel(Condition.values()[0], ""); + + private static final String COLON = ":"; + + /* + * if true, match is against feature description + */ + final private boolean byLabel; + + /* + * if true, match is against feature score + */ + final private boolean byScore; + + /* + * if not null, match is against feature attribute [sub-attribute] + */ + final private String[] key; + + final private MatcherI matcher; + + /** + * A helper method that converts a 'compound' attribute name from its display + * form, e.g. CSQ:PolyPhen to array form, e.g. { "CSQ", "PolyPhen" } + * + * @param attribute + * @return + */ + public static String[] fromAttributeDisplayName(String attribute) + { + return attribute == null ? null : attribute.split(COLON); + } + + /** + * A helper method that converts a 'compound' attribute name to its display + * form, e.g. CSQ:PolyPhen from its array form, e.g. { "CSQ", "PolyPhen" } + * + * @param attName + * @return + */ + public static String toAttributeDisplayName(String[] attName) + { + return attName == null ? "" : String.join(COLON, attName); + } + + /** + * A factory constructor that converts a stringified object (as output by + * toStableString) to an object instance. Returns null if parsing fails. + *

+ * Leniency in parsing (for manually created feature files): + *

keywords Score and Label, and the condition, are not + * case-sensitive
quotes around value and pattern are optional if string does not include + * a space

+ * + * @param descriptor + * @return + */ + public static FeatureMatcher fromString(final String descriptor) + { + String invalidFormat = "Invalid matcher format: " + descriptor; + + /* + * expect + * value condition pattern + * where value is Label or Space or attributeName or attName1:attName2 + * and pattern is a float value as string, or a text string + * attribute names or patterns may be quoted (must be if include space) + */ + String attName = null; + boolean byScore = false; + boolean byLabel = false; + Condition cond = null; + String pattern = null; + + /* + * parse first field (Label / Score / attribute) + * optionally in quotes (required if attName includes space) + */ + String leftToParse = descriptor; + String firstField = null; + + if (descriptor.startsWith(QUOTE)) + { + // 'Label' / 'Score' / 'attName' + int nextQuotePos = descriptor.indexOf(QUOTE, 1); + if (nextQuotePos == -1) + { + System.err.println(invalidFormat); + return null; + } + firstField = descriptor.substring(1, nextQuotePos); + leftToParse = descriptor.substring(nextQuotePos + 1).trim(); + } + else + { + // Label / Score / attName (unquoted) + int nextSpacePos = descriptor.indexOf(SPACE); + if (nextSpacePos == -1) + { + System.err.println(invalidFormat); + return null; + } + firstField = descriptor.substring(0, nextSpacePos); + leftToParse = descriptor.substring(nextSpacePos + 1).trim(); + } + String lower = firstField.toLowerCase(); + if (lower.startsWith(LABEL.toLowerCase())) + { + byLabel = true; + } + else if (lower.startsWith(SCORE.toLowerCase())) + { + byScore = true; + } + else + { + attName = firstField; + } + + /* + * next field is the comparison condition + * most conditions require a following pattern (optionally quoted) + * although some conditions e.g. Present do not + */ + int nextSpacePos = leftToParse.indexOf(SPACE); + if (nextSpacePos == -1) + { + /* + * no value following condition - only valid for some conditions + */ + cond = Condition.fromString(leftToParse); + if (cond == null || cond.needsAPattern()) + { + System.err.println(invalidFormat); + return null; + } + } + else + { + /* + * condition and pattern + */ + cond = Condition.fromString(leftToParse.substring(0, nextSpacePos)); + leftToParse = leftToParse.substring(nextSpacePos + 1).trim(); + if (leftToParse.startsWith(QUOTE)) + { + // pattern in quotes + if (leftToParse.endsWith(QUOTE)) + { + pattern = leftToParse.substring(1, leftToParse.length() - 1); + } + else + { + // unbalanced quote + System.err.println(invalidFormat); + return null; + } + } + else + { + // unquoted pattern + pattern = leftToParse; + } + } + + /* + * we have parsed out value, condition and pattern + * so can now make the FeatureMatcher + */ + try + { + if (byLabel) + { + return FeatureMatcher.byLabel(cond, pattern); + } + else if (byScore) + { + return FeatureMatcher.byScore(cond, pattern); + } + else + { + String[] attNames = FeatureMatcher + .fromAttributeDisplayName(attName); + return FeatureMatcher.byAttribute(cond, pattern, attNames); + } + } catch (NumberFormatException e) + { + // numeric condition with non-numeric pattern + return null; + } + } + + /** + * A factory constructor method for a matcher that applies its match condition + * to the feature label (description) + * + * @param cond + * @param pattern + * @return + * @throws NumberFormatException + * if an invalid numeric pattern is supplied + */ + public static FeatureMatcher byLabel(Condition cond, String pattern) + { + return new FeatureMatcher(new Matcher(cond, pattern), true, false, + null); + } + + /** + * A factory constructor method for a matcher that applies its match condition + * to the feature score + * + * @param cond + * @param pattern + * @return + * @throws NumberFormatException + * if an invalid numeric pattern is supplied + */ + public static FeatureMatcher byScore(Condition cond, String pattern) + { + return new FeatureMatcher(new Matcher(cond, pattern), false, true, + null); + } + + /** + * A factory constructor method for a matcher that applies its match condition + * to the named feature attribute [and optional sub-attribute] + * + * @param cond + * @param pattern + * @param attName + * @return + * @throws NumberFormatException + * if an invalid numeric pattern is supplied + */ + public static FeatureMatcher byAttribute(Condition cond, String pattern, + String... attName) + { + return new FeatureMatcher(new Matcher(cond, pattern), false, false, + attName); + } + + private FeatureMatcher(Matcher m, boolean forLabel, boolean forScore, + String[] theKey) + { + key = theKey; + matcher = m; + byLabel = forLabel; + byScore = forScore; + } + @Override + public boolean matches(SequenceFeature feature) + { + String value = byLabel ? feature.getDescription() + : (byScore ? String.valueOf(feature.getScore()) + : feature.getValueAsString(key)); + return matcher.matches(value); + } + + @Override + public String[] getAttribute() + { + return key; + } + + @Override + public MatcherI getMatcher() + { + return matcher; + } + + /** + * Answers a string description of this matcher, suitable for display, debugging + * or logging. The format may change in future. + */ + @Override + public String toString() + { + StringBuilder sb = new StringBuilder(); + if (byLabel) + { + sb.append(MessageManager.getString("label.label")); + } + else if (byScore) + { + sb.append(MessageManager.getString("label.score")); + } + else + { + sb.append(String.join(COLON, key)); + } + + Condition condition = matcher.getCondition(); + sb.append(SPACE).append(condition.toString().toLowerCase()); + if (condition.isNumeric()) + { + sb.append(SPACE).append(matcher.getPattern()); + } + else if (condition.needsAPattern()) + { + sb.append(" '").append(matcher.getPattern()).append(QUOTE); + } + + return sb.toString(); + } + + @Override + public boolean isByLabel() + { + return byLabel; + } + + @Override + public boolean isByScore() + { + return byScore; + } + + @Override + public boolean isByAttribute() + { + return getAttribute() != null; + } + + /** + * {@inheritDoc} The output of this method should be parseable by method + *

fromString to restore the original object.
+   */
+  @Override
+  public String toStableString()
+  {
+    StringBuilder sb = new StringBuilder();
+    if (byLabel)
+    {
+      sb.append(LABEL); // no i18n here unlike toString() !
+    }
+    else if (byScore)
+    {
+      sb.append(SCORE);
+    }
+    else
+    {
+      /*
+       * enclose attribute name in quotes if it includes space
+       */
+      String displayName = toAttributeDisplayName(key);
+      if (displayName.contains(SPACE))
+      {
+        sb.append(QUOTE).append(displayName).append(QUOTE);
+      }
+      else
+      {
+        sb.append(displayName);
+      }
+    }
+  
+    Condition condition = matcher.getCondition();
+    sb.append(SPACE).append(condition.getStableName());
+    String pattern = matcher.getPattern();
+    if (condition.needsAPattern())
+    {
+      /*
+       * enclose pattern in quotes if it includes space
+       */
+      if (pattern.contains(SPACE))
+      {
+        sb.append(SPACE).append(QUOTE).append(pattern).append(QUOTE);
+      }
+      else
+      {
+        sb.append(SPACE).append(pattern);
+      }
+    }
+  
+    return sb.toString();
+  }
+}
diff --git a/src/jalview/datamodel/features/FeatureMatcherI.java b/src/jalview/datamodel/features/FeatureMatcherI.java
new file mode 100644
index 0000000..f1f8585
--- /dev/null
+++ b/src/jalview/datamodel/features/FeatureMatcherI.java
@@ -0,0 +1,65 @@
+package jalview.datamodel.features;
+
+import jalview.datamodel.SequenceFeature;
+import jalview.util.matcher.MatcherI;
+
+/**
+ * An interface for an object that can apply a match condition to a
+ * SequenceFeature object
+ * 
+ * @author gmcarstairs
+ */
+public interface FeatureMatcherI
+{
+  /**
+   * Answers true if the value provided for this matcher's key passes this
+   * matcher's match condition
+   * 
+   * @param feature
+   * @return
+   */
+  boolean matches(SequenceFeature feature);
+
+  /**
+   * Answers the attribute key this matcher operates on (or null if match is by
+   * Label or Score)
+   * 
+   * @return
+   */
+  String[] getAttribute();
+
+  /**
+   * Answers true if match is against feature label (description), else false
+   * 
+   * @return
+   */
+  boolean isByLabel();
+
+  /**
+   * Answers true if match is against feature score, else false
+   * 
+   * @return
+   */
+  boolean isByScore();
+
+  /**
+   * Answers true if match is against a feature attribute (text or range)
+   * 
+   * @return
+   */
+  boolean isByAttribute();
+
+  /**
+   * Answers the match condition that is applied
+   * 
+   * @return
+   */
+  MatcherI getMatcher();
+
+  /**
+   * Answers a string representation of this object suitable for use when
+   * persisting data, in a format that can be reliably read back. Any changes to
+   * the format should be backwards compatible.
+   */
+  String toStableString();
+}
diff --git a/src/jalview/datamodel/features/FeatureMatcherSet.java b/src/jalview/datamodel/features/FeatureMatcherSet.java
new file mode 100644
index 0000000..b51f2f0
--- /dev/null
+++ b/src/jalview/datamodel/features/FeatureMatcherSet.java
@@ -0,0 +1,294 @@
+package jalview.datamodel.features;
+
+import jalview.datamodel.SequenceFeature;
+import jalview.util.MessageManager;
+
+import java.util.ArrayList;
+import java.util.List;
+
+/**
+ * A class that models one or more match conditions, which may be combined with
+ * AND or OR (but not a mixture)
+ * 
+ * @author gmcarstairs
+ */
+public class FeatureMatcherSet implements FeatureMatcherSetI
+{
+  private static final String OR = "OR";
+
+  private static final String AND = "AND";
+
+  private static final String SPACE = " ";
+
+  private static final String CLOSE_BRACKET = ")";
+
+  private static final String OPEN_BRACKET = "(";
+
+  private static final String OR_I18N = MessageManager
+          .getString("label.or");
+
+  private static final String AND_18N = MessageManager
+          .getString("label.and");
+
+  List matchConditions;
+
+  boolean andConditions;
+
+  /**
+   * A factory constructor that converts a stringified object (as output by
+   * toStableString) to an object instance.
+   * 
+   * Format:
+   * 
+   * (condition1) AND (condition2) AND (condition3)
+   * or
+   * (condition1) OR (condition2) OR (condition3)
+   * 
+   * where OR and AND are not case-sensitive, and may not be mixed. Brackets are
+   * optional if there is only one condition.
+   * 
+   * @param descriptor
+   * @return
+   * @see FeatureMatcher#fromString(String)
+   */
+  public static FeatureMatcherSet fromString(final String descriptor)
+  {
+    String invalid = "Invalid descriptor: " + descriptor;
+    boolean firstCondition = true;
+    FeatureMatcherSet result = new FeatureMatcherSet();
+
+    String leftToParse = descriptor.trim();
+
+    while (leftToParse.length() > 0)
+    {
+      /*
+       * inspect AND or OR condition, check not mixed
+       */
+      boolean and = true;
+      if (!firstCondition)
+      {
+        int spacePos = leftToParse.indexOf(SPACE);
+        if (spacePos == -1)
+        {
+          // trailing junk after a match condition
+          System.err.println(invalid);
+          return null;
+        }
+        String conjunction = leftToParse.substring(0, spacePos);
+        leftToParse = leftToParse.substring(spacePos + 1).trim();
+        if (conjunction.equalsIgnoreCase(AND))
+        {
+          and = true;
+        }
+        else if (conjunction.equalsIgnoreCase(OR))
+        {
+          and = false;
+        }
+        else
+        {
+          // not an AND or an OR - invalid
+          System.err.println(invalid);
+          return null;
+        }
+      }
+
+      /*
+       * now extract the next condition and AND or OR it
+       */
+      String nextCondition = leftToParse;
+      if (leftToParse.startsWith(OPEN_BRACKET))
+      {
+        int closePos = leftToParse.indexOf(CLOSE_BRACKET);
+        if (closePos == -1)
+        {
+          System.err.println(invalid);
+          return null;
+        }
+        nextCondition = leftToParse.substring(1, closePos);
+        leftToParse = leftToParse.substring(closePos + 1).trim();
+      }
+      else
+      {
+        leftToParse = "";
+      }
+
+      FeatureMatcher fm = FeatureMatcher.fromString(nextCondition);
+      if (fm == null)
+      {
+        System.err.println(invalid);
+        return null;
+      }
+      try
+      {
+        if (and)
+        {
+          result.and(fm);
+        }
+        else
+        {
+          result.or(fm);
+        }
+        firstCondition = false;
+      } catch (IllegalStateException e)
+      {
+        // thrown if OR and AND are mixed
+        System.err.println(invalid);
+        return null;
+      }
+
+    }
+    return result;
+  }
+
+  /**
+   * Constructor
+   */
+  public FeatureMatcherSet()
+  {
+    matchConditions = new ArrayList<>();
+  }
+
+  @Override
+  public boolean matches(SequenceFeature feature)
+  {
+    /*
+     * no conditions matches anything
+     */
+    if (matchConditions.isEmpty())
+    {
+      return true;
+    }
+
+    /*
+     * AND until failure
+     */
+    if (andConditions)
+    {
+      for (FeatureMatcherI m : matchConditions)
+      {
+        if (!m.matches(feature))
+        {
+          return false;
+        }
+      }
+      return true;
+    }
+
+    /*
+     * OR until match
+     */
+    for (FeatureMatcherI m : matchConditions)
+    {
+      if (m.matches(feature))
+      {
+        return true;
+      }
+    }
+    return false;
+  }
+
+  @Override
+  public void and(FeatureMatcherI m)
+  {
+    if (!andConditions && matchConditions.size() > 1)
+    {
+      throw new IllegalStateException("Can't add an AND to OR conditions");
+    }
+    matchConditions.add(m);
+    andConditions = true;
+  }
+
+  @Override
+  public void or(FeatureMatcherI m)
+  {
+    if (andConditions && matchConditions.size() > 1)
+    {
+      throw new IllegalStateException("Can't add an OR to AND conditions");
+    }
+    matchConditions.add(m);
+    andConditions = false;
+  }
+
+  @Override
+  public boolean isAnded()
+  {
+    return andConditions;
+  }
+
+  @Override
+  public Iterable getMatchers()
+  {
+    return matchConditions;
+  }
+
+  /**
+   * Answers a string representation of this object suitable for display, and
+   * possibly internationalized. The format is not guaranteed stable and may
+   * change in future.
+   */
+  @Override
+  public String toString()
+  {
+    StringBuilder sb = new StringBuilder();
+    boolean first = true;
+    boolean multiple = matchConditions.size() > 1;
+    for (FeatureMatcherI matcher : matchConditions)
+    {
+      if (!first)
+      {
+        String joiner = andConditions ? AND_18N : OR_I18N;
+        sb.append(SPACE).append(joiner.toLowerCase()).append(SPACE);
+      }
+      first = false;
+      if (multiple)
+      {
+        sb.append(OPEN_BRACKET).append(matcher.toString())
+                .append(CLOSE_BRACKET);
+      }
+      else
+      {
+        sb.append(matcher.toString());
+      }
+    }
+    return sb.toString();
+  }
+
+  @Override
+  public boolean isEmpty()
+  {
+    return matchConditions == null || matchConditions.isEmpty();
+  }
+
+  /**
+   * {@inheritDoc} The output of this method should be parseable by method
+   * fromString to restore the original object.
+   */
+  @Override
+  public String toStableString()
+  {
+    StringBuilder sb = new StringBuilder();
+    boolean moreThanOne = matchConditions.size() > 1;
+    boolean first = true;
+
+    for (FeatureMatcherI matcher : matchConditions)
+    {
+      if (!first)
+      {
+        String joiner = andConditions ? AND : OR;
+        sb.append(SPACE).append(joiner).append(SPACE);
+      }
+      first = false;
+      if (moreThanOne)
+      {
+        sb.append(OPEN_BRACKET).append(matcher.toStableString())
+                .append(CLOSE_BRACKET);
+      }
+      else
+      {
+        sb.append(matcher.toStableString());
+      }
+    }
+    return sb.toString();
+  }
+
+}
diff --git a/src/jalview/datamodel/features/FeatureMatcherSetI.java b/src/jalview/datamodel/features/FeatureMatcherSetI.java
new file mode 100644
index 0000000..90c2986
--- /dev/null
+++ b/src/jalview/datamodel/features/FeatureMatcherSetI.java
@@ -0,0 +1,68 @@
+package jalview.datamodel.features;
+
+import jalview.datamodel.SequenceFeature;
+
+/**
+ * An interface to describe a set of one or more feature matchers, where all
+ * matchers are combined with either AND or OR
+ * 
+ * @author gmcarstairs
+ *
+ */
+public interface FeatureMatcherSetI
+{
+  /**
+   * Answers true if the feature provided passes this matcher's match condition
+   * 
+   * @param feature
+   * @return
+   */
+  boolean matches(SequenceFeature feature);
+
+  /**
+   * Adds (ANDs) match condition m to this object's matcher set
+   * 
+   * @param m
+   * @throws IllegalStateException
+   *           if an attempt is made to AND to existing OR-ed conditions
+   */
+  void and(FeatureMatcherI m);
+
+  /**
+   * Answers true if any second condition is AND-ed with this one, false if it
+   * is OR-ed
+   * 
+   * @return
+   */
+  boolean isAnded();
+
+  /**
+   * Adds (ORs) the given condition to this object's match conditions
+   * 
+   * @param m
+   * @throws IllegalStateException
+   *           if an attempt is made to OR to existing AND-ed conditions
+   */
+  void or(FeatureMatcherI m);
+
+  /**
+   * Answers an iterator over the combined match conditions
+   * 
+   * @return
+   */
+  Iterable getMatchers();
+
+  /**
+   * Answers true if this object contains no conditions
+   * 
+   * @return
+   */
+  boolean isEmpty();
+
+  /**
+   * Answers a string representation of this object suitable for use when
+   * persisting data, in a format that can be reliably read back. Any changes to
+   * the format should be backwards compatible.
+   */
+  String toStableString();
+}
diff --git a/src/jalview/datamodel/features/FeatureSource.java b/src/jalview/datamodel/features/FeatureSource.java
new file mode 100644
index 0000000..a1be1dc
--- /dev/null
+++ b/src/jalview/datamodel/features/FeatureSource.java
@@ -0,0 +1,78 @@
+package jalview.datamodel.features;
+
+import java.util.HashMap;
+import java.util.Map;
+
+/**
+ * A class to model one source of feature data, including metadata about
+ * attributes of features
+ * 
+ * @author gmcarstairs
+ *
+ */
+public class FeatureSource implements FeatureSourceI
+{
+  private String name;
+
+  private Map attributeNames;
+  
+  private Map attributeTypes;
+  
+  /**
+   * Constructor
+   * 
+   * @param theName
+   */
+  public FeatureSource(String theName)
+  {
+    this.name = theName;
+    attributeNames = new HashMap<>();
+    attributeTypes = new HashMap<>();
+  }
+
+  /**
+   * {@inheritDoc}
+   */
+  @Override
+  public String getName()
+  {
+    return name;
+  }
+
+  /**
+   * {@inheritDoc}
+   */
+  @Override
+  public String getAttributeName(String attributeId)
+  {
+    return attributeNames.get(attributeId);
+  }
+
+  /**
+   * {@inheritDoc}
+   */
+  @Override
+  public FeatureAttributeType getAttributeType(String attributeId)
+  {
+    return attributeTypes.get(attributeId);
+  }
+
+  /**
+   * {@inheritDoc}
+   */
+  @Override
+  public void setAttributeName(String id, String attName)
+  {
+    attributeNames.put(id, attName);
+  }
+
+  /**
+   * {@inheritDoc}
+   */
+  @Override
+  public void setAttributeType(String id, FeatureAttributeType type)
+  {
+    attributeTypes.put(id, type);
+  }
+
+}
diff --git a/src/jalview/datamodel/features/FeatureSourceI.java b/src/jalview/datamodel/features/FeatureSourceI.java
new file mode 100644
index 0000000..c873593
--- /dev/null
+++ b/src/jalview/datamodel/features/FeatureSourceI.java
@@ -0,0 +1,45 @@
+package jalview.datamodel.features;
+
+public interface FeatureSourceI
+{
+  /**
+   * Answers a name for the feature source (not necessarily unique)
+   * 
+   * @return
+   */
+  String getName();
+
+  /**
+   * Answers the 'long name' of an attribute given its id (short name or
+   * abbreviation), or null if not known
+   * 
+   * @param attributeId
+   * @return
+   */
+  String getAttributeName(String attributeId);
+
+  /**
+   * Sets the 'long name' of an attribute given its id (short name or
+   * abbreviation).
+   * 
+   * @param id
+   * @param name
+   */
+  void setAttributeName(String id, String name);
+
+  /**
+   * Answers the datatype of the attribute with given id, or null if not known
+   * 
+   * @param attributeId
+   * @return
+   */
+  FeatureAttributeType getAttributeType(String attributeId);
+
+  /**
+   * Sets the datatype of the attribute with given id
+   * 
+   * @param id
+   * @param type
+   */
+  void setAttributeType(String id, FeatureAttributeType type);
+}
diff --git a/src/jalview/datamodel/features/FeatureSources.java b/src/jalview/datamodel/features/FeatureSources.java
new file mode 100644
index 0000000..1be1b82
--- /dev/null
+++ b/src/jalview/datamodel/features/FeatureSources.java
@@ -0,0 +1,58 @@
+package jalview.datamodel.features;
+
+import java.util.HashMap;
+import java.util.Map;
+
+/**
+ * A singleton to hold metadata about feature attributes, keyed by a unique
+ * feature source identifier
+ * 
+ * @author gmcarstairs
+ *
+ */
+public class FeatureSources
+{
+  private static FeatureSources instance = new FeatureSources();
+
+  private Map sources;
+
+  /**
+   * Answers the singleton instance of this class
+   * 
+   * @return
+   */
+  public static FeatureSources getInstance()
+  {
+    return instance;
+  }
+
+  private FeatureSources()
+  {
+    sources = new HashMap<>();
+  }
+
+  /**
+   * Answers the FeatureSource with the given unique identifier, or null if not
+   * known
+   * 
+   * @param sourceId
+   * @return
+   */
+  public FeatureSourceI getSource(String sourceId)
+  {
+    return sources.get(sourceId);
+  }
+
+  /**
+   * Adds the given source under the given key. This will replace any existing
+   * source with the same id, it is the caller's responsibility to ensure keys
+   * are unique if necessary.
+   * 
+   * @param sourceId
+   * @param source
+   */
+  public void addSource(String sourceId, FeatureSource source)
+  {
+    sources.put(sourceId, source);
+  }
+}
diff --git a/src/jalview/ext/ensembl/EnsemblData.java b/src/jalview/ext/ensembl/EnsemblData.java
new file mode 100644
index 0000000..47fe0fc
--- /dev/null
+++ b/src/jalview/ext/ensembl/EnsemblData.java
@@ -0,0 +1,91 @@
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ * 
+ * This file is part of Jalview.
+ * 
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License 
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *  
+ * Jalview is distributed in the hope that it will be useful, but 
+ * WITHOUT ANY WARRANTY; without even the implied warranty 
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR 
+ * PURPOSE.  See the GNU General Public License for more details.
+ * 
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview.  If not, see .
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+package jalview.ext.ensembl;
+
+/**
+ * A data class to model the data and rest version of one Ensembl domain,
+ * currently for rest.ensembl.org and rest.ensemblgenomes.org
+ * 
+ * @author gmcarstairs
+ */
+class EnsemblData
+{
+  /*
+   * The http domain this object is holding data values for
+   */
+  String domain;
+
+  /*
+   * The latest version Jalview has tested for, e.g. "4.5"; a minor version change should be
+   * ok, a major version change may break stuff 
+   */
+  String expectedRestVersion;
+
+  /*
+   * Major / minor / point version e.g. "4.5.1"
+   * @see http://rest.ensembl.org/info/rest/?content-type=application/json
+   */
+  String restVersion;
+
+  /*
+   * data version
+   * @see http://rest.ensembl.org/info/data/?content-type=application/json
+   */
+  String dataVersion;
+
+  /*
+   * true when http://rest.ensembl.org/info/ping/?content-type=application/json
+   * returns response code 200 and not {"error":"Database is unavailable"}
+   */
+  boolean restAvailable;
+
+  /*
+   * absolute time when availability was last checked
+   */
+  long lastAvailableCheckTime;
+
+  /*
+   * absolute time when version numbers were last checked
+   */
+  long lastVersionCheckTime;
+
+  // flag set to true if REST major version is not the one expected
+  boolean restMajorVersionMismatch;
+
+  /*
+   * absolute time to wait till if we overloaded the REST service
+   */
+  long retryAfter;
+
+  /**
+   * Constructor given expected REST version number e.g 4.5 or 3.4.3
+   * 
+   * @param restExpected
+   */
+  EnsemblData(String theDomain, String restExpected)
+  {
+    domain = theDomain;
+    expectedRestVersion = restExpected;
+    lastAvailableCheckTime = -1;
+    lastVersionCheckTime = -1;
+  }
+
+}
diff --git a/src/jalview/ext/ensembl/EnsemblGene.java b/src/jalview/ext/ensembl/EnsemblGene.java
index 0d5fc26..7e6f653 100644
--- a/src/jalview/ext/ensembl/EnsemblGene.java
+++ b/src/jalview/ext/ensembl/EnsemblGene.java
@@ -23,6 +23,8 @@ package jalview.ext.ensembl;
 import jalview.api.FeatureColourI;
 import jalview.api.FeatureSettingsModelI;
 import jalview.datamodel.AlignmentI;
+import jalview.datamodel.DBRefEntry;
+import jalview.datamodel.GeneLociI;
 import jalview.datamodel.Sequence;
 import jalview.datamodel.SequenceFeature;
 import jalview.datamodel.SequenceI;
@@ -150,10 +152,14 @@ public class EnsemblGene extends EnsemblSeqProxy
       {
         continue;
       }
+      
       if (geneAlignment.getHeight() == 1)
       {
         // ensure id has 'correct' case for the Ensembl identifier
         geneId = geneAlignment.getSequenceAt(0).getName();
+
+        findGeneLoci(geneAlignment.getSequenceAt(0), geneId);
+
         getTranscripts(geneAlignment, geneId);
       }
       if (al == null)
@@ -169,6 +175,67 @@ public class EnsemblGene extends EnsemblSeqProxy
   }
 
   /**
+   * Calls the /lookup/id REST service, parses the response for gene
+   * coordinates, and if successful, adds these to the sequence. If this fails,
+   * fall back on trying to parse the sequence description in case it is in
+   * Ensembl-gene format e.g. chromosome:GRCh38:17:45051610:45109016:1.
+   * 
+   * @param seq
+   * @param geneId
+   */
+  void findGeneLoci(SequenceI seq, String geneId)
+  {
+    GeneLociI geneLoci = new EnsemblLookup(getDomain()).getGeneLoci(geneId);
+    if (geneLoci != null)
+    {
+      seq.setGeneLoci(geneLoci.getSpeciesId(), geneLoci.getAssemblyId(),
+              geneLoci.getChromosomeId(), geneLoci.getMap());
+    }
+    else
+    {
+      parseChromosomeLocations(seq);
+    }
+  }
+
+  /**
+   * Parses and saves fields of an Ensembl-style description e.g.
+   * chromosome:GRCh38:17:45051610:45109016:1
+   * 
+   * @param seq
+   */
+  boolean parseChromosomeLocations(SequenceI seq)
+  {
+    String description = seq.getDescription();
+    if (description == null)
+    {
+      return false;
+    }
+    String[] tokens = description.split(":");
+    if (tokens.length == 6 && tokens[0].startsWith(DBRefEntry.CHROMOSOME))
+    {
+      String ref = tokens[1];
+      String chrom = tokens[2];
+      try
+      {
+        int chStart = Integer.parseInt(tokens[3]);
+        int chEnd = Integer.parseInt(tokens[4]);
+        boolean forwardStrand = "1".equals(tokens[5]);
+        String species = ""; // not known here
+        int[] from = new int[] { seq.getStart(), seq.getEnd() };
+        int[] to = new int[] { forwardStrand ? chStart : chEnd,
+            forwardStrand ? chEnd : chStart };
+        MapList map = new MapList(from, to, 1, 1);
+        seq.setGeneLoci(species, ref, chrom, map);
+        return true;
+      } catch (NumberFormatException e)
+      {
+        System.err.println("Bad integers in description " + description);
+      }
+    }
+    return false;
+  }
+
+  /**
    * Converts a query, which may contain one or more gene, transcript, or
    * external (to Ensembl) identifiers, into a non-redundant list of gene
    * identifiers.
@@ -362,6 +429,8 @@ public class EnsemblGene extends EnsemblSeqProxy
     cdna.transferFeatures(gene.getFeatures().getPositionalFeatures(),
             transcript.getDatasetSequence(), mapping, parentId);
 
+    mapTranscriptToChromosome(transcript, gene, mapping);
+
     /*
      * fetch and save cross-references
      */
@@ -376,6 +445,42 @@ public class EnsemblGene extends EnsemblSeqProxy
   }
 
   /**
+   * If the gene has a mapping to chromosome coordinates, derive the transcript
+   * chromosome regions and save on the transcript sequence
+   * 
+   * @param transcript
+   * @param gene
+   * @param mapping
+   *          the mapping from gene to transcript positions
+   */
+  protected void mapTranscriptToChromosome(SequenceI transcript,
+          SequenceI gene, MapList mapping)
+  {
+    GeneLociI loci = gene.getGeneLoci();
+    if (loci == null)
+    {
+      return;
+    }
+
+    MapList geneMapping = loci.getMap();
+
+    List exons = mapping.getFromRanges();
+    List transcriptLoci = new ArrayList<>();
+
+    for (int[] exon : exons)
+    {
+      transcriptLoci.add(geneMapping.locateInTo(exon[0], exon[1]));
+    }
+
+    List transcriptRange = Arrays.asList(new int[] {
+        transcript.getStart(), transcript.getEnd() });
+    MapList mapList = new MapList(transcriptRange, transcriptLoci, 1, 1);
+
+    transcript.setGeneLoci(loci.getSpeciesId(), loci.getAssemblyId(),
+            loci.getChromosomeId(), mapList);
+  }
+
+  /**
    * Returns the 'transcript_id' property of the sequence feature (or null)
    * 
    * @param feature
diff --git a/src/jalview/ext/ensembl/EnsemblInfo.java b/src/jalview/ext/ensembl/EnsemblInfo.java
index 7668941..de55a53 100644
--- a/src/jalview/ext/ensembl/EnsemblInfo.java
+++ b/src/jalview/ext/ensembl/EnsemblInfo.java
@@ -1,86 +1,185 @@
-/*
- * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
- * Copyright (C) $$Year-Rel$$ The Jalview Authors
- * 
- * This file is part of Jalview.
- * 
- * Jalview is free software: you can redistribute it and/or
- * modify it under the terms of the GNU General Public License 
- * as published by the Free Software Foundation, either version 3
- * of the License, or (at your option) any later version.
- *  
- * Jalview is distributed in the hope that it will be useful, but 
- * WITHOUT ANY WARRANTY; without even the implied warranty 
- * of MERCHANTABILITY or FITNESS FOR A PARTICULAR 
- * PURPOSE.  See the GNU General Public License for more details.
- * 
- * You should have received a copy of the GNU General Public License
- * along with Jalview.  If not, see .
- * The Jalview Authors are detailed in the 'AUTHORS' file.
- */
 package jalview.ext.ensembl;
 
-/**
- * A data class to model the data and rest version of one Ensembl domain,
- * currently for rest.ensembl.org and rest.ensemblgenomes.org
- * 
- * @author gmcarstairs
- */
-class EnsemblInfo
+import jalview.datamodel.AlignmentI;
+import jalview.datamodel.DBRefSource;
+
+import java.io.BufferedReader;
+import java.io.IOException;
+import java.net.MalformedURLException;
+import java.net.URL;
+import java.util.HashMap;
+import java.util.Iterator;
+import java.util.List;
+import java.util.Map;
+import java.util.Set;
+
+import org.json.simple.JSONArray;
+import org.json.simple.parser.JSONParser;
+import org.json.simple.parser.ParseException;
+
+public class EnsemblInfo extends EnsemblRestClient
 {
-  /*
-   * The http domain this object is holding data values for
-   */
-  String domain;
 
   /*
-   * The latest version Jalview has tested for, e.g. "4.5"; a minor version change should be
-   * ok, a major version change may break stuff 
+   * cached results of REST /info/divisions service, currently
+   * +   * { 
+   *  { "ENSEMBLFUNGI", "http://rest.ensemblgenomes.org"},
+   *    "ENSEMBLBACTERIA", "http://rest.ensemblgenomes.org"},
+   *    "ENSEMBLPROTISTS", "http://rest.ensemblgenomes.org"},
+   *    "ENSEMBLMETAZOA", "http://rest.ensemblgenomes.org"},
+   *    "ENSEMBLPLANTS",  "http://rest.ensemblgenomes.org"},
+   *    "ENSEMBL", "http://rest.ensembl.org" }
+   *  }
+   * 
+   * The values for EnsemblGenomes are retrieved by a REST call, that for
+   * Ensembl is added programmatically for convenience of lookup
    */
-  String expectedRestVersion;
+  private static Map divisions;
 
-  /*
-   * Major / minor / point version e.g. "4.5.1"
-   * @see http://rest.ensembl.org/info/rest/?content-type=application/json
-   */
-  String restVersion;
+  @Override
+  public String getDbName()
+  {
+    return "ENSEMBL";
+  }
 
-  /*
-   * data version
-   * @see http://rest.ensembl.org/info/data/?content-type=application/json
-   */
-  String dataVersion;
+  @Override
+  public AlignmentI getSequenceRecords(String queries) throws Exception
+  {
+    return null;
+  }
 
-  /*
-   * true when http://rest.ensembl.org/info/ping/?content-type=application/json
-   * returns response code 200 and not {"error":"Database is unavailable"}
+  @Override
+  protected URL getUrl(List ids) throws MalformedURLException
+  {
+    return null;
+  }
+
+  @Override
+  protected boolean useGetRequest()
+  {
+    return true;
+  }
+
+  @Override
+  protected String getRequestMimeType(boolean multipleIds)
+  {
+    return "application/json";
+  }
+
+  @Override
+  protected String getResponseMimeType()
+  {
+    return "application/json";
+  }
+
+  /**
+   * Answers the domain (http://rest.ensembl.org or
+   * http://rest.ensemblgenomes.org) for the given division, or null if not
+   * recognised by Ensembl.
+   * 
+   * @param division
+   * @return
    */
-  boolean restAvailable;
+  public String getDomain(String division)
+  {
+    if (divisions == null)
+    {
+      fetchDivisions();
+    }
+    return divisions.get(division.toUpperCase());
+  }
 
-  /*
-   * absolute time when availability was last checked
+  /**
+   * On first request only, populate the lookup map by fetching the list of
+   * divisions known to EnsemblGenomes.
    */
-  long lastAvailableCheckTime;
+  void fetchDivisions()
+  {
+    divisions = new HashMap<>();
 
-  /*
-   * absolute time when version numbers were last checked
+    /*
+     * for convenience, pre-fill ensembl.org as the domain for "ENSEMBL"
+     */
+    divisions.put(DBRefSource.ENSEMBL.toUpperCase(), ENSEMBL_REST);
+
+    BufferedReader br = null;
+    try
+    {
+      URL url = getDivisionsUrl(ENSEMBL_GENOMES_REST);
+      if (url != null)
+      {
+        br = getHttpResponse(url, null);
+      }
+      parseResponse(br, ENSEMBL_GENOMES_REST);
+    } catch (IOException e)
+    {
+      // ignore
+    } finally
+    {
+      if (br != null)
+      {
+        try
+        {
+          br.close();
+        } catch (IOException e)
+        {
+          // ignore
+        }
+      }
+    }
+  }
+
+  /**
+   * Parses the JSON response to /info/divisions, and add each to the lookup map
+   * 
+   * @param br
+   * @param domain
    */
-  long lastVersionCheckTime;
+  void parseResponse(BufferedReader br, String domain)
+  {
+    JSONParser jp = new JSONParser();
+
+    try
+    {
+      JSONArray parsed = (JSONArray) jp.parse(br);
 
-  // flag set to true if REST major version is not the one expected
-  boolean restMajorVersionMismatch;
+      Iterator rvals = parsed.iterator();
+      while (rvals.hasNext())
+      {
+        String division = rvals.next().toString();
+        divisions.put(division.toUpperCase(), domain);
+      }
+    } catch (IOException | ParseException | NumberFormatException e)
+    {
+      // ignore
+    }
+  }
 
   /**
-   * Constructor given expected REST version number e.g 4.5 or 3.4.3
+   * Constructs the URL for the EnsemblGenomes /info/divisions REST service
+   * @param domain TODO
    * 
-   * @param restExpected
+   * @return
+   * @throws MalformedURLException
    */
-  EnsemblInfo(String theDomain, String restExpected)
+  URL getDivisionsUrl(String domain) throws MalformedURLException
   {
-    domain = theDomain;
-    expectedRestVersion = restExpected;
-    lastAvailableCheckTime = -1;
-    lastVersionCheckTime = -1;
+    return new URL(domain
+            + "/info/divisions?content-type=application/json");
   }
 
+  /**
+   * Returns the set of 'divisions' recognised by Ensembl or EnsemblGenomes
+   * 
+   * @return
+   */
+  public Set getDivisions() {
+    if (divisions == null)
+    {
+      fetchDivisions();
+    }
+
+    return divisions.keySet();
+  }
 }
diff --git a/src/jalview/ext/ensembl/EnsemblLookup.java b/src/jalview/ext/ensembl/EnsemblLookup.java
index 92763a1..f6b3a47 100644
--- a/src/jalview/ext/ensembl/EnsemblLookup.java
+++ b/src/jalview/ext/ensembl/EnsemblLookup.java
@@ -20,13 +20,17 @@
  */
 package jalview.ext.ensembl;
 
+import jalview.bin.Cache;
 import jalview.datamodel.AlignmentI;
+import jalview.datamodel.GeneLociI;
+import jalview.util.MapList;
 
 import java.io.BufferedReader;
 import java.io.IOException;
 import java.net.MalformedURLException;
 import java.net.URL;
 import java.util.Arrays;
+import java.util.Collections;
 import java.util.List;
 
 import org.json.simple.JSONObject;
@@ -34,13 +38,16 @@ import org.json.simple.parser.JSONParser;
 import org.json.simple.parser.ParseException;
 
 /**
- * A client for the Ensembl lookup REST endpoint, used to find the gene
- * identifier given a gene, transcript or protein identifier.
+ * A client for the Ensembl /lookup REST endpoint, used to find the gene
+ * identifier given a gene, transcript or protein identifier, or to extract the
+ * species or chromosomal coordinates from the same service response
  * 
  * @author gmcarstairs
  */
 public class EnsemblLookup extends EnsemblRestClient
 {
+  private static final String SPECIES = "species";
+
   /**
    * Default constructor (to use rest.ensembl.org)
    */
@@ -123,27 +130,49 @@ public class EnsemblLookup extends EnsemblRestClient
   }
 
   /**
-   * Returns the gene id related to the given identifier, which may be for a
-   * gene, transcript or protein
+   * Returns the gene id related to the given identifier (which may be for a
+   * gene, transcript or protein)
    * 
    * @param identifier
    * @return
    */
   public String getGeneId(String identifier)
   {
-    return getGeneId(identifier, null);
+    return parseGeneId(getResult(identifier, null));
   }
 
   /**
-   * Calls the Ensembl lookup REST endpoint and retrieves the 'Parent' for the
+   * Calls the Ensembl lookup REST endpoint and retrieves the 'species' for the
    * given identifier, or null if not found
    * 
    * @param identifier
+   * @return
+   */
+  public String getSpecies(String identifier)
+  {
+    String species = null;
+    JSONObject json = getResult(identifier, null);
+    if (json != null)
+    {
+      Object o = json.get(SPECIES);
+      if (o != null)
+      {
+        species = o.toString();
+      }
+    }
+    return species;
+  }
+
+  /**
+   * Calls the /lookup/id rest service and returns the response as a JSONObject,
+   * or null if any error
+   * 
+   * @param identifier
    * @param objectType
    *          (optional)
    * @return
    */
-  public String getGeneId(String identifier, String objectType)
+  protected JSONObject getResult(String identifier, String objectType)
   {
     List ids = Arrays.asList(new String[] { identifier });
 
@@ -155,10 +184,11 @@ public class EnsemblLookup extends EnsemblRestClient
       {
         br = getHttpResponse(url, ids);
       }
-      return br == null ? null : parseResponse(br);
-    } catch (IOException e)
+      return br == null ? null : (JSONObject) (new JSONParser().parse(br));
+    } catch (IOException | ParseException e)
     {
-      // ignore
+      System.err.println("Error parsing " + identifier + " lookup response "
+              + e.getMessage());
       return null;
     } finally
     {
@@ -179,41 +209,119 @@ public class EnsemblLookup extends EnsemblRestClient
    * Parses the JSON response and returns the gene identifier, or null if not
    * found. If the returned object_type is Gene, returns the id, if Transcript
    * returns the Parent. If it is Translation (peptide identifier), then the
-   * Parent is the transcript identifier, so we redo the search with this value.
+   * Parent is the transcript identifier, so we redo the search with this value,
+   * specifying that object_type should be Transcript.
    * 
-   * @param br
+   * @param jsonObject
    * @return
-   * @throws IOException
    */
-  protected String parseResponse(BufferedReader br) throws IOException
+  protected String parseGeneId(JSONObject json)
   {
+    if (json == null)
+    {
+      // e.g. lookup failed with 404 not found
+      return null;
+    }
+
     String geneId = null;
-    JSONParser jp = new JSONParser();
+    String type = json.get(OBJECT_TYPE).toString();
+    if (OBJECT_TYPE_GENE.equalsIgnoreCase(type))
+    {
+      // got the gene - just returns its id
+      geneId = json.get(JSON_ID).toString();
+    }
+    else if (OBJECT_TYPE_TRANSCRIPT.equalsIgnoreCase(type))
+    {
+      // got the transcript - return its (Gene) Parent
+      geneId = json.get(PARENT).toString();
+    }
+    else if (OBJECT_TYPE_TRANSLATION.equalsIgnoreCase(type))
+    {
+      // got the protein - look up its Parent, restricted to type Transcript
+      String transcriptId = json.get(PARENT).toString();
+      geneId = parseGeneId(getResult(transcriptId, OBJECT_TYPE_TRANSCRIPT));
+    }
+
+    return geneId;
+  }
+
+  /**
+   * Calls the /lookup/id rest service for the given id, and if successful,
+   * parses and returns the gene's chromosomal coordinates
+   * 
+   * @param geneId
+   * @return
+   */
+  public GeneLociI getGeneLoci(String geneId)
+  {
+    return parseGeneLoci(getResult(geneId, OBJECT_TYPE_GENE));
+  }
+
+  /**
+   * Parses the /lookup/id response for species, asssembly_name,
+   * seq_region_name, start, end and returns an object that wraps them, or null
+   * if unsuccessful
+   * 
+   * @param json
+   * @return
+   */
+  GeneLociI parseGeneLoci(JSONObject json)
+  {
+    if (json == null)
+    {
+      return null;
+    }
+
     try
     {
-      JSONObject val = (JSONObject) jp.parse(br);
-      String type = val.get(OBJECT_TYPE).toString();
-      if (OBJECT_TYPE_GENE.equalsIgnoreCase(type))
-      {
-        // got the gene - just returns its id
-        geneId = val.get(ID).toString();
-      }
-      else if (OBJECT_TYPE_TRANSCRIPT.equalsIgnoreCase(type))
-      {
-        // got the transcript - return its (Gene) Parent
-        geneId = val.get(PARENT).toString();
-      }
-      else if (OBJECT_TYPE_TRANSLATION.equalsIgnoreCase(type))
+      final String species = json.get("species").toString();
+      final String assembly = json.get("assembly_name").toString();
+      final String chromosome = json.get("seq_region_name").toString();
+      String strand = json.get("strand").toString();
+      int start = Integer.parseInt(json.get("start").toString());
+      int end = Integer.parseInt(json.get("end").toString());
+      int fromEnd = end - start + 1;
+      boolean reverseStrand = "-1".equals(strand);
+      int toStart = reverseStrand ? end : start;
+      int toEnd = reverseStrand ? start : end;
+      List fromRange = Collections.singletonList(new int[] { 1,
+          fromEnd });
+      List toRange = Collections.singletonList(new int[] { toStart,
+          toEnd });
+      final MapList map = new MapList(fromRange, toRange, 1, 1);
+      return new GeneLociI()
       {
-        // got the protein - get its Parent, restricted to type Transcript
-        String transcriptId = val.get(PARENT).toString();
-        geneId = getGeneId(transcriptId, OBJECT_TYPE_TRANSCRIPT);
-      }
-    } catch (ParseException e)
+
+        @Override
+        public String getSpeciesId()
+        {
+          return species == null ? "" : species;
+        }
+
+        @Override
+        public String getAssemblyId()
+        {
+          return assembly;
+        }
+
+        @Override
+        public String getChromosomeId()
+        {
+          return chromosome;
+        }
+
+        @Override
+        public MapList getMap()
+        {
+          return map;
+        }
+      };
+    } catch (NullPointerException | NumberFormatException e)
     {
-      // ignore
+      Cache.log.error("Error looking up gene loci: " + e.getMessage());
+      e.printStackTrace();
     }
-    return geneId;
+    return null;
   }
 
 }
diff --git a/src/jalview/ext/ensembl/EnsemblMap.java b/src/jalview/ext/ensembl/EnsemblMap.java
new file mode 100644
index 0000000..56657e0
--- /dev/null
+++ b/src/jalview/ext/ensembl/EnsemblMap.java
@@ -0,0 +1,422 @@
+package jalview.ext.ensembl;
+
+import jalview.datamodel.AlignmentI;
+import jalview.datamodel.DBRefSource;
+import jalview.datamodel.GeneLociI;
+import jalview.util.MapList;
+
+import java.io.BufferedReader;
+import java.io.IOException;
+import java.net.MalformedURLException;
+import java.net.URL;
+import java.util.ArrayList;
+import java.util.Collections;
+import java.util.Iterator;
+import java.util.List;
+
+import org.json.simple.JSONArray;
+import org.json.simple.JSONObject;
+import org.json.simple.parser.JSONParser;
+import org.json.simple.parser.ParseException;
+
+public class EnsemblMap extends EnsemblRestClient
+{
+  private static final String MAPPED = "mapped";
+
+  private static final String MAPPINGS = "mappings";
+
+  private static final String CDS = "cds";
+
+  private static final String CDNA = "cdna";
+
+  /**
+   * Default constructor (to use rest.ensembl.org)
+   */
+  public EnsemblMap()
+  {
+    super();
+  }
+
+  /**
+   * Constructor given the target domain to fetch data from
+   * 
+   * @param
+   */
+  public EnsemblMap(String domain)
+  {
+    super(domain);
+  }
+
+  @Override
+  public String getDbName()
+  {
+    return DBRefSource.ENSEMBL;
+  }
+
+  @Override
+  public AlignmentI getSequenceRecords(String queries) throws Exception
+  {
+    return null; // not used
+  }
+
+  /**
+   * Constructs a URL of the format 
+   * http://rest.ensembl.org/map/human/GRCh38/17:45051610..45109016:1/GRCh37?content-type=application/json
+   * 
+   * 
+   * @param species
+   * @param chromosome
+   * @param fromRef
+   * @param toRef
+   * @param startPos
+   * @param endPos
+   * @return
+   * @throws MalformedURLException
+   */
+  protected URL getAssemblyMapUrl(String species, String chromosome, String fromRef,
+          String toRef, int startPos, int endPos)
+          throws MalformedURLException
+  {
+    /*
+     * start-end might be reverse strand - present forwards to the service
+     */
+    boolean forward = startPos <= endPos;
+    int start = forward ? startPos : endPos;
+    int end = forward ? endPos : startPos;
+    String strand = forward ? "1" : "-1";
+    String url = String.format(
+            "%s/map/%s/%s/%s:%d..%d:%s/%s?content-type=application/json",
+            getDomain(), species, fromRef, chromosome, start, end, strand,
+            toRef);
+    return new URL(url);
+  }
+
+  @Override
+  protected boolean useGetRequest()
+  {
+    return true;
+  }
+
+  @Override
+  protected String getRequestMimeType(boolean multipleIds)
+  {
+    return "application/json";
+  }
+
+  @Override
+  protected String getResponseMimeType()
+  {
+    return "application/json";
+  }
+
+  @Override
+  protected URL getUrl(List ids) throws MalformedURLException
+  {
+    return null; // not used
+  }
+
+  /**
+   * Calls the REST /map service to get the chromosomal coordinates (start/end)
+   * in 'toRef' that corresponding to the (start/end) queryRange in 'fromRef'
+   * 
+   * @param species
+   * @param chromosome
+   * @param fromRef
+   * @param toRef
+   * @param queryRange
+   * @return
+   * @see http://rest.ensemblgenomes.org/documentation/info/assembly_map
+   */
+  public int[] getAssemblyMapping(String species, String chromosome,
+          String fromRef, String toRef, int[] queryRange)
+  {
+    URL url = null;
+    BufferedReader br = null;
+
+    try
+    {
+      url = getAssemblyMapUrl(species, chromosome, fromRef, toRef, queryRange[0],
+              queryRange[1]);
+      br = getHttpResponse(url, null);
+      return (parseAssemblyMappingResponse(br));
+    } catch (Throwable t)
+    {
+      System.out.println("Error calling " + url + ": " + t.getMessage());
+      return null;
+    } finally
+    {
+      if (br != null)
+      {
+        try
+        {
+          br.close();
+        } catch (IOException e)
+        {
+          // ignore
+        }
+      }
+    }
+  }
+
+  /**
+   * Parses the JSON response from the /map/<species>/ REST service. The
+   * format is (with some fields omitted)
+   * 
+   * +   *  {"mappings": 
+   *    [{
+   *       "original": {"end":45109016,"start":45051610},
+   *       "mapped"  : {"end":43186384,"start":43128978} 
+   *  }] }
+   * 
+   * 
+   * @param br
+   * @return
+   */
+  protected int[] parseAssemblyMappingResponse(BufferedReader br)
+  {
+    int[] result = null;
+    JSONParser jp = new JSONParser();
+
+    try
+    {
+      JSONObject parsed = (JSONObject) jp.parse(br);
+      JSONArray mappings = (JSONArray) parsed.get(MAPPINGS);
+
+      Iterator rvals = mappings.iterator();
+      while (rvals.hasNext())
+      {
+        // todo check for "mapped"
+        JSONObject val = (JSONObject) rvals.next();
+        JSONObject mapped = (JSONObject) val.get(MAPPED);
+        int start = Integer.parseInt(mapped.get("start").toString());
+        int end = Integer.parseInt(mapped.get("end").toString());
+        String strand = mapped.get("strand").toString();
+        if ("1".equals(strand))
+        {
+          result = new int[] { start, end };
+        }
+        else
+        {
+          result = new int[] { end, start };
+        }
+      }
+    } catch (IOException | ParseException | NumberFormatException e)
+    {
+      // ignore
+    }
+    return result;
+  }
+
+  /**
+   * Calls the REST /map/cds/id service, and returns a DBRefEntry holding the
+   * returned chromosomal coordinates, or returns null if the call fails
+   * 
+   * @param division
+   *          e.g. Ensembl, EnsemblMetazoa
+   * @param accession
+   *          e.g. ENST00000592782, Y55B1AR.1.1
+   * @param start
+   * @param end
+   * @return
+   */
+  public GeneLociI getCdsMapping(String division, String accession,
+          int start, int end)
+  {
+    return getIdMapping(division, accession, start, end, CDS);
+  }
+
+  /**
+   * Calls the REST /map/cdna/id service, and returns a DBRefEntry holding the
+   * returned chromosomal coordinates, or returns null if the call fails
+   * 
+   * @param division
+   *          e.g. Ensembl, EnsemblMetazoa
+   * @param accession
+   *          e.g. ENST00000592782, Y55B1AR.1.1
+   * @param start
+   * @param end
+   * @return
+   */
+  public GeneLociI getCdnaMapping(String division, String accession,
+          int start, int end)
+  {
+    return getIdMapping(division, accession, start, end, CDNA);
+  }
+
+  GeneLociI getIdMapping(String division, String accession, int start,
+          int end, String cdsOrCdna)
+  {
+    URL url = null;
+    BufferedReader br = null;
+
+    try
+    {
+      String domain = new EnsemblInfo().getDomain(division);
+      if (domain != null)
+      {
+        url = getIdMapUrl(domain, accession, start, end, cdsOrCdna);
+        br = getHttpResponse(url, null);
+        return (parseIdMappingResponse(br, accession, domain));
+      }
+      return null;
+    } catch (Throwable t)
+    {
+      System.out.println("Error calling " + url + ": " + t.getMessage());
+      return null;
+    } finally
+    {
+      if (br != null)
+      {
+        try
+        {
+          br.close();
+        } catch (IOException e)
+        {
+          // ignore
+        }
+      }
+    }
+  }
+
+  /**
+   * Constructs a URL to the /map/cds/ or /map/cdna/ REST service. The
+   * REST call is to either ensembl or ensemblgenomes, as determined from the
+   * division, e.g. Ensembl or EnsemblProtists.
+   * 
+   * @param domain
+   * @param accession
+   * @param start
+   * @param end
+   * @param cdsOrCdna
+   * @return
+   * @throws MalformedURLException
+   */
+  URL getIdMapUrl(String domain, String accession, int start, int end,
+          String cdsOrCdna) throws MalformedURLException
+  {
+    String url = String
+            .format("%s/map/%s/%s/%d..%d?include_original_region=1&content-type=application/json",
+                    domain, cdsOrCdna, accession, start, end);
+    return new URL(url);
+  }
+
+  /**
+   * Parses the JSON response from the /map/cds/ or /map/cdna REST service. The
+   * format is
+   * 
+   * +   * {"mappings":
+   *   [
+   *    {"assembly_name":"TAIR10","end":2501311,"seq_region_name":"1","gap":0,
+   *     "strand":-1,"coord_system":"chromosome","rank":0,"start":2501114},
+   *    {"assembly_name":"TAIR10","end":2500815,"seq_region_name":"1","gap":0,
+   *     "strand":-1,"coord_system":"chromosome","rank":0,"start":2500714}
+   *   ]
+   * }
+   * 
+   * 
+   * @param br
+   * @param accession
+   * @param domain
+   * @return
+   */
+  GeneLociI parseIdMappingResponse(BufferedReader br, String accession,
+          String domain)
+  {
+    JSONParser jp = new JSONParser();
+
+    try
+    {
+      JSONObject parsed = (JSONObject) jp.parse(br);
+      JSONArray mappings = (JSONArray) parsed.get(MAPPINGS);
+
+      Iterator rvals = mappings.iterator();
+      String assembly = null;
+      String chromosome = null;
+      int fromEnd = 0;
+      List regions = new ArrayList<>();
+
+      while (rvals.hasNext())
+      {
+        JSONObject val = (JSONObject) rvals.next();
+        JSONObject original = (JSONObject) val.get("original");
+        fromEnd = Integer.parseInt(original.get("end").toString());
+
+        JSONObject mapped = (JSONObject) val.get(MAPPED);
+        int start = Integer.parseInt(mapped.get("start").toString());
+        int end = Integer.parseInt(mapped.get("end").toString());
+        String ass = mapped.get("assembly_name").toString();
+        if (assembly != null && !assembly.equals(ass))
+        {
+          System.err
+                  .println("EnsemblMap found multiple assemblies - can't resolve");
+          return null;
+        }
+        assembly = ass;
+        String chr = mapped.get("seq_region_name").toString();
+        if (chromosome != null && !chromosome.equals(chr))
+        {
+          System.err
+                  .println("EnsemblMap found multiple chromosomes - can't resolve");
+          return null;
+        }
+        chromosome = chr;
+        String strand = mapped.get("strand").toString();
+        if ("-1".equals(strand))
+        {
+          regions.add(new int[] { end, start });
+        }
+        else
+        {
+          regions.add(new int[] { start, end });
+        }
+      }
+
+      /*
+       * processed all mapped regions on chromosome, assemble the result,
+       * having first fetched the species id for the accession
+       */
+      final String species = new EnsemblLookup(domain)
+              .getSpecies(accession);
+      final String as = assembly;
+      final String chr = chromosome;
+      List fromRange = Collections.singletonList(new int[] { 1,
+          fromEnd });
+      final MapList map = new MapList(fromRange, regions, 1, 1);
+      return new GeneLociI()
+      {
+
+        @Override
+        public String getSpeciesId()
+        {
+          return species == null ? "" : species;
+        }
+
+        @Override
+        public String getAssemblyId()
+        {
+          return as;
+        }
+
+        @Override
+        public String getChromosomeId()
+        {
+          return chr;
+        }
+
+        @Override
+        public MapList getMap()
+        {
+          return map;
+        }
+      };
+    } catch (IOException | ParseException | NumberFormatException e)
+    {
+      // ignore
+    }
+
+    return null;
+  }
+
+}
diff --git a/src/jalview/ext/ensembl/EnsemblRestClient.java b/src/jalview/ext/ensembl/EnsemblRestClient.java
index b1bc8e5..e3d1215 100644
--- a/src/jalview/ext/ensembl/EnsemblRestClient.java
+++ b/src/jalview/ext/ensembl/EnsemblRestClient.java
@@ -72,7 +72,7 @@ abstract class EnsemblRestClient extends EnsemblSequenceFetcher
 
   private static final String REST_CHANGE_LOG = "https://github.com/Ensembl/ensembl-rest/wiki/Change-log";
 
-  private static Map domainData;
+  private static Map domainData;
 
   // @see https://github.com/Ensembl/ensembl-rest/wiki/Output-formats
   private static final String PING_URL = "http://rest.ensembl.org/info/ping.json";
@@ -87,8 +87,8 @@ abstract class EnsemblRestClient extends EnsemblSequenceFetcher
   {
     domainData = new HashMap<>();
     domainData.put(ENSEMBL_REST,
-            new EnsemblInfo(ENSEMBL_REST, LATEST_ENSEMBL_REST_VERSION));
-    domainData.put(ENSEMBL_GENOMES_REST, new EnsemblInfo(
+            new EnsemblData(ENSEMBL_REST, LATEST_ENSEMBL_REST_VERSION));
+    domainData.put(ENSEMBL_GENOMES_REST, new EnsemblData(
             ENSEMBL_GENOMES_REST, LATEST_ENSEMBLGENOMES_REST_VERSION));
   }
 
@@ -381,7 +381,7 @@ abstract class EnsemblRestClient extends EnsemblSequenceFetcher
    */
   protected boolean isEnsemblAvailable()
   {
-    EnsemblInfo info = domainData.get(getDomain());
+    EnsemblData info = domainData.get(getDomain());
 
     long now = System.currentTimeMillis();
 
@@ -455,7 +455,7 @@ abstract class EnsemblRestClient extends EnsemblSequenceFetcher
    */
   private void checkEnsemblRestVersion()
   {
-    EnsemblInfo info = domainData.get(getDomain());
+    EnsemblData info = domainData.get(getDomain());
 
     JSONParser jp = new JSONParser();
     URL url = null;
diff --git a/src/jalview/ext/ensembl/EnsemblSeqProxy.java b/src/jalview/ext/ensembl/EnsemblSeqProxy.java
index b2ebb1a..9229379 100644
--- a/src/jalview/ext/ensembl/EnsemblSeqProxy.java
+++ b/src/jalview/ext/ensembl/EnsemblSeqProxy.java
@@ -34,6 +34,7 @@ import jalview.datamodel.features.SequenceFeatures;
 import jalview.exceptions.JalviewException;
 import jalview.io.FastaFile;
 import jalview.io.FileParse;
+import jalview.io.gff.Gff3Helper;
 import jalview.io.gff.SequenceOntologyFactory;
 import jalview.io.gff.SequenceOntologyI;
 import jalview.util.Comparison;
@@ -57,8 +58,6 @@ import java.util.List;
  */
 public abstract class EnsemblSeqProxy extends EnsemblRestClient
 {
-  private static final String ALLELES = "alleles";
-
   protected static final String NAME = "Name";
 
   protected static final String DESCRIPTION = "description";
@@ -708,7 +707,7 @@ public abstract class EnsemblSeqProxy extends EnsemblRestClient
    */
   static void reverseComplementAlleles(SequenceFeature sf)
   {
-    final String alleles = (String) sf.getValue(ALLELES);
+    final String alleles = (String) sf.getValue(Gff3Helper.ALLELES);
     if (alleles == null)
     {
       return;
@@ -719,7 +718,7 @@ public abstract class EnsemblSeqProxy extends EnsemblRestClient
       reverseComplementAllele(complement, allele);
     }
     String comp = complement.toString();
-    sf.setValue(ALLELES, comp);
+    sf.setValue(Gff3Helper.ALLELES, comp);
     sf.setDescription(comp);
 
     /*
@@ -729,7 +728,8 @@ public abstract class EnsemblSeqProxy extends EnsemblRestClient
     String atts = sf.getAttributes();
     if (atts != null)
     {
-      atts = atts.replace(ALLELES + "=" + alleles, ALLELES + "=" + comp);
+      atts = atts.replace(Gff3Helper.ALLELES + "=" + alleles,
+              Gff3Helper.ALLELES + "=" + comp);
       sf.setAttributes(atts);
     }
   }
diff --git a/src/jalview/ext/ensembl/EnsemblSequenceFetcher.java b/src/jalview/ext/ensembl/EnsemblSequenceFetcher.java
index c4abb20..cfb3c6d 100644
--- a/src/jalview/ext/ensembl/EnsemblSequenceFetcher.java
+++ b/src/jalview/ext/ensembl/EnsemblSequenceFetcher.java
@@ -53,7 +53,7 @@ abstract class EnsemblSequenceFetcher extends DbSourceProxyImpl
 
   protected static final String PARENT = "Parent";
 
-  protected static final String ID = "id";
+  protected static final String JSON_ID = "id";
 
   protected static final String OBJECT_TYPE = "object_type";
 
diff --git a/src/jalview/ext/ensembl/EnsemblSymbol.java b/src/jalview/ext/ensembl/EnsemblSymbol.java
index e3b6c93..40d6cad 100644
--- a/src/jalview/ext/ensembl/EnsemblSymbol.java
+++ b/src/jalview/ext/ensembl/EnsemblSymbol.java
@@ -75,7 +75,7 @@ public class EnsemblSymbol extends EnsemblXref
       while (rvals.hasNext())
       {
         JSONObject val = (JSONObject) rvals.next();
-        String id = val.get(ID).toString();
+        String id = val.get(JSON_ID).toString();
         String type = val.get(TYPE).toString();
         if (id != null && GENE.equals(type))
         {
@@ -150,7 +150,6 @@ public class EnsemblSymbol extends EnsemblXref
             if (br != null)
             {
               String geneId = parseSymbolResponse(br);
-              System.out.println(url + " returned " + geneId);
               if (geneId != null && !result.contains(geneId))
               {
                 result.add(geneId);
diff --git a/src/jalview/ext/htsjdk/HtsContigDb.java b/src/jalview/ext/htsjdk/HtsContigDb.java
index 37ce625..73d1674 100644
--- a/src/jalview/ext/htsjdk/HtsContigDb.java
+++ b/src/jalview/ext/htsjdk/HtsContigDb.java
@@ -20,17 +20,13 @@
  */
 package jalview.ext.htsjdk;
 
-import htsjdk.samtools.SAMSequenceDictionary;
-import htsjdk.samtools.SAMSequenceRecord;
-import htsjdk.samtools.reference.ReferenceSequence;
-import htsjdk.samtools.reference.ReferenceSequenceFile;
-import htsjdk.samtools.reference.ReferenceSequenceFileFactory;
-import htsjdk.samtools.util.StringUtil;
 import jalview.datamodel.Sequence;
 import jalview.datamodel.SequenceI;
 
 import java.io.File;
+import java.io.IOException;
 import java.math.BigInteger;
+import java.nio.file.Path;
 import java.security.MessageDigest;
 import java.security.NoSuchAlgorithmException;
 import java.util.ArrayList;
@@ -38,6 +34,15 @@ import java.util.HashSet;
 import java.util.List;
 import java.util.Set;
 
+import htsjdk.samtools.SAMException;
+import htsjdk.samtools.SAMSequenceDictionary;
+import htsjdk.samtools.SAMSequenceRecord;
+import htsjdk.samtools.reference.FastaSequenceIndexCreator;
+import htsjdk.samtools.reference.ReferenceSequence;
+import htsjdk.samtools.reference.ReferenceSequenceFile;
+import htsjdk.samtools.reference.ReferenceSequenceFileFactory;
+import htsjdk.samtools.util.StringUtil;
+
 /**
  * a source of sequence data accessed via the HTSJDK
  * 
@@ -46,14 +51,25 @@ import java.util.Set;
  */
 public class HtsContigDb
 {
-
   private String name;
 
   private File dbLocation;
 
   private htsjdk.samtools.reference.ReferenceSequenceFile refFile = null;
 
-  public HtsContigDb(String name, File descriptor) throws Exception
+  public static void createFastaSequenceIndex(Path path, boolean overwrite)
+          throws IOException
+  {
+    try
+    {
+      FastaSequenceIndexCreator.create(path, overwrite);
+    } catch (SAMException e)
+    {
+      throw new IOException(e.getMessage());
+    }
+  }
+
+  public HtsContigDb(String name, File descriptor)
   {
     if (descriptor.isFile())
     {
@@ -63,7 +79,21 @@ public class HtsContigDb
     initSource();
   }
 
-  private void initSource() throws Exception
+  public void close()
+  {
+    if (refFile != null)
+    {
+      try
+      {
+        refFile.close();
+      } catch (IOException e)
+      {
+        // ignore
+      }
+    }
+  }
+
+  private void initSource()
   {
     if (refFile != null)
     {
@@ -142,8 +172,8 @@ public class HtsContigDb
     final ReferenceSequenceFile refSeqFile = ReferenceSequenceFileFactory
             .getReferenceSequenceFile(f, truncate);
     ReferenceSequence refSeq;
-    List ret = new ArrayList();
-    Set sequenceNames = new HashSet();
+    List ret = new ArrayList<>();
+    Set sequenceNames = new HashSet<>();
     for (int numSequences = 0; (refSeq = refSeqFile
             .nextSequence()) != null; ++numSequences)
     {
@@ -220,14 +250,29 @@ public class HtsContigDb
 
   // ///// end of hts bits.
 
-  SequenceI getSequenceProxy(String id)
+  /**
+   * Reads the contig with the given id and returns as a Jalview SequenceI object.
+   * Note the database must be indexed for this operation to succeed.
+   * 
+   * @param id
+   * @return
+   */
+  public SequenceI getSequenceProxy(String id)
   {
-    if (!isValid())
+    if (!isValid() || !refFile.isIndexed())
     {
+      System.err.println(
+              "Cannot read contig as file is invalid or not indexed");
       return null;
     }
 
     ReferenceSequence sseq = refFile.getSequence(id);
     return new Sequence(sseq.getName(), new String(sseq.getBases()));
   }
+
+  public boolean isIndexed()
+  {
+    return refFile != null && refFile.isIndexed();
+  }
+
 }
diff --git a/src/jalview/ext/htsjdk/VCFReader.java b/src/jalview/ext/htsjdk/VCFReader.java
new file mode 100644
index 0000000..14c057f
--- /dev/null
+++ b/src/jalview/ext/htsjdk/VCFReader.java
@@ -0,0 +1,214 @@
+package jalview.ext.htsjdk;
+
+import htsjdk.samtools.util.CloseableIterator;
+import htsjdk.variant.variantcontext.VariantContext;
+import htsjdk.variant.vcf.VCFFileReader;
+import htsjdk.variant.vcf.VCFHeader;
+
+import java.io.Closeable;
+import java.io.File;
+import java.io.IOException;
+
+/**
+ * A thin wrapper for htsjdk classes to read either plain, or compressed, or
+ * compressed and indexed VCF files
+ */
+public class VCFReader implements Closeable, Iterable
+{
+  private static final String GZ = "gz";
+
+  private static final String TBI_EXTENSION = ".tbi";
+
+  private boolean indexed;
+
+  private VCFFileReader reader;
+
+  /**
+   * Constructor given a raw or compressed VCF file or a (tabix) index file
+   * 
+   * For now, file type is inferred from its suffix: .gz or .bgz for compressed
+   * data, .tbi for an index file, anything else is assumed to be plain text
+   * VCF.
+   * 
+   * @param f
+   * @throws IOException
+   */
+  public VCFReader(String filePath) throws IOException
+  {
+    if (filePath.endsWith(GZ))
+    {
+      if (new File(filePath + TBI_EXTENSION).exists())
+      {
+        indexed = true;
+      }
+    }
+    else if (filePath.endsWith(TBI_EXTENSION))
+    {
+      indexed = true;
+      filePath = filePath.substring(0, filePath.length() - 4);
+    }
+
+    reader = new VCFFileReader(new File(filePath), indexed);
+  }
+
+  @Override
+  public void close() throws IOException
+  {
+    if (reader != null)
+    {
+      reader.close();
+    }
+  }
+
+  /**
+   * Returns an iterator over VCF variants in the file. The client should call
+   * close() on the iterator when finished with it.
+   */
+  @Override
+  public CloseableIterator iterator()
+  {
+    return reader == null ? null : reader.iterator();
+  }
+
+  /**
+   * Queries for records overlapping the region specified. Note that this method
+   * is performant if the VCF file is indexed, and may be very slow if it is
+   * not.
+   * 

+   * Client code should call close() on the iterator when finished with it.
+   * 
+   * @param chrom
+   *          the chromosome to query
+   * @param start
+   *          query interval start
+   * @param end
+   *          query interval end
+   * @return
+   */
+  public CloseableIterator query(final String chrom,
+          final int start, final int end)
+  {
+   if (reader == null) {
+     return null;
+   }
+    if (indexed)
+    {
+      return reader.query(chrom, start, end);
+    }
+    else
+    {
+      return queryUnindexed(chrom, start, end);
+    }
+  }
+
+  /**
+   * Returns an iterator over variant records read from a flat file which
+   * overlap the specified chromosomal positions. Call close() on the iterator
+   * when finished with it!
+   * 
+   * @param chrom
+   * @param start
+   * @param end
+   * @return
+   */
+  protected CloseableIterator queryUnindexed(
+          final String chrom, final int start, final int end)
+  {
+    final CloseableIterator it = reader.iterator();
+    
+    return new CloseableIterator()
+    {
+      boolean atEnd = false;
+
+      // prime look-ahead buffer with next matching record
+      private VariantContext next = findNext();
+
+      private VariantContext findNext()
+      {
+        if (atEnd)
+        {
+          return null;
+        }
+        VariantContext variant = null;
+        while (it.hasNext())
+        {
+          variant = it.next();
+          int vstart = variant.getStart();
+
+          if (vstart > end)
+          {
+            atEnd = true;
+            close();
+            return null;
+          }
+
+          int vend = variant.getEnd();
+          // todo what is the undeprecated way to get
+          // the chromosome for the variant?
+          if (chrom.equals(variant.getChr()) && (vstart <= end)
+                  && (vend >= start))
+          {
+            return variant;
+          }
+        }
+        return null;
+      }
+
+      @Override
+      public boolean hasNext()
+      {
+        boolean hasNext = !atEnd && (next != null);
+        if (!hasNext)
+        {
+          close();
+        }
+        return hasNext;
+      }
+
+      @Override
+      public VariantContext next()
+      {
+        /*
+         * return the next match, and then re-prime
+         * it with the following one (if any)
+         */
+        VariantContext temp = next;
+        next = findNext();
+        return temp;
+      }
+
+      @Override
+      public void remove()
+      {
+        // not implemented
+      }
+
+      @Override
+      public void close()
+      {
+        it.close();
+      }
+    };
+  }
+
+  /**
+   * Returns an object that models the VCF file headers
+   * 
+   * @return
+   */
+  public VCFHeader getFileHeader()
+  {
+    return reader == null ? null : reader.getFileHeader();
+  }
+
+  /**
+   * Answers true if we are processing a tab-indexed VCF file, false if it is a
+   * plain text (uncompressed) file.
+   * 
+   * @return
+   */
+  public boolean isIndex()
+  {
+    return indexed;
+  }
+}
diff --git a/src/jalview/gui/AlignFrame.java b/src/jalview/gui/AlignFrame.java
index 298688b..4c9360e 100644
--- a/src/jalview/gui/AlignFrame.java
+++ b/src/jalview/gui/AlignFrame.java
@@ -81,6 +81,7 @@ import jalview.io.JnetAnnotationMaker;
 import jalview.io.NewickFile;
 import jalview.io.ScoreMatrixFile;
 import jalview.io.TCoffeeScoreFile;
+import jalview.io.vcf.VCFLoader;
 import jalview.jbgui.GAlignFrame;
 import jalview.schemes.ColourSchemeI;
 import jalview.schemes.ColourSchemes;
@@ -839,6 +840,7 @@ public class AlignFrame extends GAlignFrame implements DropTargetListener,
     AlignmentI al = getViewport().getAlignment();
     boolean nucleotide = al.isNucleotide();
 
+    loadVcf.setVisible(nucleotide);
     showTranslation.setVisible(nucleotide);
     showReverse.setVisible(nucleotide);
     showReverseComplement.setVisible(nucleotide);
@@ -1390,13 +1392,13 @@ public class AlignFrame extends GAlignFrame implements DropTargetListener,
   @Override
   public void exportFeatures_actionPerformed(ActionEvent e)
   {
-    new AnnotationExporter().exportFeatures(alignPanel);
+    new AnnotationExporter(alignPanel).exportFeatures();
   }
 
   @Override
   public void exportAnnotations_actionPerformed(ActionEvent e)
   {
-    new AnnotationExporter().exportAnnotations(alignPanel);
+    new AnnotationExporter(alignPanel).exportAnnotations();
   }
 
   @Override
@@ -4258,7 +4260,7 @@ public class AlignFrame extends GAlignFrame implements DropTargetListener,
   protected void showProductsFor(final SequenceI[] sel, final boolean _odna,
           final String source)
   {
-    new Thread(CrossRefAction.showProductsFor(sel, _odna, source, this))
+    new Thread(CrossRefAction.getHandlerFor(sel, _odna, source, this))
             .start();
   }
 
@@ -5585,6 +5587,27 @@ public class AlignFrame extends GAlignFrame implements DropTargetListener,
       new CalculationChooser(AlignFrame.this);
     }
   }
+
+  @Override
+  protected void loadVcf_actionPerformed()
+  {
+    JalviewFileChooser chooser = new JalviewFileChooser(
+            Cache.getProperty("LAST_DIRECTORY"));
+    chooser.setFileView(new JalviewFileView());
+    chooser.setDialogTitle(MessageManager.getString("label.load_vcf_file"));
+    chooser.setToolTipText(MessageManager.getString("label.load_vcf_file"));
+
+    int value = chooser.showOpenDialog(null);
+
+    if (value == JalviewFileChooser.APPROVE_OPTION)
+    {
+      String choice = chooser.getSelectedFile().getPath();
+      Cache.setProperty("LAST_DIRECTORY", choice);
+      SequenceI[] seqs = viewport.getAlignment().getSequencesArray();
+      new VCFLoader(choice).loadVCF(seqs, this);
+    }
+
+  }
 }
 
 class PrintThread extends Thread
diff --git a/src/jalview/gui/AnnotationExporter.java b/src/jalview/gui/AnnotationExporter.java
index a619997..6fefbd0 100644
--- a/src/jalview/gui/AnnotationExporter.java
+++ b/src/jalview/gui/AnnotationExporter.java
@@ -21,8 +21,10 @@
 package jalview.gui;
 
 import jalview.api.FeatureColourI;
+import jalview.bin.Cache;
 import jalview.datamodel.AlignmentAnnotation;
 import jalview.datamodel.SequenceI;
+import jalview.datamodel.features.FeatureMatcherSetI;
 import jalview.io.AnnotationFile;
 import jalview.io.FeaturesFile;
 import jalview.io.JalviewFileChooser;
@@ -34,6 +36,8 @@ import java.awt.Color;
 import java.awt.FlowLayout;
 import java.awt.event.ActionEvent;
 import java.awt.event.ActionListener;
+import java.io.FileWriter;
+import java.io.PrintWriter;
 import java.util.List;
 import java.util.Map;
 
@@ -57,18 +61,22 @@ import javax.swing.SwingConstants;
  */
 public class AnnotationExporter extends JPanel
 {
-  JInternalFrame frame;
+  private JInternalFrame frame;
 
-  AlignmentPanel ap;
+  private AlignmentPanel ap;
 
-  boolean features = true;
+  /*
+   * true if exporting features, false if exporting annotations
+   */
+  private boolean exportFeatures = true;
 
   private AlignmentAnnotation[] annotations;
 
   private boolean wholeView;
 
-  public AnnotationExporter()
+  public AnnotationExporter(AlignmentPanel panel)
   {
+    this.ap = panel;
     try
     {
       jbInit();
@@ -84,47 +92,54 @@ public class AnnotationExporter extends JPanel
             frame.getPreferredSize().height);
   }
 
-  public void exportFeatures(AlignmentPanel ap)
+  /**
+   * Configures the diglog for options to export visible features
+   */
+  public void exportFeatures()
   {
-    this.ap = ap;
-    features = true;
+    exportFeatures = true;
     CSVFormat.setVisible(false);
     frame.setTitle(MessageManager.getString("label.export_features"));
   }
 
-  public void exportAnnotations(AlignmentPanel ap)
+  /**
+   * Configures the dialog for options to export all visible annotations
+   */
+  public void exportAnnotations()
   {
-    this.ap = ap;
-    annotations = ap.av.isShowAnnotation() ? null
-            : ap.av.getAlignment().getAlignmentAnnotation();
-    wholeView = true;
-    startExportAnnotation();
+    boolean showAnnotation = ap.av.isShowAnnotation();
+    exportAnnotation(showAnnotation ? null
+            : ap.av.getAlignment().getAlignmentAnnotation(), true);
   }
 
-  public void exportAnnotations(AlignmentPanel alp,
-          AlignmentAnnotation[] toExport)
+  /**
+   * Configures the dialog for options to export the given annotation row
+   * 
+   * @param toExport
+   */
+  public void exportAnnotation(AlignmentAnnotation toExport)
   {
-    ap = alp;
-    annotations = toExport;
-    wholeView = false;
-    startExportAnnotation();
+    exportAnnotation(new AlignmentAnnotation[] { toExport }, false);
   }
 
-  private void startExportAnnotation()
+  private void exportAnnotation(AlignmentAnnotation[] toExport,
+          boolean forWholeView)
   {
-    features = false;
+    wholeView = forWholeView;
+    annotations = toExport;
+    exportFeatures = false;
     GFFFormat.setVisible(false);
     CSVFormat.setVisible(true);
     frame.setTitle(MessageManager.getString("label.export_annotations"));
   }
 
-  public void toFile_actionPerformed(ActionEvent e)
+  private void toFile_actionPerformed()
   {
     JalviewFileChooser chooser = new JalviewFileChooser(
-            jalview.bin.Cache.getProperty("LAST_DIRECTORY"));
+            Cache.getProperty("LAST_DIRECTORY"));
 
     chooser.setFileView(new JalviewFileView());
-    chooser.setDialogTitle(features
+    chooser.setDialogTitle(exportFeatures
             ? MessageManager.getString("label.save_features_to_file")
             : MessageManager.getString("label.save_annotation_to_file"));
     chooser.setToolTipText(MessageManager.getString("action.save"));
@@ -133,13 +148,12 @@ public class AnnotationExporter extends JPanel
 
     if (value == JalviewFileChooser.APPROVE_OPTION)
     {
-      String text = getFileContents();
+      String text = getText();
 
       try
       {
-        java.io.PrintWriter out = new java.io.PrintWriter(
-                new java.io.FileWriter(chooser.getSelectedFile()));
-
+        PrintWriter out = new PrintWriter(
+                new FileWriter(chooser.getSelectedFile()));
         out.print(text);
         out.close();
       } catch (Exception ex)
@@ -148,64 +162,89 @@ public class AnnotationExporter extends JPanel
       }
     }
 
-    close_actionPerformed(null);
+    close_actionPerformed();
+  }
+
+  /**
+   * Answers the text to output for either Features (in GFF or Jalview format) or
+   * Annotations (in CSV or Jalview format)
+   * 
+   * @return
+   */
+  private String getText()
+  {
+    return exportFeatures ? getFeaturesText() : getAnnotationsText();
   }
 
-  private String getFileContents()
+  /**
+   * Returns the text contents for output of annotations in either CSV or Jalview
+   * format
+   * 
+   * @return
+   */
+  private String getAnnotationsText()
   {
-    String text = MessageManager
-            .getString("label.no_features_on_alignment");
-    if (features)
+    String text;
+    if (CSVFormat.isSelected())
     {
-      FeaturesFile formatter = new FeaturesFile();
-      SequenceI[] sequences = ap.av.getAlignment().getSequencesArray();
-      Map featureColours = ap.getFeatureRenderer()
-              .getDisplayedFeatureCols();
-      List featureGroups = ap.getFeatureRenderer()
-              .getDisplayedFeatureGroups();
-      boolean includeNonPositional = ap.av.isShowNPFeats();
-      if (GFFFormat.isSelected())
-      {
-        text = formatter.printGffFormat(sequences, featureColours,
-                featureGroups, includeNonPositional);
-      }
-      else
-      {
-        text = formatter.printJalviewFormat(sequences, featureColours,
-                featureGroups, includeNonPositional);
-      }
+      text = new AnnotationFile().printCSVAnnotations(annotations);
     }
     else
     {
-      if (CSVFormat.isSelected())
+      if (wholeView)
       {
-        text = new AnnotationFile().printCSVAnnotations(annotations);
+        text = new AnnotationFile().printAnnotationsForView(ap.av);
       }
       else
       {
-        if (wholeView)
-        {
-          text = new AnnotationFile().printAnnotationsForView(ap.av);
-        }
-        else
-        {
-          text = new AnnotationFile().printAnnotations(annotations, null,
-                  null);
-        }
+        text = new AnnotationFile().printAnnotations(annotations, null,
+                null);
       }
     }
     return text;
   }
 
-  public void toTextbox_actionPerformed(ActionEvent e)
+  /**
+   * Returns the text contents for output of features in either GFF or Jalview
+   * format
+   * 
+   * @return
+   */
+  private String getFeaturesText()
+  {
+    String text;
+    SequenceI[] sequences = ap.av.getAlignment().getSequencesArray();
+    Map featureColours = ap.getFeatureRenderer()
+            .getDisplayedFeatureCols();
+    Map featureFilters = ap.getFeatureRenderer()
+            .getFeatureFilters();
+    List featureGroups = ap.getFeatureRenderer()
+            .getDisplayedFeatureGroups();
+    boolean includeNonPositional = ap.av.isShowNPFeats();
+
+    FeaturesFile formatter = new FeaturesFile();
+    if (GFFFormat.isSelected())
+    {
+      text = formatter.printGffFormat(sequences, featureColours,
+              featureGroups, includeNonPositional);
+    }
+    else
+    {
+      text = formatter.printJalviewFormat(sequences, featureColours,
+              featureFilters, featureGroups, includeNonPositional);
+    }
+    return text;
+  }
+
+  private void toTextbox_actionPerformed()
   {
     CutAndPasteTransfer cap = new CutAndPasteTransfer();
 
     try
     {
-      String text = getFileContents();
+      String text = getText();
       cap.setText(text);
-      Desktop.addInternalFrame(cap, (features ? MessageManager
+      Desktop.addInternalFrame(cap, (exportFeatures ? MessageManager
               .formatMessage("label.features_for_params", new String[]
               { ap.alignFrame.getTitle() })
               : MessageManager.formatMessage("label.annotations_for_params",
@@ -214,7 +253,7 @@ public class AnnotationExporter extends JPanel
               600, 500);
     } catch (OutOfMemoryError oom)
     {
-      new OOMWarning((features ? MessageManager.formatMessage(
+      new OOMWarning((exportFeatures ? MessageManager.formatMessage(
               "label.generating_features_for_params", new String[]
               { ap.alignFrame.getTitle() })
               : MessageManager.formatMessage(
@@ -225,10 +264,10 @@ public class AnnotationExporter extends JPanel
       cap.dispose();
     }
 
-    close_actionPerformed(null);
+    close_actionPerformed();
   }
 
-  public void close_actionPerformed(ActionEvent e)
+  private void close_actionPerformed()
   {
     try
     {
@@ -248,7 +287,7 @@ public class AnnotationExporter extends JPanel
       @Override
       public void actionPerformed(ActionEvent e)
       {
-        toFile_actionPerformed(e);
+        toFile_actionPerformed();
       }
     });
     toTextbox.setText(MessageManager.getString("label.to_textbox"));
@@ -257,7 +296,7 @@ public class AnnotationExporter extends JPanel
       @Override
       public void actionPerformed(ActionEvent e)
       {
-        toTextbox_actionPerformed(e);
+        toTextbox_actionPerformed();
       }
     });
     close.setText(MessageManager.getString("action.close"));
@@ -266,7 +305,7 @@ public class AnnotationExporter extends JPanel
       @Override
       public void actionPerformed(ActionEvent e)
       {
-        close_actionPerformed(e);
+        close_actionPerformed();
       }
     });
     jalviewFormat.setOpaque(false);
diff --git a/src/jalview/gui/AnnotationLabels.java b/src/jalview/gui/AnnotationLabels.java
index 77b4ea9..4e181b3 100755
--- a/src/jalview/gui/AnnotationLabels.java
+++ b/src/jalview/gui/AnnotationLabels.java
@@ -290,9 +290,7 @@ public class AnnotationLabels extends JPanel
     }
     else if (evt.getActionCommand().equals(OUTPUT_TEXT))
     {
-      new AnnotationExporter().exportAnnotations(ap,
-              new AlignmentAnnotation[]
-              { aa[selectedRow] });
+      new AnnotationExporter(ap).exportAnnotation(aa[selectedRow]);
     }
     else if (evt.getActionCommand().equals(COPYCONS_SEQ))
     {
diff --git a/src/jalview/gui/AquaInternalFrameManager.java b/src/jalview/gui/AquaInternalFrameManager.java
index ea809eb..829135b 100644
--- a/src/jalview/gui/AquaInternalFrameManager.java
+++ b/src/jalview/gui/AquaInternalFrameManager.java
@@ -60,7 +60,6 @@ import javax.swing.JInternalFrame;
  * around to the bottom of the window stack (as the original implementation
  * does)
  * 
- * @see com.sun.java.swing.plaf.windows.WindowsDesktopManager
  */
 public class AquaInternalFrameManager extends DefaultDesktopManager
 {
diff --git a/src/jalview/gui/CalculationChooser.java b/src/jalview/gui/CalculationChooser.java
index e403dba..f674c7e 100644
--- a/src/jalview/gui/CalculationChooser.java
+++ b/src/jalview/gui/CalculationChooser.java
@@ -169,8 +169,8 @@ public class CalculationChooser extends JPanel
     JPanel treePanel = new JPanel(new FlowLayout(FlowLayout.LEFT));
     treePanel.setOpaque(false);
 
-    treePanel.setBorder(BorderFactory
-            .createTitledBorder(MessageManager.getString("label.tree")));
+    JvSwingUtils.createTitledBorder(treePanel,
+            MessageManager.getString("label.tree"), true);
 
     // then copy the inset dimensions for the border-less PCA panel
     JPanel pcaBorderless = new JPanel(new FlowLayout(FlowLayout.LEFT));
diff --git a/src/jalview/gui/CrossRefAction.java b/src/jalview/gui/CrossRefAction.java
index 2d1dfd4..85f2498 100644
--- a/src/jalview/gui/CrossRefAction.java
+++ b/src/jalview/gui/CrossRefAction.java
@@ -27,17 +27,25 @@ import jalview.api.FeatureSettingsModelI;
 import jalview.bin.Cache;
 import jalview.datamodel.Alignment;
 import jalview.datamodel.AlignmentI;
+import jalview.datamodel.DBRefEntry;
 import jalview.datamodel.DBRefSource;
+import jalview.datamodel.GeneLociI;
 import jalview.datamodel.SequenceI;
+import jalview.ext.ensembl.EnsemblInfo;
+import jalview.ext.ensembl.EnsemblMap;
 import jalview.io.gff.SequenceOntologyI;
 import jalview.structure.StructureSelectionManager;
+import jalview.util.DBRefUtils;
+import jalview.util.MapList;
+import jalview.util.MappingUtils;
 import jalview.util.MessageManager;
 import jalview.ws.SequenceFetcher;
 
 import java.util.ArrayList;
+import java.util.HashMap;
 import java.util.List;
-
-import javax.swing.JOptionPane;
+import java.util.Map;
+import java.util.Set;
 
 /**
  * Factory constructor and runnable for discovering and displaying
@@ -52,13 +60,13 @@ public class CrossRefAction implements Runnable
 
   private SequenceI[] sel;
 
-  private boolean _odna;
+  private final boolean _odna;
 
   private String source;
 
-  List xrefViews = new ArrayList();
+  List xrefViews = new ArrayList<>();
 
-  public List getXrefViews()
+  List getXrefViews()
   {
     return xrefViews;
   }
@@ -90,6 +98,13 @@ public class CrossRefAction implements Runnable
       {
         return;
       }
+
+      /*
+       * try to look up chromosomal coordinates for nucleotide
+       * sequences (if not already retrieved)
+       */
+      findGeneLoci(xrefs.getSequences());
+
       /*
        * get display scheme (if any) to apply to features
        */
@@ -113,75 +128,14 @@ public class CrossRefAction implements Runnable
 
       if (Cache.getDefault(Preferences.ENABLE_SPLIT_FRAME, true))
       {
-        boolean copyAlignmentIsAligned = false;
-        if (dna)
-        {
-          copyAlignment = AlignmentUtils.makeCdsAlignment(sel, dataset,
-                  xrefsAlignment.getSequencesArray());
-          if (copyAlignment.getHeight() == 0)
-          {
-            JvOptionPane.showMessageDialog(alignFrame,
-                    MessageManager.getString("label.cant_map_cds"),
-                    MessageManager.getString("label.operation_failed"),
-                    JvOptionPane.OK_OPTION);
-            System.err.println("Failed to make CDS alignment");
-          }
-
-          /*
-           * pending getting Embl transcripts to 'align', 
-           * we are only doing this for Ensembl
-           */
-          // TODO proper criteria for 'can align as cdna'
-          if (DBRefSource.ENSEMBL.equalsIgnoreCase(source)
-                  || AlignmentUtils.looksLikeEnsembl(alignment))
-          {
-            copyAlignment.alignAs(alignment);
-            copyAlignmentIsAligned = true;
-          }
-        }
-        else
+        copyAlignment = copyAlignmentForSplitFrame(alignment, dataset, dna,
+                xrefs, xrefsAlignment);
+        if (copyAlignment == null)
         {
-          copyAlignment = AlignmentUtils.makeCopyAlignment(sel,
-                  xrefs.getSequencesArray(), dataset);
-        }
-        copyAlignment
-                .setGapCharacter(alignFrame.viewport.getGapCharacter());
-
-        StructureSelectionManager ssm = StructureSelectionManager
-                .getStructureSelectionManager(Desktop.instance);
-
-        /*
-         * register any new mappings for sequence mouseover etc
-         * (will not duplicate any previously registered mappings)
-         */
-        ssm.registerMappings(dataset.getCodonFrames());
-
-        if (copyAlignment.getHeight() <= 0)
-        {
-          System.err.println(
-                  "No Sequences generated for xRef type " + source);
-          return;
-        }
-        /*
-         * align protein to dna
-         */
-        if (dna && copyAlignmentIsAligned)
-        {
-          xrefsAlignment.alignAs(copyAlignment);
-        }
-        else
-        {
-          /*
-           * align cdna to protein - currently only if 
-           * fetching and aligning Ensembl transcripts!
-           */
-          // TODO: generalise for other sources of locus/transcript/cds data
-          if (dna && DBRefSource.ENSEMBL.equalsIgnoreCase(source))
-          {
-            copyAlignment.alignAs(xrefsAlignment);
-          }
+          return; // failed
         }
       }
+
       /*
        * build AlignFrame(s) according to available alignment data
        */
@@ -207,6 +161,7 @@ public class CrossRefAction implements Runnable
         xrefViews.add(newFrame.alignPanel);
         return; // via finally clause
       }
+
       AlignFrame copyThis = new AlignFrame(copyAlignment,
               AlignFrame.DEFAULT_WIDTH, AlignFrame.DEFAULT_HEIGHT);
       copyThis.setTitle(alignFrame.getTitle());
@@ -221,10 +176,14 @@ public class CrossRefAction implements Runnable
       /*
        * copy feature rendering settings to split frame
        */
-      newFrame.alignPanel.getSeqPanel().seqCanvas.getFeatureRenderer()
-              .transferSettings(myFeatureStyling);
-      copyThis.alignPanel.getSeqPanel().seqCanvas.getFeatureRenderer()
-              .transferSettings(myFeatureStyling);
+      FeatureRenderer fr1 = newFrame.alignPanel.getSeqPanel().seqCanvas
+              .getFeatureRenderer();
+      fr1.transferSettings(myFeatureStyling);
+      fr1.findAllFeatures(true);
+      FeatureRenderer fr2 = copyThis.alignPanel.getSeqPanel().seqCanvas
+              .getFeatureRenderer();
+      fr2.transferSettings(myFeatureStyling);
+      fr2.findAllFeatures(true);
 
       /*
        * apply 'database source' feature configuration
@@ -263,6 +222,260 @@ public class CrossRefAction implements Runnable
   }
 
   /**
+   * Tries to add chromosomal coordinates to any nucleotide sequence which does
+   * not already have them. Coordinates are retrieved from Ensembl given an
+   * Ensembl identifier, either on the sequence itself or on a peptide sequence
+   * it has a reference to.
+   * 
+   * 
+   * Example (human):
+   * - fetch EMBLCDS cross-references for Uniprot entry P30419
+   * - the EMBL sequences do not have xrefs to Ensembl
+   * - the Uniprot entry has xrefs to 
+   *    ENSP00000258960, ENSP00000468424, ENST00000258960, ENST00000592782
+   * - either of the transcript ids can be used to retrieve gene loci e.g.
+   *    http://rest.ensembl.org/map/cds/ENST00000592782/1..100000
+   * Example (invertebrate):
+   * - fetch EMBLCDS cross-references for Uniprot entry Q43517 (FER1_SOLLC)
+   * - the Uniprot entry has an xref to ENSEMBLPLANTS Solyc10g044520.1.1
+   * - can retrieve gene loci with
+   *    http://rest.ensemblgenomes.org/map/cds/Solyc10g044520.1.1/1..100000
+   * 
+   * 
+   * @param sequences
+   */
+  public static void findGeneLoci(List sequences)
+  {
+    Map retrievedLoci = new HashMap<>();
+    for (SequenceI seq : sequences)
+    {
+      findGeneLoci(seq, retrievedLoci);
+    }
+  }
+
+  /**
+   * Tres to find chromosomal coordinates for the sequence, by searching its
+   * direct and indirect cross-references for Ensembl. If the loci have already
+   * been retrieved, just reads them out of the map of retrievedLoci; this is
+   * the case of an alternative transcript for the same protein. Otherwise calls
+   * a REST service to retrieve the loci, and if successful, adds them to the
+   * sequence and to the retrievedLoci.
+   * 
+   * @param seq
+   * @param retrievedLoci
+   */
+  static void findGeneLoci(SequenceI seq,
+          Map retrievedLoci)
+  {
+    /*
+     * don't replace any existing chromosomal coordinates
+     */
+    if (seq == null || seq.isProtein() || seq.getGeneLoci() != null
+            || seq.getDBRefs() == null)
+    {
+      return;
+    }
+    
+    Set ensemblDivisions = new EnsemblInfo().getDivisions();
+    
+    /*
+     * first look for direct dbrefs from sequence to Ensembl
+     */
+    String[] divisionsArray = ensemblDivisions
+            .toArray(new String[ensemblDivisions.size()]);
+    DBRefEntry[] seqRefs = seq.getDBRefs();
+    DBRefEntry[] directEnsemblRefs = DBRefUtils.selectRefs(seqRefs,
+            divisionsArray);
+    if (directEnsemblRefs != null)
+    {
+      for (DBRefEntry ensemblRef : directEnsemblRefs)
+      {
+        if (fetchGeneLoci(seq, ensemblRef, retrievedLoci))
+        {
+          return;
+        }
+      }
+    }
+
+    /*
+     * else look for indirect dbrefs from sequence to Ensembl
+     */
+    for (DBRefEntry dbref : seq.getDBRefs())
+    {
+      if (dbref.getMap() != null && dbref.getMap().getTo() != null)
+      {
+        DBRefEntry[] dbrefs = dbref.getMap().getTo().getDBRefs();
+        DBRefEntry[] indirectEnsemblRefs = DBRefUtils.selectRefs(dbrefs,
+                divisionsArray);
+        if (indirectEnsemblRefs != null)
+        {
+          for (DBRefEntry ensemblRef : indirectEnsemblRefs)
+          {
+            if (fetchGeneLoci(seq, ensemblRef, retrievedLoci))
+            {
+              return;
+            }
+          }
+        }
+      }
+    }
+  }
+
+  /**
+   * Retrieves chromosomal coordinates for the Ensembl (or EnsemblGenomes)
+   * identifier in dbref. If successful, and the sequence length matches gene
+   * loci length, then add it to the sequence, and to the retrievedLoci map.
+   * Answers true if successful, else false.
+   * 
+   * @param seq
+   * @param dbref
+   * @param retrievedLoci
+   * @return
+   */
+  static boolean fetchGeneLoci(SequenceI seq, DBRefEntry dbref,
+          Map retrievedLoci)
+  {
+    String accession = dbref.getAccessionId();
+    String division = dbref.getSource();
+
+    /*
+     * hack: ignore cross-references to Ensembl protein ids
+     * (or use map/translation perhaps?)
+     * todo: is there an equivalent in EnsemblGenomes?
+     */
+    if (accession.startsWith("ENSP"))
+    {
+      return false;
+    }
+    EnsemblMap mapper = new EnsemblMap();
+
+    /*
+     * try CDS mapping first
+     */
+    GeneLociI geneLoci = mapper.getCdsMapping(division, accession, 1,
+            seq.getLength());
+    if (geneLoci != null)
+    {
+      MapList map = geneLoci.getMap();
+      int mappedFromLength = MappingUtils.getLength(map.getFromRanges());
+      if (mappedFromLength == seq.getLength())
+      {
+        seq.setGeneLoci(geneLoci.getSpeciesId(), geneLoci.getAssemblyId(),
+                geneLoci.getChromosomeId(), geneLoci.getMap());
+        retrievedLoci.put(dbref, geneLoci);
+        return true;
+      }
+    }
+
+    /*
+     * else try CDNA mapping
+     */
+    geneLoci = mapper.getCdnaMapping(division, accession, 1,
+            seq.getLength());
+    if (geneLoci != null)
+    {
+      MapList map = geneLoci.getMap();
+      int mappedFromLength = MappingUtils.getLength(map.getFromRanges());
+      if (mappedFromLength == seq.getLength())
+      {
+        seq.setGeneLoci(geneLoci.getSpeciesId(), geneLoci.getAssemblyId(),
+                geneLoci.getChromosomeId(), geneLoci.getMap());
+        retrievedLoci.put(dbref, geneLoci);
+        return true;
+      }
+    }
+
+    return false;
+  }
+
+  /**
+   * @param alignment
+   * @param dataset
+   * @param dna
+   * @param xrefs
+   * @param xrefsAlignment
+   * @return
+   */
+  protected AlignmentI copyAlignmentForSplitFrame(AlignmentI alignment,
+          AlignmentI dataset, boolean dna, AlignmentI xrefs,
+          AlignmentI xrefsAlignment)
+  {
+    AlignmentI copyAlignment;
+    boolean copyAlignmentIsAligned = false;
+    if (dna)
+    {
+      copyAlignment = AlignmentUtils.makeCdsAlignment(sel, dataset,
+              xrefsAlignment.getSequencesArray());
+      if (copyAlignment.getHeight() == 0)
+      {
+        JvOptionPane.showMessageDialog(alignFrame,
+                MessageManager.getString("label.cant_map_cds"),
+                MessageManager.getString("label.operation_failed"),
+                JvOptionPane.OK_OPTION);
+        System.err.println("Failed to make CDS alignment");
+        return null;
+      }
+
+      /*
+       * pending getting Embl transcripts to 'align', 
+       * we are only doing this for Ensembl
+       */
+      // TODO proper criteria for 'can align as cdna'
+      if (DBRefSource.ENSEMBL.equalsIgnoreCase(source)
+              || AlignmentUtils.looksLikeEnsembl(alignment))
+      {
+        copyAlignment.alignAs(alignment);
+        copyAlignmentIsAligned = true;
+      }
+    }
+    else
+    {
+      copyAlignment = AlignmentUtils.makeCopyAlignment(sel,
+              xrefs.getSequencesArray(), dataset);
+    }
+    copyAlignment
+            .setGapCharacter(alignFrame.viewport.getGapCharacter());
+
+    StructureSelectionManager ssm = StructureSelectionManager
+            .getStructureSelectionManager(Desktop.instance);
+
+    /*
+     * register any new mappings for sequence mouseover etc
+     * (will not duplicate any previously registered mappings)
+     */
+    ssm.registerMappings(dataset.getCodonFrames());
+
+    if (copyAlignment.getHeight() <= 0)
+    {
+      System.err.println(
+              "No Sequences generated for xRef type " + source);
+      return null;
+    }
+
+    /*
+     * align protein to dna
+     */
+    if (dna && copyAlignmentIsAligned)
+    {
+      xrefsAlignment.alignAs(copyAlignment);
+    }
+    else
+    {
+      /*
+       * align cdna to protein - currently only if 
+       * fetching and aligning Ensembl transcripts!
+       */
+      // TODO: generalise for other sources of locus/transcript/cds data
+      if (dna && DBRefSource.ENSEMBL.equalsIgnoreCase(source))
+      {
+        copyAlignment.alignAs(xrefsAlignment);
+      }
+    }
+
+    return copyAlignment;
+  }
+
+  /**
    * Makes an alignment containing the given sequences, and adds them to the
    * given dataset, which is also set as the dataset for the new alignment
    * 
@@ -291,20 +504,28 @@ public class CrossRefAction implements Runnable
     return al;
   }
 
-  public CrossRefAction(AlignFrame alignFrame, SequenceI[] sel,
-          boolean _odna, String source)
+  /**
+   * Constructor
+   * 
+   * @param af
+   * @param seqs
+   * @param fromDna
+   * @param dbSource
+   */
+  CrossRefAction(AlignFrame af, SequenceI[] seqs, boolean fromDna,
+          String dbSource)
   {
-    this.alignFrame = alignFrame;
-    this.sel = sel;
-    this._odna = _odna;
-    this.source = source;
+    this.alignFrame = af;
+    this.sel = seqs;
+    this._odna = fromDna;
+    this.source = dbSource;
   }
 
-  public static CrossRefAction showProductsFor(final SequenceI[] sel,
-          final boolean _odna, final String source,
+  public static CrossRefAction getHandlerFor(final SequenceI[] sel,
+          final boolean fromDna, final String source,
           final AlignFrame alignFrame)
   {
-    return new CrossRefAction(alignFrame, sel, _odna, source);
+    return new CrossRefAction(alignFrame, sel, fromDna, source);
   }
 
 }
diff --git a/src/jalview/gui/CutAndPasteHtmlTransfer.java b/src/jalview/gui/CutAndPasteHtmlTransfer.java
index 71a1520..2e51bce 100644
--- a/src/jalview/gui/CutAndPasteHtmlTransfer.java
+++ b/src/jalview/gui/CutAndPasteHtmlTransfer.java
@@ -141,6 +141,7 @@ public class CutAndPasteHtmlTransfer extends GCutAndPasteHtmlTransfer
    */
   public void setText(String text)
   {
+    textarea.setDocument(textarea.getEditorKit().createDefaultDocument());
     textarea.setText(text);
   }
 
diff --git a/src/jalview/gui/FeatureColourChooser.java b/src/jalview/gui/FeatureColourChooser.java
deleted file mode 100644
index d8db546..0000000
--- a/src/jalview/gui/FeatureColourChooser.java
+++ /dev/null
@@ -1,632 +0,0 @@
-/*
- * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
- * Copyright (C) $$Year-Rel$$ The Jalview Authors
- * 
- * This file is part of Jalview.
- * 
- * Jalview is free software: you can redistribute it and/or
- * modify it under the terms of the GNU General Public License 
- * as published by the Free Software Foundation, either version 3
- * of the License, or (at your option) any later version.
- *  
- * Jalview is distributed in the hope that it will be useful, but 
- * WITHOUT ANY WARRANTY; without even the implied warranty 
- * of MERCHANTABILITY or FITNESS FOR A PARTICULAR 
- * PURPOSE.  See the GNU General Public License for more details.
- * 
- * You should have received a copy of the GNU General Public License
- * along with Jalview.  If not, see .
- * The Jalview Authors are detailed in the 'AUTHORS' file.
- */
-package jalview.gui;
-
-import jalview.api.FeatureColourI;
-import jalview.datamodel.GraphLine;
-import jalview.schemes.FeatureColour;
-import jalview.util.MessageManager;
-
-import java.awt.BorderLayout;
-import java.awt.Color;
-import java.awt.Dimension;
-import java.awt.FlowLayout;
-import java.awt.event.ActionEvent;
-import java.awt.event.ActionListener;
-import java.awt.event.FocusAdapter;
-import java.awt.event.FocusEvent;
-import java.awt.event.MouseAdapter;
-import java.awt.event.MouseEvent;
-
-import javax.swing.BorderFactory;
-import javax.swing.JCheckBox;
-import javax.swing.JColorChooser;
-import javax.swing.JComboBox;
-import javax.swing.JLabel;
-import javax.swing.JPanel;
-import javax.swing.JSlider;
-import javax.swing.JTextField;
-import javax.swing.border.LineBorder;
-import javax.swing.event.ChangeEvent;
-import javax.swing.event.ChangeListener;
-
-public class FeatureColourChooser extends JalviewDialog
-{
-  // FeatureSettings fs;
-  private FeatureRenderer fr;
-
-  private FeatureColourI cs;
-
-  private FeatureColourI oldcs;
-
-  private AlignmentPanel ap;
-
-  private boolean adjusting = false;
-
-  final private float min;
-
-  final private float max;
-
-  final private float scaleFactor;
-
-  private String type = null;
-
-  private JPanel minColour = new JPanel();
-
-  private JPanel maxColour = new JPanel();
-
-  private JComboBox threshold = new JComboBox<>();
-
-  private JSlider slider = new JSlider();
-
-  private JTextField thresholdValue = new JTextField(20);
-
-  // TODO implement GUI for tolower flag
-  // JCheckBox toLower = new JCheckBox();
-
-  private JCheckBox thresholdIsMin = new JCheckBox();
-
-  private JCheckBox colourByLabel = new JCheckBox();
-
-  private GraphLine threshline;
-
-  private Color oldmaxColour;
-
-  private Color oldminColour;
-
-  private ActionListener colourEditor = null;
-
-  /**
-   * Constructor
-   * 
-   * @param frender
-   * @param theType
-   */
-  public FeatureColourChooser(FeatureRenderer frender, String theType)
-  {
-    this(frender, false, theType);
-  }
-
-  /**
-   * Constructor, with option to make a blocking dialog (has to complete in the
-   * AWT event queue thread). Currently this option is always set to false.
-   * 
-   * @param frender
-   * @param blocking
-   * @param theType
-   */
-  FeatureColourChooser(FeatureRenderer frender, boolean blocking,
-          String theType)
-  {
-    this.fr = frender;
-    this.type = theType;
-    ap = fr.ap;
-    String title = MessageManager
-            .formatMessage("label.graduated_color_for_params", new String[]
-            { theType });
-    initDialogFrame(this, true, blocking, title, 480, 185);
-
-    slider.addChangeListener(new ChangeListener()
-    {
-      @Override
-      public void stateChanged(ChangeEvent evt)
-      {
-        if (!adjusting)
-        {
-          thresholdValue.setText((slider.getValue() / scaleFactor) + "");
-          sliderValueChanged();
-        }
-      }
-    });
-    slider.addMouseListener(new MouseAdapter()
-    {
-      @Override
-      public void mouseReleased(MouseEvent evt)
-      {
-        /*
-         * only update Overview and/or structure colouring
-         * when threshold slider drag ends (mouse up)
-         */
-        if (ap != null)
-        {
-          ap.paintAlignment(true, true);
-        }
-      }
-    });
-
-    float mm[] = fr.getMinMax().get(theType)[0];
-    min = mm[0];
-    max = mm[1];
-
-    /*
-     * ensure scale factor allows a scaled range with
-     * 10 integer divisions ('ticks'); if we have got here,
-     * we should expect that max != min
-     */
-    scaleFactor = (max == min) ? 1f : 100f / (max - min);
-
-    oldcs = fr.getFeatureColours().get(theType);
-    if (!oldcs.isSimpleColour())
-    {
-      if (oldcs.isAutoScaled())
-      {
-        // update the scale
-        cs = new FeatureColour((FeatureColour) oldcs, min, max);
-      }
-      else
-      {
-        cs = new FeatureColour((FeatureColour) oldcs);
-      }
-    }
-    else
-    {
-      // promote original color to a graduated color
-      Color bl = oldcs.getColour();
-      if (bl == null)
-      {
-        bl = Color.BLACK;
-      }
-      // original colour becomes the maximum colour
-      cs = new FeatureColour(Color.white, bl, mm[0], mm[1]);
-      cs.setColourByLabel(false);
-    }
-    minColour.setBackground(oldminColour = cs.getMinColour());
-    maxColour.setBackground(oldmaxColour = cs.getMaxColour());
-    adjusting = true;
-
-    try
-    {
-      jbInit();
-    } catch (Exception ex)
-    {
-    }
-    // update the gui from threshold state
-    thresholdIsMin.setSelected(!cs.isAutoScaled());
-    colourByLabel.setSelected(cs.isColourByLabel());
-    if (cs.hasThreshold())
-    {
-      // initialise threshold slider and selector
-      threshold.setSelectedIndex(cs.isAboveThreshold() ? 1 : 2);
-      slider.setEnabled(true);
-      slider.setValue((int) (cs.getThreshold() * scaleFactor));
-      thresholdValue.setEnabled(true);
-      threshline = new GraphLine((max - min) / 2f, "Threshold",
-              Color.black);
-      threshline.value = cs.getThreshold();
-    }
-
-    adjusting = false;
-
-    changeColour(false);
-    waitForInput();
-  }
-
-  private void jbInit() throws Exception
-  {
-
-    minColour.setFont(JvSwingUtils.getLabelFont());
-    minColour.setBorder(BorderFactory.createLineBorder(Color.black));
-    minColour.setPreferredSize(new Dimension(40, 20));
-    minColour.setToolTipText(MessageManager.getString("label.min_colour"));
-    minColour.addMouseListener(new MouseAdapter()
-    {
-      @Override
-      public void mousePressed(MouseEvent e)
-      {
-        if (minColour.isEnabled())
-        {
-          minColour_actionPerformed();
-        }
-      }
-    });
-    maxColour.setFont(JvSwingUtils.getLabelFont());
-    maxColour.setBorder(BorderFactory.createLineBorder(Color.black));
-    maxColour.setPreferredSize(new Dimension(40, 20));
-    maxColour.setToolTipText(MessageManager.getString("label.max_colour"));
-    maxColour.addMouseListener(new MouseAdapter()
-    {
-      @Override
-      public void mousePressed(MouseEvent e)
-      {
-        if (maxColour.isEnabled())
-        {
-          maxColour_actionPerformed();
-        }
-      }
-    });
-    maxColour.setBorder(new LineBorder(Color.black));
-    JLabel minText = new JLabel(MessageManager.getString("label.min"));
-    minText.setFont(JvSwingUtils.getLabelFont());
-    JLabel maxText = new JLabel(MessageManager.getString("label.max"));
-    maxText.setFont(JvSwingUtils.getLabelFont());
-    this.setLayout(new BorderLayout());
-    JPanel jPanel1 = new JPanel();
-    jPanel1.setBackground(Color.white);
-    JPanel jPanel2 = new JPanel();
-    jPanel2.setLayout(new FlowLayout());
-    jPanel2.setBackground(Color.white);
-    threshold.addActionListener(new ActionListener()
-    {
-      @Override
-      public void actionPerformed(ActionEvent e)
-      {
-        threshold_actionPerformed();
-      }
-    });
-    threshold.setToolTipText(MessageManager
-            .getString("label.threshold_feature_display_by_score"));
-    threshold.addItem(MessageManager
-            .getString("label.threshold_feature_no_threshold")); // index 0
-    threshold.addItem(MessageManager
-            .getString("label.threshold_feature_above_threshold")); // index 1
-    threshold.addItem(MessageManager
-            .getString("label.threshold_feature_below_threshold")); // index 2
-
-    JPanel jPanel3 = new JPanel();
-    jPanel3.setLayout(new FlowLayout());
-    thresholdValue.addActionListener(new ActionListener()
-    {
-      @Override
-      public void actionPerformed(ActionEvent e)
-      {
-        thresholdValue_actionPerformed();
-      }
-    });
-    thresholdValue.addFocusListener(new FocusAdapter()
-    {
-      @Override
-      public void focusLost(FocusEvent e)
-      {
-        thresholdValue_actionPerformed();
-      }
-    });
-    slider.setPaintLabels(false);
-    slider.setPaintTicks(true);
-    slider.setBackground(Color.white);
-    slider.setEnabled(false);
-    slider.setOpaque(false);
-    slider.setPreferredSize(new Dimension(100, 32));
-    slider.setToolTipText(
-            MessageManager.getString("label.adjust_threshold"));
-    thresholdValue.setEnabled(false);
-    thresholdValue.setColumns(7);
-    jPanel3.setBackground(Color.white);
-    thresholdIsMin.setBackground(Color.white);
-    thresholdIsMin
-            .setText(MessageManager.getString("label.threshold_minmax"));
-    thresholdIsMin.setToolTipText(MessageManager
-            .getString("label.toggle_absolute_relative_display_threshold"));
-    thresholdIsMin.addActionListener(new ActionListener()
-    {
-      @Override
-      public void actionPerformed(ActionEvent actionEvent)
-      {
-        thresholdIsMin_actionPerformed();
-      }
-    });
-    colourByLabel.setBackground(Color.white);
-    colourByLabel
-            .setText(MessageManager.getString("label.colour_by_label"));
-    colourByLabel.setToolTipText(MessageManager.getString(
-            "label.display_features_same_type_different_label_using_different_colour"));
-    colourByLabel.addActionListener(new ActionListener()
-    {
-      @Override
-      public void actionPerformed(ActionEvent actionEvent)
-      {
-        colourByLabel_actionPerformed();
-      }
-    });
-
-    JPanel colourPanel = new JPanel();
-    colourPanel.setBackground(Color.white);
-    jPanel1.add(ok);
-    jPanel1.add(cancel);
-    jPanel2.add(colourByLabel, BorderLayout.WEST);
-    jPanel2.add(colourPanel, BorderLayout.EAST);
-    colourPanel.add(minText);
-    colourPanel.add(minColour);
-    colourPanel.add(maxText);
-    colourPanel.add(maxColour);
-    this.add(jPanel3, BorderLayout.CENTER);
-    jPanel3.add(threshold);
-    jPanel3.add(slider);
-    jPanel3.add(thresholdValue);
-    jPanel3.add(thresholdIsMin);
-    this.add(jPanel1, BorderLayout.SOUTH);
-    this.add(jPanel2, BorderLayout.NORTH);
-  }
-
-  /**
-   * Action on clicking the 'minimum colour' - open a colour chooser dialog, and
-   * set the selected colour (if the user does not cancel out of the dialog)
-   */
-  protected void minColour_actionPerformed()
-  {
-    Color col = JColorChooser.showDialog(this,
-            MessageManager.getString("label.select_colour_minimum_value"),
-            minColour.getBackground());
-    if (col != null)
-    {
-      minColour.setBackground(col);
-      minColour.setForeground(col);
-    }
-    minColour.repaint();
-    changeColour(true);
-  }
-
-  /**
-   * Action on clicking the 'maximum colour' - open a colour chooser dialog, and
-   * set the selected colour (if the user does not cancel out of the dialog)
-   */
-  protected void maxColour_actionPerformed()
-  {
-    Color col = JColorChooser.showDialog(this,
-            MessageManager.getString("label.select_colour_maximum_value"),
-            maxColour.getBackground());
-    if (col != null)
-    {
-      maxColour.setBackground(col);
-      maxColour.setForeground(col);
-    }
-    maxColour.repaint();
-    changeColour(true);
-  }
-
-  /**
-   * Constructs and sets the selected colour options as the colour for the
-   * feature type, and repaints the alignment, and optionally the Overview
-   * and/or structure viewer if open
-   * 
-   * @param updateStructsAndOverview
-   */
-  void changeColour(boolean updateStructsAndOverview)
-  {
-    // Check if combobox is still adjusting
-    if (adjusting)
-    {
-      return;
-    }
-
-    boolean aboveThreshold = false;
-    boolean belowThreshold = false;
-    if (threshold.getSelectedIndex() == 1)
-    {
-      aboveThreshold = true;
-    }
-    else if (threshold.getSelectedIndex() == 2)
-    {
-      belowThreshold = true;
-    }
-    boolean hasThreshold = aboveThreshold || belowThreshold;
-
-    slider.setEnabled(true);
-    thresholdValue.setEnabled(true);
-
-    FeatureColourI acg;
-    if (cs.isColourByLabel())
-    {
-      acg = new FeatureColour(oldminColour, oldmaxColour, min, max);
-    }
-    else
-    {
-      acg = new FeatureColour(oldminColour = minColour.getBackground(),
-              oldmaxColour = maxColour.getBackground(), min, max);
-    }
-
-    if (!hasThreshold)
-    {
-      slider.setEnabled(false);
-      thresholdValue.setEnabled(false);
-      thresholdValue.setText("");
-      thresholdIsMin.setEnabled(false);
-    }
-    else if (threshline == null)
-    {
-      /*
-       * todo not yet implemented: visual indication of feature threshold
-       */
-      threshline = new GraphLine((max - min) / 2f, "Threshold",
-              Color.black);
-    }
-
-    if (hasThreshold)
-    {
-      adjusting = true;
-      acg.setThreshold(threshline.value);
-
-      float range = (max - min) * scaleFactor;
-
-      slider.setMinimum((int) (min * scaleFactor));
-      slider.setMaximum((int) (max * scaleFactor));
-      // slider.setValue((int) (threshline.value * scaleFactor));
-      slider.setValue(Math.round(threshline.value * scaleFactor));
-      thresholdValue.setText(threshline.value + "");
-      slider.setMajorTickSpacing((int) (range / 10f));
-      slider.setEnabled(true);
-      thresholdValue.setEnabled(true);
-      thresholdIsMin.setEnabled(!colourByLabel.isSelected());
-      adjusting = false;
-    }
-
-    acg.setAboveThreshold(aboveThreshold);
-    acg.setBelowThreshold(belowThreshold);
-    if (thresholdIsMin.isSelected() && hasThreshold)
-    {
-      acg.setAutoScaled(false);
-      if (aboveThreshold)
-      {
-        acg = new FeatureColour((FeatureColour) acg, threshline.value, max);
-      }
-      else
-      {
-        acg = new FeatureColour((FeatureColour) acg, min, threshline.value);
-      }
-    }
-    else
-    {
-      acg.setAutoScaled(true);
-    }
-    acg.setColourByLabel(colourByLabel.isSelected());
-    if (acg.isColourByLabel())
-    {
-      maxColour.setEnabled(false);
-      minColour.setEnabled(false);
-      maxColour.setBackground(this.getBackground());
-      maxColour.setForeground(this.getBackground());
-      minColour.setBackground(this.getBackground());
-      minColour.setForeground(this.getBackground());
-
-    }
-    else
-    {
-      maxColour.setEnabled(true);
-      minColour.setEnabled(true);
-      maxColour.setBackground(oldmaxColour);
-      minColour.setBackground(oldminColour);
-      maxColour.setForeground(oldmaxColour);
-      minColour.setForeground(oldminColour);
-    }
-    fr.setColour(type, acg);
-    cs = acg;
-    ap.paintAlignment(updateStructsAndOverview, updateStructsAndOverview);
-  }
-
-  @Override
-  protected void raiseClosed()
-  {
-    if (this.colourEditor != null)
-    {
-      colourEditor.actionPerformed(new ActionEvent(this, 0, "CLOSED"));
-    }
-  }
-
-  @Override
-  public void okPressed()
-  {
-    changeColour(false);
-  }
-
-  @Override
-  public void cancelPressed()
-  {
-    reset();
-  }
-
-  /**
-   * Action when the user cancels the dialog. All previous settings should be
-   * restored and rendered on the alignment, and any linked Overview window or
-   * structure.
-   */
-  void reset()
-  {
-    fr.setColour(type, oldcs);
-    ap.paintAlignment(true, true);
-    cs = null;
-  }
-
-  /**
-   * Action on change of choice of No / Above / Below Threshold
-   */
-  protected void threshold_actionPerformed()
-  {
-    changeColour(true);
-  }
-
-  /**
-   * Action on text entry of a threshold value
-   */
-  protected void thresholdValue_actionPerformed()
-  {
-    try
-    {
-      float f = Float.parseFloat(thresholdValue.getText());
-      slider.setValue((int) (f * scaleFactor));
-      threshline.value = f;
-
-      /*
-       * force repaint of any Overview window or structure
-       */
-      ap.paintAlignment(true, true);
-    } catch (NumberFormatException ex)
-    {
-    }
-  }
-
-  /**
-   * Action on change of threshold slider value. This may be done interactively
-   * (by moving the slider), or programmatically (to update the slider after
-   * manual input of a threshold value).
-   */
-  protected void sliderValueChanged()
-  {
-    /*
-     * squash rounding errors by forcing min/max of slider to 
-     * actual min/max of feature score range
-     */
-    int value = slider.getValue();
-    threshline.value = value == slider.getMaximum() ? max
-            : (value == slider.getMinimum() ? min : value / scaleFactor);
-    cs.setThreshold(threshline.value);
-
-    /*
-     * repaint alignment, but not Overview or structure,
-     * to avoid overload while dragging the slider
-     */
-    changeColour(false);
-  }
-
-  protected void thresholdIsMin_actionPerformed()
-  {
-    changeColour(true);
-  }
-
-  protected void colourByLabel_actionPerformed()
-  {
-    changeColour(true);
-  }
-
-  void addActionListener(ActionListener graduatedColorEditor)
-  {
-    if (colourEditor != null)
-    {
-      System.err.println(
-              "IMPLEMENTATION ISSUE: overwriting action listener for FeatureColourChooser");
-    }
-    colourEditor = graduatedColorEditor;
-  }
-
-  /**
-   * Answers the last colour setting selected by user - either oldcs (which may
-   * be a java.awt.Color) or the new GraduatedColor
-   * 
-   * @return
-   */
-  FeatureColourI getLastColour()
-  {
-    if (cs == null)
-    {
-      return oldcs;
-    }
-    return cs;
-  }
-
-}
diff --git a/src/jalview/gui/FeatureRenderer.java b/src/jalview/gui/FeatureRenderer.java
index 9c4b009..46f574e 100644
--- a/src/jalview/gui/FeatureRenderer.java
+++ b/src/jalview/gui/FeatureRenderer.java
@@ -180,15 +180,15 @@ public class FeatureRenderer
     final JSpinner end = new JSpinner();
     start.setPreferredSize(new Dimension(80, 20));
     end.setPreferredSize(new Dimension(80, 20));
-    final FeatureRenderer me = this;
     final JLabel colour = new JLabel();
     colour.setOpaque(true);
     // colour.setBorder(BorderFactory.createEtchedBorder());
     colour.setMaximumSize(new Dimension(30, 16));
     colour.addMouseListener(new MouseAdapter()
     {
-      FeatureColourChooser fcc = null;
-
+      /*
+       * open colour chooser on click in colour panel
+       */
       @Override
       public void mousePressed(MouseEvent evt)
       {
@@ -205,28 +205,26 @@ public class FeatureRenderer
         }
         else
         {
-          if (fcc == null)
+          /*
+           * variable colour dialog - on OK, refetch the updated
+           * feature colour and update this display
+           */
+          final String ft = features.get(featureIndex).getType();
+          final String type = ft == null ? lastFeatureAdded : ft;
+          FeatureTypeSettings fcc = new FeatureTypeSettings(
+                  FeatureRenderer.this, type);
+          fcc.setRequestFocusEnabled(true);
+          fcc.requestFocus();
+          fcc.addActionListener(new ActionListener()
           {
-            final String ft = features.get(featureIndex).getType();
-            final String type = ft == null ? lastFeatureAdded : ft;
-            fcc = new FeatureColourChooser(me, type);
-            fcc.setRequestFocusEnabled(true);
-            fcc.requestFocus();
-
-            fcc.addActionListener(new ActionListener()
+            @Override
+            public void actionPerformed(ActionEvent e)
             {
-
-              @Override
-              public void actionPerformed(ActionEvent e)
-              {
-                fcol = fcc.getLastColour();
-                fcc = null;
-                setColour(type, fcol);
-                updateColourButton(mainPanel, colour, fcol);
-              }
-            });
-
-          }
+              fcol = FeatureRenderer.this.getFeatureStyle(ft);
+              setColour(type, fcol);
+              updateColourButton(mainPanel, colour, fcol);
+            }
+          });
         }
       }
     });
diff --git a/src/jalview/gui/FeatureSettings.java b/src/jalview/gui/FeatureSettings.java
index 3f1d9c7..1dbc9b8 100644
--- a/src/jalview/gui/FeatureSettings.java
+++ b/src/jalview/gui/FeatureSettings.java
@@ -22,19 +22,23 @@ package jalview.gui;
 
 import jalview.api.FeatureColourI;
 import jalview.api.FeatureSettingsControllerI;
-import jalview.bin.Cache;
 import jalview.datamodel.AlignmentI;
 import jalview.datamodel.SequenceI;
+import jalview.datamodel.features.FeatureMatcherI;
+import jalview.datamodel.features.FeatureMatcherSet;
+import jalview.datamodel.features.FeatureMatcherSetI;
 import jalview.gui.Help.HelpId;
 import jalview.io.JalviewFileChooser;
 import jalview.io.JalviewFileView;
+import jalview.schemabinding.version2.Filter;
 import jalview.schemabinding.version2.JalviewUserColours;
+import jalview.schemabinding.version2.MatcherSet;
 import jalview.schemes.FeatureColour;
-import jalview.util.Format;
 import jalview.util.MessageManager;
 import jalview.util.Platform;
-import jalview.util.QuickSort;
 import jalview.viewmodel.AlignmentViewport;
+import jalview.viewmodel.seqfeatures.FeatureRendererModel.FeatureSettingsBean;
+import jalview.ws.DasSequenceFeatureFetcher;
 import jalview.ws.dbsources.das.api.jalviewSourceI;
 
 import java.awt.BorderLayout;
@@ -44,6 +48,7 @@ import java.awt.Dimension;
 import java.awt.Font;
 import java.awt.Graphics;
 import java.awt.GridLayout;
+import java.awt.Point;
 import java.awt.Rectangle;
 import java.awt.event.ActionEvent;
 import java.awt.event.ActionListener;
@@ -61,6 +66,8 @@ import java.io.InputStreamReader;
 import java.io.OutputStreamWriter;
 import java.io.PrintWriter;
 import java.util.Arrays;
+import java.util.Comparator;
+import java.util.HashMap;
 import java.util.HashSet;
 import java.util.Hashtable;
 import java.util.Iterator;
@@ -86,7 +93,6 @@ import javax.swing.JPanel;
 import javax.swing.JPopupMenu;
 import javax.swing.JScrollPane;
 import javax.swing.JSlider;
-import javax.swing.JTabbedPane;
 import javax.swing.JTable;
 import javax.swing.ListSelectionModel;
 import javax.swing.SwingConstants;
@@ -96,15 +102,34 @@ import javax.swing.event.ChangeListener;
 import javax.swing.table.AbstractTableModel;
 import javax.swing.table.TableCellEditor;
 import javax.swing.table.TableCellRenderer;
+import javax.swing.table.TableColumn;
 
 public class FeatureSettings extends JPanel
         implements FeatureSettingsControllerI
 {
-  DasSourceBrowser dassourceBrowser;
+  private static final String SEQUENCE_FEATURE_COLOURS = MessageManager
+          .getString("label.sequence_feature_colours");
+
+  /*
+   * column indices of fields in Feature Settings table
+   */
+  static final int TYPE_COLUMN = 0;
+
+  static final int COLOUR_COLUMN = 1;
+
+  static final int FILTER_COLUMN = 2;
+
+  static final int SHOW_COLUMN = 3;
+
+  private static final int COLUMN_COUNT = 4;
 
-  jalview.ws.DasSequenceFeatureFetcher dasFeatureFetcher;
+  private static final int MIN_WIDTH = 400;
+
+  private static final int MIN_HEIGHT = 400;
 
-  JPanel settingsPane = new JPanel();
+  DasSourceBrowser dassourceBrowser;
+
+  DasSequenceFeatureFetcher dasFeatureFetcher;
 
   JPanel dasSettingsPane = new JPanel();
 
@@ -112,10 +137,15 @@ public class FeatureSettings extends JPanel
 
   public final AlignFrame af;
 
+  /*
+   * 'original' fields hold settings to restore on Cancel
+   */
   Object[][] originalData;
 
   private float originalTransparency;
 
+  private Map originalFilters;
+
   final JInternalFrame frame;
 
   JScrollPane scrollPane = new JScrollPane();
@@ -126,29 +156,47 @@ public class FeatureSettings extends JPanel
 
   JSlider transparency = new JSlider();
 
-  JPanel transPanel = new JPanel(new GridLayout(1, 2));
-
-  private static final int MIN_WIDTH = 400;
-
-  private static final int MIN_HEIGHT = 400;
-  
-  /**
+  /*
    * when true, constructor is still executing - so ignore UI events
    */
   protected volatile boolean inConstruction = true;
 
+  int selectedRow = -1;
+
+  JButton fetchDAS = new JButton();
+
+  JButton saveDAS = new JButton();
+
+  JButton cancelDAS = new JButton();
+
+  boolean resettingTable = false;
+
+  /*
+   * true when Feature Settings are updating from feature renderer
+   */
+  private boolean handlingUpdate = false;
+
+  /*
+   * holds {featureCount, totalExtent} for each feature type
+   */
+  Map typeWidth = null;
+
   /**
    * Constructor
    * 
    * @param af
    */
-  public FeatureSettings(AlignFrame af)
+  public FeatureSettings(AlignFrame alignFrame)
   {
-    this.af = af;
+    this.af = alignFrame;
     fr = af.getFeatureRenderer();
-    // allow transparency to be recovered
-    transparency.setMaximum(100
-            - (int) ((originalTransparency = fr.getTransparency()) * 100));
+
+    // save transparency for restore on Cancel
+    originalTransparency = fr.getTransparency();
+    int originalTransparencyAsPercent = (int) (originalTransparency * 100);
+    transparency.setMaximum(100 - originalTransparencyAsPercent);
+
+    originalFilters = new HashMap<>(fr.getFeatureFilters()); // shallow copy
 
     try
     {
@@ -163,25 +211,48 @@ public class FeatureSettings extends JPanel
       @Override
       public String getToolTipText(MouseEvent e)
       {
-        if (table.columnAtPoint(e.getPoint()) == 0)
+        String tip = null;
+        int column = table.columnAtPoint(e.getPoint());
+        switch (column)
         {
-          /*
-           * Tooltip for feature name only
-           */
-          return JvSwingUtils.wrapTooltip(true, MessageManager
+        case TYPE_COLUMN:
+          tip = JvSwingUtils.wrapTooltip(true, MessageManager
                   .getString("label.feature_settings_click_drag"));
+          break;
+        case FILTER_COLUMN:
+          int row = table.rowAtPoint(e.getPoint());
+          FeatureMatcherSet o = (FeatureMatcherSet) table.getValueAt(row,
+                  column);
+          tip = o.isEmpty()
+                  ? MessageManager.getString("label.filters_tooltip")
+                  : o.toString();
+          break;
+        default:
+          break;
         }
-        return null;
+        return tip;
       }
     };
     table.getTableHeader().setFont(new Font("Verdana", Font.PLAIN, 12));
     table.setFont(new Font("Verdana", Font.PLAIN, 12));
-    table.setDefaultRenderer(Color.class, new ColorRenderer());
-
-    table.setDefaultEditor(Color.class, new ColorEditor(this));
 
+    // table.setDefaultRenderer(Color.class, new ColorRenderer());
+    // table.setDefaultEditor(Color.class, new ColorEditor(this));
+    //
     table.setDefaultEditor(FeatureColour.class, new ColorEditor(this));
     table.setDefaultRenderer(FeatureColour.class, new ColorRenderer());
+
+    table.setDefaultEditor(FeatureMatcherSet.class, new FilterEditor(this));
+    table.setDefaultRenderer(FeatureMatcherSet.class, new FilterRenderer());
+
+    TableColumn colourColumn = new TableColumn(COLOUR_COLUMN, 75,
+            new ColorRenderer(), new ColorEditor(this));
+    table.addColumn(colourColumn);
+
+    TableColumn filterColumn = new TableColumn(FILTER_COLUMN, 75,
+            new FilterRenderer(), new FilterEditor(this));
+    table.addColumn(filterColumn);
+
     table.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
 
     table.addMouseListener(new MouseAdapter()
@@ -190,11 +261,12 @@ public class FeatureSettings extends JPanel
       public void mousePressed(MouseEvent evt)
       {
         selectedRow = table.rowAtPoint(evt.getPoint());
+        String type = (String) table.getValueAt(selectedRow, TYPE_COLUMN);
         if (evt.isPopupTrigger())
         {
-          popupSort(selectedRow, (String) table.getValueAt(selectedRow, 0),
-                  table.getValueAt(selectedRow, 1), fr.getMinMax(),
-                  evt.getX(), evt.getY());
+          Object colour = table.getValueAt(selectedRow, COLOUR_COLUMN);
+          popupSort(selectedRow, type, colour, fr.getMinMax(), evt.getX(),
+                  evt.getY());
         }
         else if (evt.getClickCount() == 2)
         {
@@ -202,8 +274,7 @@ public class FeatureSettings extends JPanel
           boolean toggleSelection = Platform.isControlDown(evt);
           boolean extendSelection = evt.isShiftDown();
           fr.ap.alignFrame.avc.markColumnsContainingFeatures(
-                  invertSelection, extendSelection, toggleSelection,
-                  (String) table.getValueAt(selectedRow, 0));
+                  invertSelection, extendSelection, toggleSelection, type);
         }
       }
 
@@ -214,9 +285,10 @@ public class FeatureSettings extends JPanel
         selectedRow = table.rowAtPoint(evt.getPoint());
         if (evt.isPopupTrigger())
         {
-          popupSort(selectedRow, (String) table.getValueAt(selectedRow, 0),
-                  table.getValueAt(selectedRow, 1), fr.getMinMax(),
-                  evt.getX(), evt.getY());
+          String type = (String) table.getValueAt(selectedRow, TYPE_COLUMN);
+          Object colour = table.getValueAt(selectedRow, COLOUR_COLUMN);
+          popupSort(selectedRow, type, colour, fr.getMinMax(), evt.getX(),
+                  evt.getY());
         }
       }
     });
@@ -272,8 +344,8 @@ public class FeatureSettings extends JPanel
         if (!fs.resettingTable && !fs.handlingUpdate)
         {
           fs.handlingUpdate = true;
-          fs.resetTable(null); // new groups may be added with new seuqence
-          // feature types only
+          fs.resetTable(null);
+          // new groups may be added with new sequence feature types only
           fs.handlingUpdate = false;
         }
       }
@@ -286,13 +358,13 @@ public class FeatureSettings extends JPanel
     {
       Desktop.addInternalFrame(frame,
               MessageManager.getString("label.sequence_feature_settings"),
-              475, 480);
+              600, 480);
     }
     else
     {
       Desktop.addInternalFrame(frame,
               MessageManager.getString("label.sequence_feature_settings"),
-              400, 450);
+              600, 450);
     }
     frame.setMinimumSize(new Dimension(MIN_WIDTH, MIN_HEIGHT));
 
@@ -311,7 +383,7 @@ public class FeatureSettings extends JPanel
     inConstruction = false;
   }
 
-  protected void popupSort(final int selectedRow, final String type,
+  protected void popupSort(final int rowSelected, final String type,
           final Object typeCol, final Map minmax, int x,
           int y)
   {
@@ -351,84 +423,70 @@ public class FeatureSettings extends JPanel
 
     });
     men.add(dens);
-    if (minmax != null)
+
+    /*
+     * variable colour options include colour by label, by score,
+     * by selected attribute text, or attribute value
+     */
+    final JCheckBoxMenuItem mxcol = new JCheckBoxMenuItem(
+            MessageManager.getString("label.variable_colour"));
+    mxcol.setSelected(!featureColour.isSimpleColour());
+    men.add(mxcol);
+    mxcol.addActionListener(new ActionListener()
     {
-      final float[][] typeMinMax = minmax.get(type);
-      /*
-       * final JCheckBoxMenuItem chb = new JCheckBoxMenuItem("Vary Height"); //
-       * this is broken at the moment and isn't that useful anyway!
-       * chb.setSelected(minmax.get(type) != null); chb.addActionListener(new
-       * ActionListener() {
-       * 
-       * public void actionPerformed(ActionEvent e) {
-       * chb.setState(chb.getState()); if (chb.getState()) { minmax.put(type,
-       * null); } else { minmax.put(type, typeMinMax); } }
-       * 
-       * });
-       * 
-       * men.add(chb);
-       */
-      if (typeMinMax != null && typeMinMax[0] != null)
-      {
-        // if (table.getValueAt(row, column));
-        // graduated colourschemes for those where minmax exists for the
-        // positional features
-        final JCheckBoxMenuItem mxcol = new JCheckBoxMenuItem(
-                "Graduated Colour");
-        mxcol.setSelected(!featureColour.isSimpleColour());
-        men.add(mxcol);
-        mxcol.addActionListener(new ActionListener()
-        {
-          JColorChooser colorChooser;
+      JColorChooser colorChooser;
 
-          @Override
-          public void actionPerformed(ActionEvent e)
+      @Override
+      public void actionPerformed(ActionEvent e)
+      {
+        if (e.getSource() == mxcol)
+        {
+          if (featureColour.isSimpleColour())
           {
-            if (e.getSource() == mxcol)
-            {
-              if (featureColour.isSimpleColour())
-              {
-                FeatureColourChooser fc = new FeatureColourChooser(me.fr,
-                        type);
-                fc.addActionListener(this);
-              }
-              else
-              {
-                // bring up simple color chooser
-                colorChooser = new JColorChooser();
-                JDialog dialog = JColorChooser.createDialog(me,
-                        "Select new Colour", true, // modal
-                        colorChooser, this, // OK button handler
-                        null); // no CANCEL button handler
-                colorChooser.setColor(featureColour.getMaxColour());
-                dialog.setVisible(true);
-              }
-            }
-            else
-            {
-              if (e.getSource() instanceof FeatureColourChooser)
-              {
-                FeatureColourChooser fc = (FeatureColourChooser) e
-                        .getSource();
-                table.setValueAt(fc.getLastColour(), selectedRow, 1);
-                table.validate();
-              }
-              else
-              {
-                // probably the color chooser!
-                table.setValueAt(new FeatureColour(colorChooser.getColor()),
-                        selectedRow, 1);
-                table.validate();
-                me.updateFeatureRenderer(
-                        ((FeatureTableModel) table.getModel()).getData(),
-                        false);
-              }
-            }
+            FeatureTypeSettings fc = new FeatureTypeSettings(me.fr, type);
+            fc.addActionListener(this);
           }
-
-        });
+          else
+          {
+            // bring up simple color chooser
+            colorChooser = new JColorChooser();
+            String title = MessageManager
+                    .getString("label.select_colour");
+            JDialog dialog = JColorChooser.createDialog(me,
+                    title, true, // modal
+                    colorChooser, this, // OK button handler
+                    null); // no CANCEL button handler
+            colorChooser.setColor(featureColour.getMaxColour());
+            dialog.setVisible(true);
+          }
+        }
+        else
+        {
+          if (e.getSource() instanceof FeatureTypeSettings)
+          {
+            /*
+             * update after OK in feature colour dialog; the updated
+             * colour will have already been set in the FeatureRenderer
+             */
+            FeatureColourI fci = fr.getFeatureColours().get(type);
+            table.setValueAt(fci, rowSelected, 1);
+            table.validate();
+          }
+          else
+          {
+            // probably the color chooser!
+            table.setValueAt(new FeatureColour(colorChooser.getColor()),
+                    rowSelected, 1);
+            table.validate();
+            me.updateFeatureRenderer(
+                    ((FeatureTableModel) table.getModel()).getData(),
+                    false);
+          }
+        }
       }
-    }
+
+    });
+
     JMenuItem selCols = new JMenuItem(
             MessageManager.getString("label.select_columns_containing"));
     selCols.addActionListener(new ActionListener()
@@ -478,16 +536,6 @@ public class FeatureSettings extends JPanel
     men.show(table, x, y);
   }
 
-  /**
-   * true when Feature Settings are updating from feature renderer
-   */
-  private boolean handlingUpdate = false;
-
-  /**
-   * holds {featureCount, totalExtent} for each feature type
-   */
-  Map typeWidth = null;
-
   @Override
   synchronized public void discoverAllFeatureData()
   {
@@ -549,8 +597,6 @@ public class FeatureSettings extends JPanel
     return visible;
   }
 
-  boolean resettingTable = false;
-
   synchronized void resetTable(String[] groupChanged)
   {
     if (resettingTable)
@@ -613,7 +659,7 @@ public class FeatureSettings extends JPanel
       }
     }
 
-    Object[][] data = new Object[displayableTypes.size()][3];
+    Object[][] data = new Object[displayableTypes.size()][COLUMN_COUNT];
     int dataIndex = 0;
 
     if (fr.hasRenderOrder())
@@ -636,9 +682,13 @@ public class FeatureSettings extends JPanel
           continue;
         }
 
-        data[dataIndex][0] = type;
-        data[dataIndex][1] = fr.getFeatureStyle(type);
-        data[dataIndex][2] = new Boolean(
+        data[dataIndex][TYPE_COLUMN] = type;
+        data[dataIndex][COLOUR_COLUMN] = fr.getFeatureStyle(type);
+        FeatureMatcherSetI featureFilter = fr.getFeatureFilter(type);
+        data[dataIndex][FILTER_COLUMN] = featureFilter == null
+                ? new FeatureMatcherSet()
+                : featureFilter;
+        data[dataIndex][SHOW_COLUMN] = new Boolean(
                 af.getViewport().getFeaturesDisplayed().isVisible(type));
         dataIndex++;
         displayableTypes.remove(type);
@@ -652,27 +702,30 @@ public class FeatureSettings extends JPanel
     while (!displayableTypes.isEmpty())
     {
       String type = displayableTypes.iterator().next();
-      data[dataIndex][0] = type;
+      data[dataIndex][TYPE_COLUMN] = type;
 
-      data[dataIndex][1] = fr.getFeatureStyle(type);
-      if (data[dataIndex][1] == null)
+      data[dataIndex][COLOUR_COLUMN] = fr.getFeatureStyle(type);
+      if (data[dataIndex][COLOUR_COLUMN] == null)
       {
         // "Colour has been updated in another view!!"
         fr.clearRenderOrder();
         return;
       }
-
-      data[dataIndex][2] = new Boolean(true);
+      FeatureMatcherSetI featureFilter = fr.getFeatureFilter(type);
+      data[dataIndex][FILTER_COLUMN] = featureFilter == null
+              ? new FeatureMatcherSet()
+              : featureFilter;
+      data[dataIndex][SHOW_COLUMN] = new Boolean(true);
       dataIndex++;
       displayableTypes.remove(type);
     }
 
     if (originalData == null)
     {
-      originalData = new Object[data.length][3];
+      originalData = new Object[data.length][COLUMN_COUNT];
       for (int i = 0; i < data.length; i++)
       {
-        System.arraycopy(data[i], 0, originalData[i], 0, 3);
+        System.arraycopy(data[i], 0, originalData[i], 0, COLUMN_COUNT);
       }
     }
     else
@@ -693,8 +746,8 @@ public class FeatureSettings extends JPanel
   }
 
   /**
-   * Updates 'originalData' (used for restore on Cancel) if we detect that
-   * changes have been made outwith this dialog
+   * Updates 'originalData' (used for restore on Cancel) if we detect that changes
+   * have been made outwith this dialog
    * 
    * a new feature type added (and made visible)
    * a feature colour changed (in the Amend Features dialog)
@@ -710,27 +763,27 @@ public class FeatureSettings extends JPanel
             .getData();
     for (Object[] row : foundData)
     {
-      String type = (String) row[0];
+      String type = (String) row[TYPE_COLUMN];
       boolean found = false;
       for (Object[] current : currentData)
       {
-        if (type.equals(current[0]))
+        if (type.equals(current[TYPE_COLUMN]))
         {
           found = true;
           /*
            * currently dependent on object equality here;
            * really need an equals method on FeatureColour
            */
-          if (!row[1].equals(current[1]))
+          if (!row[COLOUR_COLUMN].equals(current[COLOUR_COLUMN]))
           {
             /*
              * feature colour has changed externally - update originalData
              */
             for (Object[] original : originalData)
             {
-              if (type.equals(original[0]))
+              if (type.equals(original[TYPE_COLUMN]))
               {
-                original[1] = row[1];
+                original[COLOUR_COLUMN] = row[COLOUR_COLUMN];
                 break;
               }
             }
@@ -743,10 +796,12 @@ public class FeatureSettings extends JPanel
         /*
          * new feature detected - add to original data (on top)
          */
-        Object[][] newData = new Object[originalData.length + 1][3];
+        Object[][] newData = new Object[originalData.length
+                + 1][COLUMN_COUNT];
         for (int i = 0; i < originalData.length; i++)
         {
-          System.arraycopy(originalData[i], 0, newData[i + 1], 0, 3);
+          System.arraycopy(originalData[i], 0, newData[i + 1], 0,
+                  COLUMN_COUNT);
         }
         newData[0] = row;
         originalData = newData;
@@ -756,8 +811,8 @@ public class FeatureSettings extends JPanel
 
   /**
    * Remove from the groups panel any checkboxes for groups that are not in the
-   * foundGroups set. This enables removing a group from the display when the
-   * last feature in that group is deleted.
+   * foundGroups set. This enables removing a group from the display when the last
+   * feature in that group is deleted.
    * 
    * @param foundGroups
    */
@@ -800,10 +855,14 @@ public class FeatureSettings extends JPanel
     }
   }
 
+  /**
+   * Offers a file chooser dialog, and then loads the feature colours and
+   * filters from file in XML format and unmarshals to Jalview feature settings
+   */
   void load()
   {
     JalviewFileChooser chooser = new JalviewFileChooser("fc",
-            "Sequence Feature Colours");
+            SEQUENCE_FEATURE_COLOURS);
     chooser.setFileView(new JalviewFileView());
     chooser.setDialogTitle(
             MessageManager.getString("label.load_feature_colours"));
@@ -814,88 +873,78 @@ public class FeatureSettings extends JPanel
     if (value == JalviewFileChooser.APPROVE_OPTION)
     {
       File file = chooser.getSelectedFile();
+      load(file);
+    }
+  }
 
-      try
-      {
-        InputStreamReader in = new InputStreamReader(
-                new FileInputStream(file), "UTF-8");
+  /**
+   * Loads feature colours and filters from XML stored in the given file
+   * 
+   * @param file
+   */
+  void load(File file)
+  {
+    try
+    {
+      InputStreamReader in = new InputStreamReader(
+              new FileInputStream(file), "UTF-8");
 
-        JalviewUserColours jucs = JalviewUserColours.unmarshal(in);
+      JalviewUserColours jucs = JalviewUserColours.unmarshal(in);
 
-        for (int i = jucs.getColourCount() - 1; i >= 0; i--)
-        {
-          String name;
-          jalview.schemabinding.version2.Colour newcol = jucs.getColour(i);
-          if (newcol.hasMax())
-          {
-            Color mincol = null, maxcol = null;
-            try
-            {
-              mincol = new Color(Integer.parseInt(newcol.getMinRGB(), 16));
-              maxcol = new Color(Integer.parseInt(newcol.getRGB(), 16));
+      /*
+       * load feature colours
+       */
+      for (int i = jucs.getColourCount() - 1; i >= 0; i--)
+      {
+        jalview.schemabinding.version2.Colour newcol = jucs.getColour(i);
+        FeatureColourI colour = Jalview2XML.unmarshalColour(newcol);
+        fr.setColour(newcol.getName(), colour);
+        fr.setOrder(newcol.getName(), i / (float) jucs.getColourCount());
+      }
 
-            } catch (Exception e)
-            {
-              Cache.log.warn("Couldn't parse out graduated feature color.",
-                      e);
-            }
-            FeatureColourI gcol = new FeatureColour(mincol, maxcol,
-                    newcol.getMin(), newcol.getMax());
-            if (newcol.hasAutoScale())
-            {
-              gcol.setAutoScaled(newcol.getAutoScale());
-            }
-            if (newcol.hasColourByLabel())
-            {
-              gcol.setColourByLabel(newcol.getColourByLabel());
-            }
-            if (newcol.hasThreshold())
-            {
-              gcol.setThreshold(newcol.getThreshold());
-            }
-            if (newcol.getThreshType().length() > 0)
-            {
-              String ttyp = newcol.getThreshType();
-              if (ttyp.equalsIgnoreCase("ABOVE"))
-              {
-                gcol.setAboveThreshold(true);
-              }
-              if (ttyp.equalsIgnoreCase("BELOW"))
-              {
-                gcol.setBelowThreshold(true);
-              }
-            }
-            fr.setColour(name = newcol.getName(), gcol);
-          }
-          else
-          {
-            Color color = new Color(
-                    Integer.parseInt(jucs.getColour(i).getRGB(), 16));
-            fr.setColour(name = jucs.getColour(i).getName(),
-                    new FeatureColour(color));
-          }
-          fr.setOrder(name, (i == 0) ? 0 : i / jucs.getColourCount());
-        }
-        if (table != null)
+      /*
+       * load feature filters; loaded filters will replace any that are
+       * currently defined, other defined filters are left unchanged 
+       */
+      for (int i = 0; i < jucs.getFilterCount(); i++)
+      {
+        jalview.schemabinding.version2.Filter filterModel = jucs
+                .getFilter(i);
+        String featureType = filterModel.getFeatureType();
+        FeatureMatcherSetI filter = Jalview2XML.unmarshalFilter(featureType,
+                filterModel.getMatcherSet());
+        if (!filter.isEmpty())
         {
-          resetTable(null);
-          Object[][] data = ((FeatureTableModel) table.getModel())
-                  .getData();
-          ensureOrder(data);
-          updateFeatureRenderer(data, false);
-          table.repaint();
+          fr.setFeatureFilter(featureType, filter);
         }
-      } catch (Exception ex)
-      {
-        System.out.println("Error loading User Colour File\n" + ex);
       }
+
+      /*
+       * update feature settings table
+       */
+      if (table != null)
+      {
+        resetTable(null);
+        Object[][] data = ((FeatureTableModel) table.getModel())
+                .getData();
+        ensureOrder(data);
+        updateFeatureRenderer(data, false);
+        table.repaint();
+      }
+    } catch (Exception ex)
+    {
+      System.out.println("Error loading User Colour File\n" + ex);
     }
   }
 
+  /**
+   * Offers a file chooser dialog, and then saves the current feature colours
+   * and any filters to the selected file in XML format
+   */
   void save()
   {
     JalviewFileChooser chooser = new JalviewFileChooser("fc",
-            "Sequence Feature Colours");
+            SEQUENCE_FEATURE_COLOURS);
     chooser.setFileView(new JalviewFileView());
     chooser.setDialogTitle(
             MessageManager.getString("label.save_feature_colours"));
@@ -905,57 +954,75 @@ public class FeatureSettings extends JPanel
 
     if (value == JalviewFileChooser.APPROVE_OPTION)
     {
-      String choice = chooser.getSelectedFile().getPath();
-      jalview.schemabinding.version2.JalviewUserColours ucs = new jalview.schemabinding.version2.JalviewUserColours();
-      ucs.setSchemeName("Sequence Features");
-      try
-      {
-        PrintWriter out = new PrintWriter(new OutputStreamWriter(
-                new FileOutputStream(choice), "UTF-8"));
+      save(chooser.getSelectedFile());
+    }
+  }
 
-        Set fr_colours = fr.getAllFeatureColours();
-        Iterator e = fr_colours.iterator();
-        float[] sortOrder = new float[fr_colours.size()];
-        String[] sortTypes = new String[fr_colours.size()];
-        int i = 0;
-        while (e.hasNext())
+  /**
+   * Saves feature colours and filters to the given file
+   * 
+   * @param file
+   */
+  void save(File file)
+  {
+    JalviewUserColours ucs = new JalviewUserColours();
+    ucs.setSchemeName("Sequence Features");
+    try
+    {
+      PrintWriter out = new PrintWriter(new OutputStreamWriter(
+              new FileOutputStream(file), "UTF-8"));
+
+      /*
+       * sort feature types by colour order, from 0 (highest)
+       * to 1 (lowest)
+       */
+      Set fr_colours = fr.getAllFeatureColours();
+      String[] sortedTypes = fr_colours
+              .toArray(new String[fr_colours.size()]);
+      Arrays.sort(sortedTypes, new Comparator()
+      {
+        @Override
+        public int compare(String type1, String type2)
         {
-          sortTypes[i] = e.next();
-          sortOrder[i] = fr.getOrder(sortTypes[i]);
-          i++;
+          return Float.compare(fr.getOrder(type1), fr.getOrder(type2));
         }
-        QuickSort.sort(sortOrder, sortTypes);
-        sortOrder = null;
-        for (i = 0; i < sortTypes.length; i++)
+      });
+
+      /*
+       * save feature colours
+       */
+      for (String featureType : sortedTypes)
+      {
+        FeatureColourI fcol = fr.getFeatureStyle(featureType);
+        jalview.schemabinding.version2.Colour col = Jalview2XML.marshalColour(
+                featureType, fcol);
+        ucs.addColour(col);
+      }
+
+      /*
+       * save any feature filters
+       */
+      for (String featureType : sortedTypes)
+      {
+        FeatureMatcherSetI filter = fr.getFeatureFilter(featureType);
+        if (filter != null && !filter.isEmpty())
         {
-          jalview.schemabinding.version2.Colour col = new jalview.schemabinding.version2.Colour();
-          col.setName(sortTypes[i]);
-          FeatureColourI fcol = fr.getFeatureStyle(sortTypes[i]);
-          if (fcol.isSimpleColour())
-          {
-            col.setRGB(Format.getHexString(fcol.getColour()));
-          }
-          else
-          {
-            col.setRGB(Format.getHexString(fcol.getMaxColour()));
-            col.setMin(fcol.getMin());
-            col.setMax(fcol.getMax());
-            col.setMinRGB(
-                    jalview.util.Format.getHexString(fcol.getMinColour()));
-            col.setAutoScale(fcol.isAutoScaled());
-            col.setThreshold(fcol.getThreshold());
-            col.setColourByLabel(fcol.isColourByLabel());
-            col.setThreshType(fcol.isAboveThreshold() ? "ABOVE"
-                    : (fcol.isBelowThreshold() ? "BELOW" : "NONE"));
-          }
-          ucs.addColour(col);
+          Iterator iterator = filter.getMatchers().iterator();
+          FeatureMatcherI firstMatcher = iterator.next();
+          MatcherSet ms = Jalview2XML.marshalFilter(firstMatcher, iterator,
+                  filter.isAnded());
+          Filter filterModel = new Filter();
+          filterModel.setFeatureType(featureType);
+          filterModel.setMatcherSet(ms);
+          ucs.addFilter(filterModel);
         }
-        ucs.marshal(out);
-        out.close();
-      } catch (Exception ex)
-      {
-        ex.printStackTrace();
       }
+
+      ucs.marshal(out);
+      out.close();
+    } catch (Exception ex)
+    {
+      ex.printStackTrace();
     }
   }
 
@@ -963,9 +1030,9 @@ public class FeatureSettings extends JPanel
   {
     for (int i = 0; i < table.getRowCount(); i++)
     {
-      Boolean value = (Boolean) table.getValueAt(i, 2);
+      Boolean value = (Boolean) table.getValueAt(i, SHOW_COLUMN);
 
-      table.setValueAt(new Boolean(!value.booleanValue()), i, 2);
+      table.setValueAt(new Boolean(!value.booleanValue()), i, SHOW_COLUMN);
     }
   }
 
@@ -979,17 +1046,16 @@ public class FeatureSettings extends JPanel
     float[] width = new float[data.length];
     float[] awidth;
     float max = 0;
-    int num = 0;
+
     for (int i = 0; i < data.length; i++)
     {
-      awidth = typeWidth.get(data[i][0]);
+      awidth = typeWidth.get(data[i][TYPE_COLUMN]);
       if (awidth[0] > 0)
       {
         width[i] = awidth[1] / awidth[0];// *awidth[0]*awidth[2]; - better
         // weight - but have to make per
         // sequence, too (awidth[2])
         // if (width[i]==1) // hack to distinguish single width sequences.
-        num++;
       }
       else
       {
@@ -1006,16 +1072,17 @@ public class FeatureSettings extends JPanel
       // awidth = (float[]) typeWidth.get(data[i][0]);
       if (width[i] == 0)
       {
-        width[i] = fr.getOrder(data[i][0].toString());
+        width[i] = fr.getOrder(data[i][TYPE_COLUMN].toString());
         if (width[i] < 0)
         {
-          width[i] = fr.setOrder(data[i][0].toString(), i / data.length);
+          width[i] = fr.setOrder(data[i][TYPE_COLUMN].toString(),
+                  i / data.length);
         }
       }
       else
       {
         width[i] /= max; // normalize
-        fr.setOrder(data[i][0].toString(), width[i]); // store for later
+        fr.setOrder(data[i][TYPE_COLUMN].toString(), width[i]); // store for later
       }
       if (i > 0)
       {
@@ -1049,76 +1116,58 @@ public class FeatureSettings extends JPanel
   }
 
   /**
-   * Update the priority order of features; only repaint if this changed the
-   * order of visible features
+   * Update the priority order of features; only repaint if this changed the order
+   * of visible features
    * 
    * @param data
    * @param visibleNew
    */
   private void updateFeatureRenderer(Object[][] data, boolean visibleNew)
   {
-    if (fr.setFeaturePriority(data, visibleNew))
+    FeatureSettingsBean[] rowData = getTableAsBeans(data);
+
+    if (fr.setFeaturePriority(rowData, visibleNew))
     {
       af.alignPanel.paintAlignment(true, true);
     }
   }
 
-  int selectedRow = -1;
-
-  JTabbedPane tabbedPane = new JTabbedPane();
-
-  BorderLayout borderLayout1 = new BorderLayout();
-
-  BorderLayout borderLayout2 = new BorderLayout();
-
-  BorderLayout borderLayout3 = new BorderLayout();
-
-  JPanel bigPanel = new JPanel();
-
-  BorderLayout borderLayout4 = new BorderLayout();
-
-  JButton invert = new JButton();
-
-  JPanel buttonPanel = new JPanel();
-
-  JButton cancel = new JButton();
-
-  JButton ok = new JButton();
-
-  JButton loadColours = new JButton();
-
-  JButton saveColours = new JButton();
-
-  JPanel dasButtonPanel = new JPanel();
-
-  JButton fetchDAS = new JButton();
-
-  JButton saveDAS = new JButton();
-
-  JButton cancelDAS = new JButton();
-
-  JButton optimizeOrder = new JButton();
-
-  JButton sortByScore = new JButton();
+  /**
+   * Converts table data into an array of data beans
+   */
+  private FeatureSettingsBean[] getTableAsBeans(Object[][] data)
+  {
+    FeatureSettingsBean[] rowData = new FeatureSettingsBean[data.length];
+    for (int i = 0; i < data.length; i++)
+    {
+      String type = (String) data[i][TYPE_COLUMN];
+      FeatureColourI colour = (FeatureColourI) data[i][COLOUR_COLUMN];
+      FeatureMatcherSetI theFilter = (FeatureMatcherSetI) data[i][FILTER_COLUMN];
+      Boolean isShown = (Boolean) data[i][SHOW_COLUMN];
+      rowData[i] = new FeatureSettingsBean(type, colour, theFilter,
+              isShown);
+    }
+    return rowData;
+  }
 
-  JButton sortByDens = new JButton();
+  private void jbInit() throws Exception
+  {
+    this.setLayout(new BorderLayout());
 
-  JButton help = new JButton();
+    JPanel settingsPane = new JPanel();
+    settingsPane.setLayout(new BorderLayout());
 
-  JPanel transbuttons = new JPanel(new GridLayout(5, 1));
+    dasSettingsPane.setLayout(new BorderLayout());
 
-  private void jbInit() throws Exception
-  {
-    this.setLayout(borderLayout1);
-    settingsPane.setLayout(borderLayout2);
-    dasSettingsPane.setLayout(borderLayout3);
-    bigPanel.setLayout(borderLayout4);
+    JPanel bigPanel = new JPanel();
+    bigPanel.setLayout(new BorderLayout());
 
     groupPanel = new JPanel();
     bigPanel.add(groupPanel, BorderLayout.NORTH);
 
+    JButton invert = new JButton(
+            MessageManager.getString("label.invert_selection"));
     invert.setFont(JvSwingUtils.getLabelFont());
-    invert.setText(MessageManager.getString("label.invert_selection"));
     invert.addActionListener(new ActionListener()
     {
       @Override
@@ -1127,8 +1176,10 @@ public class FeatureSettings extends JPanel
         invertSelection();
       }
     });
+
+    JButton optimizeOrder = new JButton(
+            MessageManager.getString("label.optimise_order"));
     optimizeOrder.setFont(JvSwingUtils.getLabelFont());
-    optimizeOrder.setText(MessageManager.getString("label.optimise_order"));
     optimizeOrder.addActionListener(new ActionListener()
     {
       @Override
@@ -1137,9 +1188,10 @@ public class FeatureSettings extends JPanel
         orderByAvWidth();
       }
     });
+
+    JButton sortByScore = new JButton(
+            MessageManager.getString("label.seq_sort_by_score"));
     sortByScore.setFont(JvSwingUtils.getLabelFont());
-    sortByScore
-            .setText(MessageManager.getString("label.seq_sort_by_score"));
     sortByScore.addActionListener(new ActionListener()
     {
       @Override
@@ -1148,9 +1200,9 @@ public class FeatureSettings extends JPanel
         af.avc.sortAlignmentByFeatureScore(null);
       }
     });
-    sortByDens.setFont(JvSwingUtils.getLabelFont());
-    sortByDens.setText(
+    JButton sortByDens = new JButton(
             MessageManager.getString("label.sequence_sort_by_density"));
+    sortByDens.setFont(JvSwingUtils.getLabelFont());
     sortByDens.addActionListener(new ActionListener()
     {
       @Override
@@ -1159,8 +1211,9 @@ public class FeatureSettings extends JPanel
         af.avc.sortAlignmentByFeatureDensity(null);
       }
     });
+
+    JButton help = new JButton(MessageManager.getString("action.help"));
     help.setFont(JvSwingUtils.getLabelFont());
-    help.setText(MessageManager.getString("action.help"));
     help.addActionListener(new ActionListener()
     {
       @Override
@@ -1191,20 +1244,23 @@ public class FeatureSettings extends JPanel
         }
       }
     });
+
+    JButton cancel = new JButton(MessageManager.getString("action.cancel"));
     cancel.setFont(JvSwingUtils.getLabelFont());
-    cancel.setText(MessageManager.getString("action.cancel"));
     cancel.addActionListener(new ActionListener()
     {
       @Override
       public void actionPerformed(ActionEvent e)
       {
         fr.setTransparency(originalTransparency);
+        fr.setFeatureFilters(originalFilters);
         updateFeatureRenderer(originalData);
         close();
       }
     });
+
+    JButton ok = new JButton(MessageManager.getString("action.ok"));
     ok.setFont(JvSwingUtils.getLabelFont());
-    ok.setText(MessageManager.getString("action.ok"));
     ok.addActionListener(new ActionListener()
     {
       @Override
@@ -1213,8 +1269,12 @@ public class FeatureSettings extends JPanel
         close();
       }
     });
+
+    JButton loadColours = new JButton(
+            MessageManager.getString("label.load_colours"));
     loadColours.setFont(JvSwingUtils.getLabelFont());
-    loadColours.setText(MessageManager.getString("label.load_colours"));
+    loadColours.setToolTipText(
+            MessageManager.getString("label.load_colours_tooltip"));
     loadColours.addActionListener(new ActionListener()
     {
       @Override
@@ -1223,8 +1283,12 @@ public class FeatureSettings extends JPanel
         load();
       }
     });
+
+    JButton saveColours = new JButton(
+            MessageManager.getString("label.save_colours"));
     saveColours.setFont(JvSwingUtils.getLabelFont());
-    saveColours.setText(MessageManager.getString("label.save_colours"));
+    saveColours.setToolTipText(
+            MessageManager.getString("label.save_colours_tooltip"));
     saveColours.addActionListener(new ActionListener()
     {
       @Override
@@ -1241,7 +1305,7 @@ public class FeatureSettings extends JPanel
         if (!inConstruction)
         {
           fr.setTransparency((100 - transparency.getValue()) / 100f);
-          af.alignPanel.paintAlignment(true,true);
+          af.alignPanel.paintAlignment(true, true);
         }
       }
     });
@@ -1267,6 +1331,8 @@ public class FeatureSettings extends JPanel
         saveDAS_actionPerformed(e);
       }
     });
+
+    JPanel dasButtonPanel = new JPanel();
     dasButtonPanel.setBorder(BorderFactory.createEtchedBorder());
     dasSettingsPane.setBorder(null);
     cancelDAS.setEnabled(false);
@@ -1279,32 +1345,32 @@ public class FeatureSettings extends JPanel
         cancelDAS_actionPerformed(e);
       }
     });
-    this.add(tabbedPane, java.awt.BorderLayout.CENTER);
-    tabbedPane.addTab(MessageManager.getString("label.feature_settings"),
-            settingsPane);
-    tabbedPane.addTab(MessageManager.getString("label.das_settings"),
-            dasSettingsPane);
-    bigPanel.add(transPanel, java.awt.BorderLayout.SOUTH);
+
+    JPanel transPanel = new JPanel(new GridLayout(1, 2));
+    bigPanel.add(transPanel, BorderLayout.SOUTH);
+
+    JPanel transbuttons = new JPanel(new GridLayout(5, 1));
     transbuttons.add(optimizeOrder);
     transbuttons.add(invert);
     transbuttons.add(sortByScore);
     transbuttons.add(sortByDens);
     transbuttons.add(help);
-    JPanel sliderPanel = new JPanel();
-    sliderPanel.add(transparency);
     transPanel.add(transparency);
     transPanel.add(transbuttons);
+
+    JPanel buttonPanel = new JPanel();
     buttonPanel.add(ok);
     buttonPanel.add(cancel);
     buttonPanel.add(loadColours);
     buttonPanel.add(saveColours);
-    bigPanel.add(scrollPane, java.awt.BorderLayout.CENTER);
-    dasSettingsPane.add(dasButtonPanel, java.awt.BorderLayout.SOUTH);
+    bigPanel.add(scrollPane, BorderLayout.CENTER);
+    dasSettingsPane.add(dasButtonPanel, BorderLayout.SOUTH);
     dasButtonPanel.add(fetchDAS);
     dasButtonPanel.add(cancelDAS);
     dasButtonPanel.add(saveDAS);
-    settingsPane.add(bigPanel, java.awt.BorderLayout.CENTER);
-    settingsPane.add(buttonPanel, java.awt.BorderLayout.SOUTH);
+    settingsPane.add(bigPanel, BorderLayout.CENTER);
+    settingsPane.add(buttonPanel, BorderLayout.SOUTH);
+    this.add(settingsPane);
   }
 
   public void fetchDAS_actionPerformed(ActionEvent e)
@@ -1469,18 +1535,19 @@ public class FeatureSettings extends JPanel
   // ///////////////////////////////////////////////////////////////////////
   class FeatureTableModel extends AbstractTableModel
   {
-    FeatureTableModel(Object[][] data)
-    {
-      this.data = data;
-    }
-
     private String[] columnNames = {
         MessageManager.getString("label.feature_type"),
         MessageManager.getString("action.colour"),
-        MessageManager.getString("label.display") };
+        MessageManager.getString("label.filter"),
+        MessageManager.getString("label.show") };
 
     private Object[][] data;
 
+    FeatureTableModel(Object[][] data)
+    {
+      this.data = data;
+    }
+
     public Object[][] getData()
     {
       return data;
@@ -1520,10 +1587,14 @@ public class FeatureSettings extends JPanel
       return data[row][col];
     }
 
+    /**
+     * Answers the class of the object in column c of the first row of the table
+     */
     @Override
-    public Class getColumnClass(int c)
+    public Class getColumnClass(int c)
     {
-      return getValueAt(0, c).getClass();
+      Object v = getValueAt(0, c);
+      return v == null ? null : v.getClass();
     }
 
     @Override
@@ -1562,12 +1633,7 @@ public class FeatureSettings extends JPanel
             boolean isSelected, boolean hasFocus, int row, int column)
     {
       FeatureColourI cellColour = (FeatureColourI) color;
-      // JLabel comp = new JLabel();
-      // comp.
       setOpaque(true);
-      // comp.
-      // setBounds(getBounds());
-      Color newColor;
       setToolTipText(baseTT);
       setBackground(tbl.getBackground());
       if (!cellColour.isSimpleColour())
@@ -1575,14 +1641,12 @@ public class FeatureSettings extends JPanel
         Rectangle cr = tbl.getCellRect(row, column, false);
         FeatureSettings.renderGraduatedColor(this, cellColour,
                 (int) cr.getWidth(), (int) cr.getHeight());
-
       }
       else
       {
         this.setText("");
         this.setIcon(null);
-        newColor = cellColour.getColour();
-        setBackground(newColor);
+        setBackground(cellColour.getColour());
       }
       if (isSelected)
       {
@@ -1607,6 +1671,54 @@ public class FeatureSettings extends JPanel
     }
   }
 
+  class FilterRenderer extends JLabel implements TableCellRenderer
+  {
+    javax.swing.border.Border unselectedBorder = null;
+
+    javax.swing.border.Border selectedBorder = null;
+
+    public FilterRenderer()
+    {
+      setOpaque(true); // MUST do this for background to show up.
+      setHorizontalTextPosition(SwingConstants.CENTER);
+      setVerticalTextPosition(SwingConstants.CENTER);
+    }
+
+    @Override
+    public Component getTableCellRendererComponent(JTable tbl,
+            Object filter, boolean isSelected, boolean hasFocus, int row,
+            int column)
+    {
+      FeatureMatcherSetI theFilter = (FeatureMatcherSetI) filter;
+      setOpaque(true);
+      String asText = theFilter.toString();
+      setBackground(tbl.getBackground());
+      this.setText(asText);
+      this.setIcon(null);
+
+      if (isSelected)
+      {
+        if (selectedBorder == null)
+        {
+          selectedBorder = BorderFactory.createMatteBorder(2, 5, 2, 5,
+                  tbl.getSelectionBackground());
+        }
+        setBorder(selectedBorder);
+      }
+      else
+      {
+        if (unselectedBorder == null)
+        {
+          unselectedBorder = BorderFactory.createMatteBorder(2, 5, 2, 5,
+                  tbl.getBackground());
+        }
+        setBorder(unselectedBorder);
+      }
+
+      return this;
+    }
+  }
+
   /**
    * update comp using rendering settings from gcol
    * 
@@ -1633,28 +1745,43 @@ public class FeatureSettings extends JPanel
           int w, int h)
   {
     boolean thr = false;
-    String tt = "";
-    String tx = "";
+    StringBuilder tt = new StringBuilder();
+    StringBuilder tx = new StringBuilder();
+
+    if (gcol.isColourByAttribute())
+    {
+      tx.append(String.join(":", gcol.getAttributeName()));
+    }
+    else if (!gcol.isColourByLabel())
+    {
+      tx.append(MessageManager.getString("label.score"));
+    }
+    tx.append(" ");
     if (gcol.isAboveThreshold())
     {
       thr = true;
-      tx += ">";
-      tt += "Thresholded (Above " + gcol.getThreshold() + ") ";
+      tx.append(">");
+      tt.append("Thresholded (Above ").append(gcol.getThreshold())
+              .append(") ");
     }
     if (gcol.isBelowThreshold())
     {
       thr = true;
-      tx += "<";
-      tt += "Thresholded (Below " + gcol.getThreshold() + ") ";
+      tx.append("<");
+      tt.append("Thresholded (Below ").append(gcol.getThreshold())
+              .append(") ");
     }
     if (gcol.isColourByLabel())
     {
-      tt = "Coloured by label text. " + tt;
+      tt.append("Coloured by label text. ").append(tt);
       if (thr)
       {
-        tx += " ";
+        tx.append(" ");
+      }
+      if (!gcol.isColourByAttribute())
+      {
+        tx.append("Label");
       }
-      tx += "Label";
       comp.setIcon(null);
     }
     else
@@ -1670,19 +1797,259 @@ public class FeatureSettings extends JPanel
       // + ", " + minCol.getBlue() + ")");
     }
     comp.setHorizontalAlignment(SwingConstants.CENTER);
-    comp.setText(tx);
+    comp.setText(tx.toString());
     if (tt.length() > 0)
     {
       if (comp.getToolTipText() == null)
       {
-        comp.setToolTipText(tt);
+        comp.setToolTipText(tt.toString());
       }
       else
       {
-        comp.setToolTipText(tt + " " + comp.getToolTipText());
+        comp.setToolTipText(
+                tt.append(" ").append(comp.getToolTipText()).toString());
       }
     }
   }
+
+  class ColorEditor extends AbstractCellEditor
+          implements TableCellEditor, ActionListener
+  {
+    FeatureSettings me;
+
+    FeatureColourI currentColor;
+
+    FeatureTypeSettings chooser;
+
+    String type;
+
+    JButton button;
+
+    JColorChooser colorChooser;
+
+    JDialog dialog;
+
+    protected static final String EDIT = "edit";
+
+    int rowSelected = 0;
+
+    public ColorEditor(FeatureSettings me)
+    {
+      this.me = me;
+      // Set up the editor (from the table's point of view),
+      // which is a button.
+      // This button brings up the color chooser dialog,
+      // which is the editor from the user's point of view.
+      button = new JButton();
+      button.setActionCommand(EDIT);
+      button.addActionListener(this);
+      button.setBorderPainted(false);
+      // Set up the dialog that the button brings up.
+      colorChooser = new JColorChooser();
+      dialog = JColorChooser.createDialog(button,
+              MessageManager.getString("label.select_colour"), true, // modal
+              colorChooser, this, // OK button handler
+              null); // no CANCEL button handler
+    }
+
+    /**
+     * Handles events from the editor button and from the dialog's OK button.
+     */
+    @Override
+    public void actionPerformed(ActionEvent e)
+    {
+      // todo test e.getSource() instead here
+      if (EDIT.equals(e.getActionCommand()))
+      {
+        // The user has clicked the cell, so
+        // bring up the dialog.
+        if (currentColor.isSimpleColour())
+        {
+          // bring up simple color chooser
+          button.setBackground(currentColor.getColour());
+          colorChooser.setColor(currentColor.getColour());
+          dialog.setVisible(true);
+        }
+        else
+        {
+          // bring up graduated chooser.
+          chooser = new FeatureTypeSettings(me.fr, type);
+          chooser.setRequestFocusEnabled(true);
+          chooser.requestFocus();
+          chooser.addActionListener(this);
+          chooser.showTab(true);
+        }
+        // Make the renderer reappear.
+        fireEditingStopped();
+
+      }
+      else
+      {
+        if (currentColor.isSimpleColour())
+        {
+          /*
+           * read off colour picked in colour chooser after OK pressed
+           */
+          currentColor = new FeatureColour(colorChooser.getColor());
+          me.table.setValueAt(currentColor, rowSelected, COLOUR_COLUMN);
+        }
+        else
+        {
+          /*
+           * after OK in variable colour dialog, any changes to colour 
+           * (or filters!) are already set in FeatureRenderer, so just
+           * update table data without triggering updateFeatureRenderer
+           */
+          currentColor = fr.getFeatureColours().get(type);
+          FeatureMatcherSetI currentFilter = me.fr.getFeatureFilter(type);
+          if (currentFilter == null)
+          {
+            currentFilter = new FeatureMatcherSet();
+          }
+          Object[] data = ((FeatureTableModel) table.getModel())
+                  .getData()[rowSelected];
+          data[COLOUR_COLUMN] = currentColor;
+          data[FILTER_COLUMN] = currentFilter;
+        }
+        fireEditingStopped();
+        me.table.validate();
+      }
+    }
+
+    // Implement the one CellEditor method that AbstractCellEditor doesn't.
+    @Override
+    public Object getCellEditorValue()
+    {
+      return currentColor;
+    }
+
+    // Implement the one method defined by TableCellEditor.
+    @Override
+    public Component getTableCellEditorComponent(JTable theTable, Object value,
+            boolean isSelected, int row, int column)
+    {
+      currentColor = (FeatureColourI) value;
+      this.rowSelected = row;
+      type = me.table.getValueAt(row, TYPE_COLUMN).toString();
+      button.setOpaque(true);
+      button.setBackground(me.getBackground());
+      if (!currentColor.isSimpleColour())
+      {
+        JLabel btn = new JLabel();
+        btn.setSize(button.getSize());
+        FeatureSettings.renderGraduatedColor(btn, currentColor);
+        button.setBackground(btn.getBackground());
+        button.setIcon(btn.getIcon());
+        button.setText(btn.getText());
+      }
+      else
+      {
+        button.setText("");
+        button.setIcon(null);
+        button.setBackground(currentColor.getColour());
+      }
+      return button;
+    }
+  }
+
+  /**
+   * The cell editor for the Filter column. It displays the text of any filters
+   * for the feature type in that row (in full as a tooltip, possible abbreviated
+   * as display text). On click in the cell, opens the Feature Display Settings
+   * dialog at the Filters tab.
+   */
+  class FilterEditor extends AbstractCellEditor
+          implements TableCellEditor, ActionListener
+  {
+    FeatureSettings me;
+
+    FeatureMatcherSetI currentFilter;
+
+    Point lastLocation;
+
+    String type;
+
+    JButton button;
+
+    protected static final String EDIT = "edit";
+
+    int rowSelected = 0;
+
+    public FilterEditor(FeatureSettings me)
+    {
+      this.me = me;
+      button = new JButton();
+      button.setActionCommand(EDIT);
+      button.addActionListener(this);
+      button.setBorderPainted(false);
+    }
+
+    /**
+     * Handles events from the editor button
+     */
+    @Override
+    public void actionPerformed(ActionEvent e)
+    {
+      if (button == e.getSource())
+      {
+        FeatureTypeSettings chooser = new FeatureTypeSettings(me.fr, type);
+        chooser.addActionListener(this);
+        chooser.setRequestFocusEnabled(true);
+        chooser.requestFocus();
+        if (lastLocation != null)
+        {
+          // todo open at its last position on screen
+          chooser.setBounds(lastLocation.x, lastLocation.y,
+                  chooser.getWidth(), chooser.getHeight());
+          chooser.validate();
+        }
+        chooser.showTab(false);
+        fireEditingStopped();
+      }
+      else if (e.getSource() instanceof Component)
+      {
+
+        /*
+         * after OK in variable colour dialog, any changes to filter
+         * (or colours!) are already set in FeatureRenderer, so just
+         * update table data without triggering updateFeatureRenderer
+         */
+        FeatureColourI currentColor = fr.getFeatureColours().get(type);
+        currentFilter = me.fr.getFeatureFilter(type);
+        if (currentFilter == null)
+        {
+          currentFilter = new FeatureMatcherSet();
+        }
+        Object[] data = ((FeatureTableModel) table.getModel())
+                .getData()[rowSelected];
+        data[COLOUR_COLUMN] = currentColor;
+        data[FILTER_COLUMN] = currentFilter;
+        fireEditingStopped();
+        me.table.validate();
+      }
+    }
+
+    @Override
+    public Object getCellEditorValue()
+    {
+      return currentFilter;
+    }
+
+    @Override
+    public Component getTableCellEditorComponent(JTable theTable, Object value,
+            boolean isSelected, int row, int column)
+    {
+      currentFilter = (FeatureMatcherSetI) value;
+      this.rowSelected = row;
+      type = me.table.getValueAt(row, TYPE_COLUMN).toString();
+      button.setOpaque(true);
+      button.setBackground(me.getBackground());
+      button.setText(currentFilter.toString());
+      button.setToolTipText(currentFilter.toString());
+      button.setIcon(null);
+      return button;
+    }
+  }
 }
 
 class FeatureIcon implements Icon
@@ -1766,124 +2133,3 @@ class FeatureIcon implements Icon
     }
   }
 }
-
-class ColorEditor extends AbstractCellEditor
-        implements TableCellEditor, ActionListener
-{
-  FeatureSettings me;
-
-  FeatureColourI currentColor;
-
-  FeatureColourChooser chooser;
-
-  String type;
-
-  JButton button;
-
-  JColorChooser colorChooser;
-
-  JDialog dialog;
-
-  protected static final String EDIT = "edit";
-
-  int selectedRow = 0;
-
-  public ColorEditor(FeatureSettings me)
-  {
-    this.me = me;
-    // Set up the editor (from the table's point of view),
-    // which is a button.
-    // This button brings up the color chooser dialog,
-    // which is the editor from the user's point of view.
-    button = new JButton();
-    button.setActionCommand(EDIT);
-    button.addActionListener(this);
-    button.setBorderPainted(false);
-    // Set up the dialog that the button brings up.
-    colorChooser = new JColorChooser();
-    dialog = JColorChooser.createDialog(button, "Select new Colour", true, // modal
-            colorChooser, this, // OK button handler
-            null); // no CANCEL button handler
-  }
-
-  /**
-   * Handles events from the editor button and from the dialog's OK button.
-   */
-  @Override
-  public void actionPerformed(ActionEvent e)
-  {
-
-    if (EDIT.equals(e.getActionCommand()))
-    {
-      // The user has clicked the cell, so
-      // bring up the dialog.
-      if (currentColor.isSimpleColour())
-      {
-        // bring up simple color chooser
-        button.setBackground(currentColor.getColour());
-        colorChooser.setColor(currentColor.getColour());
-        dialog.setVisible(true);
-      }
-      else
-      {
-        // bring up graduated chooser.
-        chooser = new FeatureColourChooser(me.fr, type);
-        chooser.setRequestFocusEnabled(true);
-        chooser.requestFocus();
-        chooser.addActionListener(this);
-      }
-      // Make the renderer reappear.
-      fireEditingStopped();
-
-    }
-    else
-    { // User pressed dialog's "OK" button.
-      if (currentColor.isSimpleColour())
-      {
-        currentColor = new FeatureColour(colorChooser.getColor());
-      }
-      else
-      {
-        currentColor = chooser.getLastColour();
-      }
-      me.table.setValueAt(getCellEditorValue(), selectedRow, 1);
-      fireEditingStopped();
-      me.table.validate();
-    }
-  }
-
-  // Implement the one CellEditor method that AbstractCellEditor doesn't.
-  @Override
-  public Object getCellEditorValue()
-  {
-    return currentColor;
-  }
-
-  // Implement the one method defined by TableCellEditor.
-  @Override
-  public Component getTableCellEditorComponent(JTable table, Object value,
-          boolean isSelected, int row, int column)
-  {
-    currentColor = (FeatureColourI) value;
-    this.selectedRow = row;
-    type = me.table.getValueAt(row, 0).toString();
-    button.setOpaque(true);
-    button.setBackground(me.getBackground());
-    if (!currentColor.isSimpleColour())
-    {
-      JLabel btn = new JLabel();
-      btn.setSize(button.getSize());
-      FeatureSettings.renderGraduatedColor(btn, currentColor);
-      button.setBackground(btn.getBackground());
-      button.setIcon(btn.getIcon());
-      button.setText(btn.getText());
-    }
-    else
-    {
-      button.setText("");
-      button.setIcon(null);
-      button.setBackground(currentColor.getColour());
-    }
-    return button;
-  }
-}
diff --git a/src/jalview/gui/FeatureTypeSettings.java b/src/jalview/gui/FeatureTypeSettings.java
new file mode 100644
index 0000000..5480f5d
--- /dev/null
+++ b/src/jalview/gui/FeatureTypeSettings.java
@@ -0,0 +1,1739 @@
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ * 
+ * This file is part of Jalview.
+ * 
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License 
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *  
+ * Jalview is distributed in the hope that it will be useful, but 
+ * WITHOUT ANY WARRANTY; without even the implied warranty 
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR 
+ * PURPOSE.  See the GNU General Public License for more details.
+ * 
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview.  If not, see .
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+package jalview.gui;
+
+import jalview.api.AlignmentViewPanel;
+import jalview.api.FeatureColourI;
+import jalview.datamodel.GraphLine;
+import jalview.datamodel.features.FeatureAttributes;
+import jalview.datamodel.features.FeatureAttributes.Datatype;
+import jalview.datamodel.features.FeatureMatcher;
+import jalview.datamodel.features.FeatureMatcherI;
+import jalview.datamodel.features.FeatureMatcherSet;
+import jalview.datamodel.features.FeatureMatcherSetI;
+import jalview.schemes.FeatureColour;
+import jalview.util.ColorUtils;
+import jalview.util.MessageManager;
+import jalview.util.matcher.Condition;
+
+import java.awt.BorderLayout;
+import java.awt.Color;
+import java.awt.Dimension;
+import java.awt.FlowLayout;
+import java.awt.GridLayout;
+import java.awt.event.ActionEvent;
+import java.awt.event.ActionListener;
+import java.awt.event.FocusAdapter;
+import java.awt.event.FocusEvent;
+import java.awt.event.ItemEvent;
+import java.awt.event.ItemListener;
+import java.awt.event.MouseAdapter;
+import java.awt.event.MouseEvent;
+import java.text.DecimalFormat;
+import java.util.ArrayList;
+import java.util.List;
+
+import javax.swing.BorderFactory;
+import javax.swing.BoxLayout;
+import javax.swing.ButtonGroup;
+import javax.swing.JButton;
+import javax.swing.JCheckBox;
+import javax.swing.JColorChooser;
+import javax.swing.JComboBox;
+import javax.swing.JLabel;
+import javax.swing.JPanel;
+import javax.swing.JRadioButton;
+import javax.swing.JSlider;
+import javax.swing.JTabbedPane;
+import javax.swing.JTextField;
+import javax.swing.SwingConstants;
+import javax.swing.border.LineBorder;
+import javax.swing.event.ChangeEvent;
+import javax.swing.event.ChangeListener;
+import javax.swing.plaf.basic.BasicArrowButton;
+
+/**
+ * A dialog where the user can configure colour scheme, and any filters, for one
+ * feature type
+ * 
+ * (Was FeatureColourChooser prior to Jalview 1.11, renamed with the addition of
+ * filter options)
+ */
+public class FeatureTypeSettings extends JalviewDialog
+{
+  private final static String LABEL_18N = MessageManager
+          .getString("label.label");
+
+  private final static String SCORE_18N = MessageManager
+          .getString("label.score");
+
+  private static final int RADIO_WIDTH = 130;
+
+  private static final String COLON = ":";
+
+  private static final int MAX_TOOLTIP_LENGTH = 50;
+
+  private static final int NO_COLOUR_OPTION = 0;
+
+  private static final int MIN_COLOUR_OPTION = 1;
+
+  private static final int MAX_COLOUR_OPTION = 2;
+
+  private static final int ABOVE_THRESHOLD_OPTION = 1;
+
+  private static final int BELOW_THRESHOLD_OPTION = 2;
+
+  private static final DecimalFormat DECFMT_2_2 = new DecimalFormat(
+          "##.##");
+
+  /*
+   * FeatureRenderer holds colour scheme and filters for feature types
+   */
+  private final FeatureRenderer fr; // todo refactor to allow interface type here
+
+  /*
+   * the view panel to update when settings change
+   */
+  private final AlignmentViewPanel ap;
+
+  private final String featureType;
+
+  /*
+   * the colour and filters to reset to on Cancel
+   */
+  private final FeatureColourI originalColour;
+
+  private final FeatureMatcherSetI originalFilter;
+
+  /*
+   * set flag to true when setting values programmatically,
+   * to avoid invocation of action handlers
+   */
+  private boolean adjusting = false;
+
+  /*
+   * minimum of the value range for graduated colour
+   * (may be for feature score or for a numeric attribute)
+   */
+  private float min;
+
+  /*
+   * maximum of the value range for graduated colour
+   */
+  private float max;
+
+  /*
+   * scale factor for conversion between absolute min-max and slider
+   */
+  private float scaleFactor;
+
+  /*
+   * radio button group, to select what to colour by:
+   * simple colour, by category (text), or graduated
+   */
+  private JRadioButton simpleColour = new JRadioButton();
+
+  private JRadioButton byCategory = new JRadioButton();
+
+  private JRadioButton graduatedColour = new JRadioButton();
+
+  private JPanel singleColour = new JPanel();
+
+  private JPanel minColour = new JPanel();
+
+  private JPanel maxColour = new JPanel();
+
+  private JComboBox threshold = new JComboBox<>();
+
+  private JSlider slider = new JSlider();
+
+  private JTextField thresholdValue = new JTextField(20);
+
+  private JCheckBox thresholdIsMin = new JCheckBox();
+
+  private GraphLine threshline;
+
+  private ActionListener featureSettings = null;
+
+  private ActionListener changeColourAction;
+
+  /*
+   * choice of option for 'colour for no value'
+   */
+  private JComboBox noValueCombo;
+
+  /*
+   * choice of what to colour by text (Label or attribute)
+   */
+  private JComboBox colourByTextCombo;
+
+  /*
+   * choice of what to colour by range (Score or attribute)
+   */
+  private JComboBox colourByRangeCombo;
+
+  private JRadioButton andFilters;
+
+  private JRadioButton orFilters;
+
+  /*
+   * filters for the currently selected feature type
+   */
+  private List filters;
+
+  // set white normally, black to debug layout
+  private Color debugBorderColour = Color.white;
+
+  private JPanel chooseFiltersPanel;
+
+  private JTabbedPane tabbedPane;
+
+  /**
+   * Constructor
+   * 
+   * @param frender
+   * @param theType
+   */
+  public FeatureTypeSettings(FeatureRenderer frender, String theType)
+  {
+    this(frender, false, theType);
+  }
+
+  /**
+   * Constructor, with option to make a blocking dialog (has to complete in the
+   * AWT event queue thread). Currently this option is always set to false.
+   * 
+   * @param frender
+   * @param blocking
+   * @param theType
+   */
+  FeatureTypeSettings(FeatureRenderer frender, boolean blocking,
+          String theType)
+  {
+    this.fr = frender;
+    this.featureType = theType;
+    ap = fr.ap;
+    originalFilter = fr.getFeatureFilter(theType);
+    originalColour = fr.getFeatureColours().get(theType);
+
+    adjusting = true;
+
+    try
+    {
+      initialise();
+    } catch (Exception ex)
+    {
+      ex.printStackTrace();
+      return;
+    }
+
+    updateColoursTab();
+
+    updateFiltersTab();
+
+    adjusting = false;
+
+    colourChanged(false);
+
+    String title = MessageManager
+            .formatMessage("label.display_settings_for", new String[]
+            { theType });
+    initDialogFrame(this, true, blocking, title, 600, 360);
+
+    waitForInput();
+  }
+
+  /**
+   * Configures the widgets on the Colours tab according to the current feature
+   * colour scheme
+   */
+  private void updateColoursTab()
+  {
+    FeatureColourI fc = fr.getFeatureColours().get(featureType);
+
+    /*
+     * suppress action handling while updating values programmatically
+     */
+    adjusting = true;
+    try
+    {
+      /*
+       * single colour
+       */
+      if (fc.isSimpleColour())
+      {
+        simpleColour.setSelected(true);
+        singleColour.setBackground(fc.getColour());
+        singleColour.setForeground(fc.getColour());
+      }
+
+      /*
+       * colour by text (Label or attribute text)
+       */
+      if (fc.isColourByLabel())
+      {
+        byCategory.setSelected(true);
+        colourByTextCombo.setEnabled(colourByTextCombo.getItemCount() > 1);
+        if (fc.isColourByAttribute())
+        {
+          String[] attributeName = fc.getAttributeName();
+          colourByTextCombo.setSelectedItem(
+                  FeatureMatcher.toAttributeDisplayName(attributeName));
+        }
+        else
+        {
+          colourByTextCombo.setSelectedItem(LABEL_18N);
+        }
+      }
+      else
+      {
+        colourByTextCombo.setEnabled(false);
+      }
+
+      if (!fc.isGraduatedColour())
+      {
+        colourByRangeCombo.setEnabled(false);
+        minColour.setEnabled(false);
+        maxColour.setEnabled(false);
+        noValueCombo.setEnabled(false);
+        threshold.setEnabled(false);
+        slider.setEnabled(false);
+        thresholdValue.setEnabled(false);
+        thresholdIsMin.setEnabled(false);
+        return;
+      }
+
+      /*
+       * Graduated colour, by score or attribute value range
+       */
+      graduatedColour.setSelected(true);
+      updateColourMinMax(); // ensure min, max are set
+      colourByRangeCombo.setEnabled(colourByRangeCombo.getItemCount() > 1);
+      minColour.setEnabled(true);
+      maxColour.setEnabled(true);
+      noValueCombo.setEnabled(true);
+      threshold.setEnabled(true);
+      minColour.setBackground(fc.getMinColour());
+      maxColour.setBackground(fc.getMaxColour());
+
+      if (fc.isColourByAttribute())
+      {
+        String[] attributeName = fc.getAttributeName();
+        colourByRangeCombo.setSelectedItem(
+                FeatureMatcher.toAttributeDisplayName(attributeName));
+      }
+      else
+      {
+        colourByRangeCombo.setSelectedItem(SCORE_18N);
+      }
+      Color noColour = fc.getNoColour();
+      if (noColour == null)
+      {
+        noValueCombo.setSelectedIndex(NO_COLOUR_OPTION);
+      }
+      else if (noColour.equals(fc.getMinColour()))
+      {
+        noValueCombo.setSelectedIndex(MIN_COLOUR_OPTION);
+      }
+      else if (noColour.equals(fc.getMaxColour()))
+      {
+        noValueCombo.setSelectedIndex(MAX_COLOUR_OPTION);
+      }
+
+      /*
+       * update min-max scaling if there is a range to work with,
+       * else disable the widgets (this shouldn't happen if only 
+       * valid options are offered in the combo box)
+       */
+      scaleFactor = (max == min) ? 1f : 100f / (max - min);
+      float range = (max - min) * scaleFactor;
+      slider.setMinimum((int) (min * scaleFactor));
+      slider.setMaximum((int) (max * scaleFactor));
+      slider.setMajorTickSpacing((int) (range / 10f));
+
+      threshline = new GraphLine((max - min) / 2f, "Threshold",
+              Color.black);
+      threshline.value = fc.getThreshold();
+
+      if (fc.hasThreshold())
+      {
+        threshold.setSelectedIndex(
+                fc.isAboveThreshold() ? ABOVE_THRESHOLD_OPTION
+                        : BELOW_THRESHOLD_OPTION);
+        slider.setEnabled(true);
+        slider.setValue((int) (fc.getThreshold() * scaleFactor));
+        thresholdValue.setText(String.valueOf(getRoundedSliderValue()));
+        thresholdValue.setEnabled(true);
+        thresholdIsMin.setEnabled(true);
+      }
+      else
+      {
+        slider.setEnabled(false);
+        thresholdValue.setEnabled(false);
+        thresholdIsMin.setEnabled(false);
+      }
+      thresholdIsMin.setSelected(!fc.isAutoScaled());
+    } finally
+    {
+      adjusting = false;
+    }
+  }
+
+  /**
+   * Configures the initial layout
+   */
+  private void initialise()
+  {
+    this.setLayout(new BorderLayout());
+    tabbedPane = new JTabbedPane();
+    this.add(tabbedPane, BorderLayout.CENTER);
+
+    /*
+     * an ActionListener that applies colour changes
+     */
+    changeColourAction = new ActionListener()
+    {
+      @Override
+      public void actionPerformed(ActionEvent e)
+      {
+        colourChanged(true);
+      }
+    };
+
+    /*
+     * first tab: colour options
+     */
+    JPanel coloursPanel = initialiseColoursPanel();
+    tabbedPane.addTab(MessageManager.getString("action.colour"),
+            coloursPanel);
+
+    /*
+     * second tab: filter options
+     */
+    JPanel filtersPanel = initialiseFiltersPanel();
+    tabbedPane.addTab(MessageManager.getString("label.filters"),
+            filtersPanel);
+
+    JPanel okCancelPanel = initialiseOkCancelPanel();
+
+    this.add(okCancelPanel, BorderLayout.SOUTH);
+  }
+
+  /**
+   * Updates the min-max range if Colour By selected item is Score, or an
+   * attribute, with a min-max range
+   */
+  protected void updateColourMinMax()
+  {
+    if (!graduatedColour.isSelected())
+    {
+      return;
+    }
+
+    String colourBy = (String) colourByRangeCombo.getSelectedItem();
+    float[] minMax = getMinMax(colourBy);
+
+    if (minMax != null)
+    {
+      min = minMax[0];
+      max = minMax[1];
+    }
+  }
+
+  /**
+   * Retrieves the min-max range:
+   * 

+   * of feature score, if colour or filter is by Score
+   * else of the selected attribute
+   * 
+   * 
+   * @param attName
+   * @return
+   */
+  private float[] getMinMax(String attName)
+  {
+    float[] minMax = null;
+    if (SCORE_18N.equals(attName))
+    {
+      minMax = fr.getMinMax().get(featureType)[0];
+    }
+    else
+    {
+      // colour by attribute range
+      minMax = FeatureAttributes.getInstance().getMinMax(featureType,
+              FeatureMatcher.fromAttributeDisplayName(attName));
+    }
+    return minMax;
+  }
+
+  /**
+   * Lay out fields for graduated colour (by score or attribute value)
+   * 
+   * @return
+   */
+  private JPanel initialiseGraduatedColourPanel()
+  {
+    JPanel graduatedColourPanel = new JPanel();
+    graduatedColourPanel.setLayout(
+            new BoxLayout(graduatedColourPanel, BoxLayout.Y_AXIS));
+    JvSwingUtils.createTitledBorder(graduatedColourPanel,
+            MessageManager.getString("label.graduated_colour"), true);
+    graduatedColourPanel.setBackground(Color.white);
+
+    /*
+     * first row: graduated colour radio button, score/attribute drop-down
+     */
+    JPanel graduatedChoicePanel = new JPanel(
+            new FlowLayout(FlowLayout.LEFT));
+    graduatedChoicePanel.setBackground(Color.white);
+    graduatedColour = new JRadioButton(
+            MessageManager.getString("label.by_range_of") + COLON);
+    graduatedColour.setPreferredSize(new Dimension(RADIO_WIDTH, 20));
+    graduatedColour.addItemListener(new ItemListener()
+    {
+      @Override
+      public void itemStateChanged(ItemEvent e)
+      {
+        if (graduatedColour.isSelected())
+        {
+          colourChanged(true);
+        }
+      }
+    });
+    graduatedChoicePanel.add(graduatedColour);
+
+    List attNames = FeatureAttributes.getInstance()
+            .getAttributes(featureType);
+    colourByRangeCombo = populateAttributesDropdown(attNames, true, false);
+    colourByRangeCombo.addItemListener(new ItemListener()
+    {
+      @Override
+      public void itemStateChanged(ItemEvent e)
+      {
+        colourChanged(true);
+      }
+    });
+
+    /*
+     * disable graduated colour option if no range found
+     */
+    graduatedColour.setEnabled(colourByRangeCombo.getItemCount() > 0);
+
+    graduatedChoicePanel.add(colourByRangeCombo);
+    graduatedColourPanel.add(graduatedChoicePanel);
+
+    /*
+     * second row - min/max/no colours
+     */
+    JPanel colourRangePanel = new JPanel(new FlowLayout(FlowLayout.LEFT));
+    colourRangePanel.setBackground(Color.white);
+    graduatedColourPanel.add(colourRangePanel);
+
+    minColour.setFont(JvSwingUtils.getLabelFont());
+    minColour.setBorder(BorderFactory.createLineBorder(Color.black));
+    minColour.setPreferredSize(new Dimension(40, 20));
+    minColour.setToolTipText(MessageManager.getString("label.min_colour"));
+    minColour.addMouseListener(new MouseAdapter()
+    {
+      @Override
+      public void mousePressed(MouseEvent e)
+      {
+        if (minColour.isEnabled())
+        {
+          showColourChooser(minColour, "label.select_colour_minimum_value");
+        }
+      }
+    });
+
+    maxColour.setFont(JvSwingUtils.getLabelFont());
+    maxColour.setBorder(BorderFactory.createLineBorder(Color.black));
+    maxColour.setPreferredSize(new Dimension(40, 20));
+    maxColour.setToolTipText(MessageManager.getString("label.max_colour"));
+    maxColour.addMouseListener(new MouseAdapter()
+    {
+      @Override
+      public void mousePressed(MouseEvent e)
+      {
+        if (maxColour.isEnabled())
+        {
+          showColourChooser(maxColour, "label.select_colour_maximum_value");
+        }
+      }
+    });
+    maxColour.setBorder(new LineBorder(Color.black));
+
+    /*
+     * default max colour to current colour (if a plain colour),
+     * or to Black if colour by label;  make min colour a pale
+     * version of max colour
+     */
+    FeatureColourI fc = fr.getFeatureColours().get(featureType);
+    Color bg = fc.isSimpleColour() ? fc.getColour() : Color.BLACK;
+    maxColour.setBackground(bg);
+    minColour.setBackground(ColorUtils.bleachColour(bg, 0.9f));
+
+    noValueCombo = new JComboBox<>();
+    noValueCombo.addItem(MessageManager.getString("label.no_colour"));
+    noValueCombo.addItem(MessageManager.getString("label.min_colour"));
+    noValueCombo.addItem(MessageManager.getString("label.max_colour"));
+    noValueCombo.addItemListener(new ItemListener()
+    {
+      @Override
+      public void itemStateChanged(ItemEvent e)
+      {
+        colourChanged(true);
+      }
+    });
+
+    JLabel minText = new JLabel(
+            MessageManager.getString("label.min_value") + COLON);
+    minText.setFont(JvSwingUtils.getLabelFont());
+    JLabel maxText = new JLabel(
+            MessageManager.getString("label.max_value") + COLON);
+    maxText.setFont(JvSwingUtils.getLabelFont());
+    JLabel noText = new JLabel(
+            MessageManager.getString("label.no_value") + COLON);
+    noText.setFont(JvSwingUtils.getLabelFont());
+
+    colourRangePanel.add(minText);
+    colourRangePanel.add(minColour);
+    colourRangePanel.add(maxText);
+    colourRangePanel.add(maxColour);
+    colourRangePanel.add(noText);
+    colourRangePanel.add(noValueCombo);
+
+    /*
+     * third row - threshold options and value
+     */
+    JPanel thresholdPanel = new JPanel(new FlowLayout(FlowLayout.LEFT));
+    thresholdPanel.setBackground(Color.white);
+    graduatedColourPanel.add(thresholdPanel);
+
+    threshold.addActionListener(changeColourAction);
+    threshold.setToolTipText(MessageManager
+            .getString("label.threshold_feature_display_by_score"));
+    threshold.addItem(MessageManager
+            .getString("label.threshold_feature_no_threshold")); // index 0
+    threshold.addItem(MessageManager
+            .getString("label.threshold_feature_above_threshold")); // index 1
+    threshold.addItem(MessageManager
+            .getString("label.threshold_feature_below_threshold")); // index 2
+
+    thresholdValue.addActionListener(new ActionListener()
+    {
+      @Override
+      public void actionPerformed(ActionEvent e)
+      {
+        thresholdValue_actionPerformed();
+      }
+    });
+    thresholdValue.addFocusListener(new FocusAdapter()
+    {
+      @Override
+      public void focusLost(FocusEvent e)
+      {
+        thresholdValue_actionPerformed();
+      }
+    });
+    slider.setPaintLabels(false);
+    slider.setPaintTicks(true);
+    slider.setBackground(Color.white);
+    slider.setEnabled(false);
+    slider.setOpaque(false);
+    slider.setPreferredSize(new Dimension(100, 32));
+    slider.setToolTipText(
+            MessageManager.getString("label.adjust_threshold"));
+
+    slider.addChangeListener(new ChangeListener()
+    {
+      @Override
+      public void stateChanged(ChangeEvent evt)
+      {
+        if (!adjusting)
+        {
+          thresholdValue
+                  .setText(String.valueOf(slider.getValue() / scaleFactor));
+          sliderValueChanged();
+        }
+      }
+    });
+    slider.addMouseListener(new MouseAdapter()
+    {
+      @Override
+      public void mouseReleased(MouseEvent evt)
+      {
+        /*
+         * only update Overview and/or structure colouring
+         * when threshold slider drag ends (mouse up)
+         */
+        if (ap != null)
+        {
+          ap.paintAlignment(true, true);
+        }
+      }
+    });
+
+    thresholdValue.setEnabled(false);
+    thresholdValue.setColumns(7);
+
+    thresholdPanel.add(threshold);
+    thresholdPanel.add(slider);
+    thresholdPanel.add(thresholdValue);
+
+    thresholdIsMin.setBackground(Color.white);
+    thresholdIsMin
+            .setText(MessageManager.getString("label.threshold_minmax"));
+    thresholdIsMin.setToolTipText(MessageManager
+            .getString("label.toggle_absolute_relative_display_threshold"));
+    thresholdIsMin.addActionListener(changeColourAction);
+    thresholdPanel.add(thresholdIsMin);
+
+    return graduatedColourPanel;
+  }
+
+  /**
+   * Lay out OK and Cancel buttons
+   * 
+   * @return
+   */
+  private JPanel initialiseOkCancelPanel()
+  {
+    JPanel okCancelPanel = new JPanel();
+    // okCancelPanel.setBackground(Color.white);
+    okCancelPanel.add(ok);
+    okCancelPanel.add(cancel);
+    return okCancelPanel;
+  }
+
+  /**
+   * Lay out Colour options panel, containing
+   * 
+   * plain colour, with colour picker
+   * colour by text, with choice of Label or other attribute
+   * colour by range, of score or other attribute, when available
+   * 
+   * 
+   * @return
+   */
+  private JPanel initialiseColoursPanel()
+  {
+    JPanel colourByPanel = new JPanel();
+    colourByPanel.setLayout(new BoxLayout(colourByPanel, BoxLayout.Y_AXIS));
+
+    /*
+     * simple colour radio button and colour picker
+     */
+    JPanel simpleColourPanel = new JPanel(new FlowLayout(FlowLayout.LEFT));
+    simpleColourPanel.setBackground(Color.white);
+    JvSwingUtils.createTitledBorder(simpleColourPanel,
+            MessageManager.getString("label.simple"), true);
+    colourByPanel.add(simpleColourPanel);
+
+    simpleColour = new JRadioButton(
+            MessageManager.getString("label.simple_colour"));
+    simpleColour.setPreferredSize(new Dimension(RADIO_WIDTH, 20));
+    simpleColour.addItemListener(new ItemListener()
+    {
+      @Override
+      public void itemStateChanged(ItemEvent e)
+      {
+        if (simpleColour.isSelected() && !adjusting)
+        {
+          showColourChooser(singleColour, "label.select_colour");
+        }
+      }
+
+    });
+    
+    singleColour.setFont(JvSwingUtils.getLabelFont());
+    singleColour.setBorder(BorderFactory.createLineBorder(Color.black));
+    singleColour.setPreferredSize(new Dimension(40, 20));
+    singleColour.addMouseListener(new MouseAdapter()
+    {
+      @Override
+      public void mousePressed(MouseEvent e)
+      {
+        if (simpleColour.isSelected())
+        {
+          showColourChooser(singleColour, "label.select_colour");
+        }
+      }
+    });
+    simpleColourPanel.add(simpleColour); // radio button
+    simpleColourPanel.add(singleColour); // colour picker button
+
+    /*
+     * colour by text (category) radio button and drop-down choice list
+     */
+    JPanel byTextPanel = new JPanel(new FlowLayout(FlowLayout.LEFT));
+    byTextPanel.setBackground(Color.white);
+    JvSwingUtils.createTitledBorder(byTextPanel,
+            MessageManager.getString("label.colour_by_text"), true);
+    colourByPanel.add(byTextPanel);
+    byCategory = new JRadioButton(
+            MessageManager.getString("label.by_text_of") + COLON);
+    byCategory.setPreferredSize(new Dimension(RADIO_WIDTH, 20));
+    byCategory.addItemListener(new ItemListener()
+    {
+      @Override
+      public void itemStateChanged(ItemEvent e)
+      {
+        if (byCategory.isSelected())
+        {
+          colourChanged(true);
+        }
+      }
+    });
+    byTextPanel.add(byCategory);
+
+    List attNames = FeatureAttributes.getInstance()
+            .getAttributes(featureType);
+    colourByTextCombo = populateAttributesDropdown(attNames, false, true);
+    colourByTextCombo.addItemListener(new ItemListener()
+    {
+      @Override
+      public void itemStateChanged(ItemEvent e)
+      {
+        colourChanged(true);
+      }
+    });
+    byTextPanel.add(colourByTextCombo);
+
+    /*
+     * graduated colour panel
+     */
+    JPanel graduatedColourPanel = initialiseGraduatedColourPanel();
+    colourByPanel.add(graduatedColourPanel);
+
+    /*
+     * 3 radio buttons select between simple colour, 
+     * by category (text), or graduated
+     */
+    ButtonGroup bg = new ButtonGroup();
+    bg.add(simpleColour);
+    bg.add(byCategory);
+    bg.add(graduatedColour);
+
+    return colourByPanel;
+  }
+
+  private void showColourChooser(JPanel colourPanel, String key)
+  {
+    Color col = JColorChooser.showDialog(this,
+            MessageManager.getString(key), colourPanel.getBackground());
+    if (col != null)
+    {
+      colourPanel.setBackground(col);
+      colourPanel.setForeground(col);
+    }
+    colourPanel.repaint();
+    colourChanged(true);
+  }
+
+  /**
+   * Constructs and sets the selected colour options as the colour for the feature
+   * type, and repaints the alignment, and optionally the Overview and/or
+   * structure viewer if open
+   * 
+   * @param updateStructsAndOverview
+   */
+  void colourChanged(boolean updateStructsAndOverview)
+  {
+    if (adjusting)
+    {
+      /*
+       * ignore action handlers while setting values programmatically
+       */
+      return;
+    }
+
+    /*
+     * ensure min-max range is for the latest choice of 
+     * 'graduated colour by'
+     */
+    updateColourMinMax();
+
+    FeatureColourI acg = makeColourFromInputs();
+
+    /*
+     * save the colour, and repaint stuff
+     */
+    fr.setColour(featureType, acg);
+    ap.paintAlignment(updateStructsAndOverview, updateStructsAndOverview);
+
+    updateColoursTab();
+  }
+
+  /**
+   * Converts the input values into an instance of FeatureColour
+   * 
+   * @return
+   */
+  private FeatureColourI makeColourFromInputs()
+  {
+    /*
+     * easiest case - a single colour
+     */
+    if (simpleColour.isSelected())
+    {
+      return new FeatureColour(singleColour.getBackground());
+    }
+
+    /*
+     * next easiest case - colour by Label, or attribute text
+     */
+    if (byCategory.isSelected())
+    {
+      Color c = this.getBackground();
+      FeatureColourI fc = new FeatureColour(c, c, null, 0f, 0f);
+      fc.setColourByLabel(true);
+      String byWhat = (String) colourByTextCombo.getSelectedItem();
+      if (!LABEL_18N.equals(byWhat))
+      {
+        fc.setAttributeName(
+                FeatureMatcher.fromAttributeDisplayName(byWhat));
+      }
+      return fc;
+    }
+
+    /*
+     * remaining case - graduated colour by score, or attribute value
+     */
+    Color noColour = null;
+    if (noValueCombo.getSelectedIndex() == MIN_COLOUR_OPTION)
+    {
+      noColour = minColour.getBackground();
+    }
+    else if (noValueCombo.getSelectedIndex() == MAX_COLOUR_OPTION)
+    {
+      noColour = maxColour.getBackground();
+    }
+
+    float thresh = 0f;
+    try
+    {
+      thresh = Float.valueOf(thresholdValue.getText());
+    } catch (NumberFormatException e)
+    {
+      // invalid inputs are already handled on entry
+    }
+
+    /*
+     * min-max range is to (or from) threshold value if 
+     * 'threshold is min/max' is selected 
+     */
+    float minValue = min;
+    float maxValue = max;
+    final int thresholdOption = threshold.getSelectedIndex();
+    if (thresholdIsMin.isSelected()
+            && thresholdOption == ABOVE_THRESHOLD_OPTION)
+    {
+      minValue = thresh;
+    }
+    if (thresholdIsMin.isSelected()
+            && thresholdOption == BELOW_THRESHOLD_OPTION)
+    {
+      maxValue = thresh;
+    }
+
+    /*
+     * make the graduated colour
+     */
+    FeatureColourI fc = new FeatureColour(minColour.getBackground(),
+            maxColour.getBackground(), noColour, minValue, maxValue);
+
+    /*
+     * set attribute to colour by if selected
+     */
+    String byWhat = (String) colourByRangeCombo.getSelectedItem();
+    if (!SCORE_18N.equals(byWhat))
+    {
+      fc.setAttributeName(FeatureMatcher.fromAttributeDisplayName(byWhat));
+    }
+
+    /*
+     * set threshold options and 'autoscaled' which is
+     * false if 'threshold is min/max' is selected
+     * else true (colour range is on actual range of values)
+     */
+    fc.setThreshold(thresh);
+    fc.setAutoScaled(!thresholdIsMin.isSelected());
+    fc.setAboveThreshold(thresholdOption == ABOVE_THRESHOLD_OPTION);
+    fc.setBelowThreshold(thresholdOption == BELOW_THRESHOLD_OPTION);
+
+    if (threshline == null)
+    {
+      /*
+       * todo not yet implemented: visual indication of feature threshold
+       */
+      threshline = new GraphLine((max - min) / 2f, "Threshold",
+              Color.black);
+    }
+
+    return fc;
+  }
+
+  @Override
+  protected void raiseClosed()
+  {
+    if (this.featureSettings != null)
+    {
+      featureSettings.actionPerformed(new ActionEvent(this, 0, "CLOSED"));
+    }
+  }
+
+  /**
+   * Action on OK is just to dismiss the dialog - any changes have already been
+   * applied
+   */
+  @Override
+  public void okPressed()
+  {
+  }
+
+  /**
+   * Action on Cancel is to restore colour scheme and filters as they were when
+   * the dialog was opened
+   */
+  @Override
+  public void cancelPressed()
+  {
+    fr.setColour(featureType, originalColour);
+    fr.setFeatureFilter(featureType, originalFilter);
+    ap.paintAlignment(true, true);
+  }
+
+  /**
+   * Action on text entry of a threshold value
+   */
+  protected void thresholdValue_actionPerformed()
+  {
+    try
+    {
+      adjusting = true;
+      float f = Float.parseFloat(thresholdValue.getText());
+      slider.setValue((int) (f * scaleFactor));
+      threshline.value = f;
+      thresholdValue.setBackground(Color.white); // ok
+
+      /*
+       * force repaint of any Overview window or structure
+       */
+      ap.paintAlignment(true, true);
+    } catch (NumberFormatException ex)
+    {
+      thresholdValue.setBackground(Color.red); // not ok
+    } finally
+    {
+      adjusting = false;
+    }
+  }
+
+  /**
+   * Action on change of threshold slider value. This may be done interactively
+   * (by moving the slider), or programmatically (to update the slider after
+   * manual input of a threshold value).
+   */
+  protected void sliderValueChanged()
+  {
+    threshline.value = getRoundedSliderValue();
+
+    /*
+     * repaint alignment, but not Overview or structure,
+     * to avoid overload while dragging the slider
+     */
+    colourChanged(false);
+  }
+
+  /**
+   * Converts the slider value to its absolute value by dividing by the
+   * scaleFactor. Rounding errors are squashed by forcing min/max of slider range
+   * to the actual min/max of feature score range
+   * 
+   * @return
+   */
+  private float getRoundedSliderValue()
+  {
+    int value = slider.getValue();
+    float f = value == slider.getMaximum() ? max
+            : (value == slider.getMinimum() ? min : value / scaleFactor);
+    return f;
+  }
+
+  void addActionListener(ActionListener listener)
+  {
+    if (featureSettings != null)
+    {
+      System.err.println(
+              "IMPLEMENTATION ISSUE: overwriting action listener for FeatureColourChooser");
+    }
+    featureSettings = listener;
+  }
+
+  /**
+   * A helper method to build the drop-down choice of attributes for a feature. If
+   * 'withRange' is true, then Score, and any attributes with a min-max range, are
+   * added. If 'withText' is true, Label and any known attributes are added. This
+   * allows 'categorical numerical' attributes e.g. codon position to be coloured
+   * by text.
+   * 
+   * Where metadata is available with a description for an attribute, that is
+   * added as a tooltip.
+   * 

+   * Attribute names may be 'simple' e.g. "AC" or 'compound' e.g. {"CSQ",
+   * "Allele"}. Compound names are rendered for display as (e.g.) CSQ:Allele.
+   * 

+   * This method does not add any ActionListener to the JComboBox.
+   * 
+   * @param attNames
+   * @param withRange
+   * @param withText
+   */
+  protected JComboBox populateAttributesDropdown(
+          List attNames, boolean withRange, boolean withText)
+  {
+    List displayAtts = new ArrayList<>();
+    List tooltips = new ArrayList<>();
+
+    if (withText)
+    {
+      displayAtts.add(LABEL_18N);
+      tooltips.add(MessageManager.getString("label.description"));
+    }
+    if (withRange)
+    {
+      float[][] minMax = fr.getMinMax().get(featureType);
+      if (minMax != null && minMax[0][0] != minMax[0][1])
+      {
+        displayAtts.add(SCORE_18N);
+        tooltips.add(SCORE_18N);
+      }
+    }
+
+    FeatureAttributes fa = FeatureAttributes.getInstance();
+    for (String[] attName : attNames)
+    {
+      float[] minMax = fa.getMinMax(featureType, attName);
+      boolean hasRange = minMax != null && minMax[0] != minMax[1];
+      if (!withText && !hasRange)
+      {
+        continue;
+      }
+      displayAtts.add(FeatureMatcher.toAttributeDisplayName(attName));
+      String desc = fa.getDescription(featureType, attName);
+      if (desc != null && desc.length() > MAX_TOOLTIP_LENGTH)
+      {
+        desc = desc.substring(0, MAX_TOOLTIP_LENGTH) + "...";
+      }
+      tooltips.add(desc == null ? "" : desc);
+    }
+
+    JComboBox attCombo = JvSwingUtils
+            .buildComboWithTooltips(displayAtts, tooltips);
+
+    return attCombo;
+  }
+
+  /**
+   * Populates initial layout of the feature attribute filters panel
+   */
+  private JPanel initialiseFiltersPanel()
+  {
+    filters = new ArrayList<>();
+
+    JPanel filtersPanel = new JPanel();
+    filtersPanel.setLayout(new BoxLayout(filtersPanel, BoxLayout.Y_AXIS));
+    filtersPanel.setBackground(Color.white);
+    JvSwingUtils.createTitledBorder(filtersPanel,
+            MessageManager.getString("label.filters"), true);
+
+    JPanel andOrPanel = initialiseAndOrPanel();
+    filtersPanel.add(andOrPanel);
+
+    /*
+     * panel with filters - populated by refreshFiltersDisplay, 
+     * which also sets the layout manager
+     */
+    chooseFiltersPanel = new JPanel();
+    chooseFiltersPanel.setBackground(Color.white);
+    filtersPanel.add(chooseFiltersPanel);
+
+    return filtersPanel;
+  }
+
+  /**
+   * Lays out the panel with radio buttons to AND or OR filter conditions
+   * 
+   * @return
+   */
+  private JPanel initialiseAndOrPanel()
+  {
+    JPanel andOrPanel = new JPanel(new FlowLayout(FlowLayout.LEFT));
+    andOrPanel.setBackground(Color.white);
+    andOrPanel.setBorder(BorderFactory.createLineBorder(debugBorderColour));
+    andFilters = new JRadioButton(MessageManager.getString("label.and"));
+    orFilters = new JRadioButton(MessageManager.getString("label.or"));
+    ActionListener actionListener = new ActionListener()
+    {
+      @Override
+      public void actionPerformed(ActionEvent e)
+      {
+        filtersChanged();
+      }
+    };
+    andFilters.addActionListener(actionListener);
+    orFilters.addActionListener(actionListener);
+    ButtonGroup andOr = new ButtonGroup();
+    andOr.add(andFilters);
+    andOr.add(orFilters);
+    andFilters.setSelected(true);
+    andOrPanel.add(
+            new JLabel(MessageManager.getString("label.join_conditions")));
+    andOrPanel.add(andFilters);
+    andOrPanel.add(orFilters);
+    return andOrPanel;
+  }
+
+  /**
+   * Refreshes the display to show any filters currently configured for the
+   * selected feature type (editable, with 'remove' option), plus one extra row
+   * for adding a condition. This should be called after a filter has been
+   * removed, added or amended.
+   */
+  private void updateFiltersTab()
+  {
+    /*
+     * clear the panel and list of filter conditions
+     */
+    chooseFiltersPanel.removeAll();
+    filters.clear();
+
+    /*
+     * look up attributes known for feature type
+     */
+    List attNames = FeatureAttributes.getInstance()
+            .getAttributes(featureType);
+
+    /*
+     * if this feature type has filters set, load them first
+     */
+    FeatureMatcherSetI featureFilters = fr.getFeatureFilter(featureType);
+    if (featureFilters != null)
+    {
+      if (!featureFilters.isAnded())
+      {
+        orFilters.setSelected(true);
+      }
+      featureFilters.getMatchers().forEach(matcher -> filters.add(matcher));
+    }
+
+    /*
+     * and an empty filter for the user to populate (add)
+     */
+    filters.add(FeatureMatcher.NULL_MATCHER);
+
+    /*
+     * use GridLayout to 'justify' rows to the top of the panel, until
+     * there are too many to fit in, then fall back on BoxLayout
+     */
+    if (filters.size() <= 5)
+    {
+      chooseFiltersPanel.setLayout(new GridLayout(5, 1));
+    }
+    else
+    {
+      chooseFiltersPanel.setLayout(
+              new BoxLayout(chooseFiltersPanel, BoxLayout.Y_AXIS));
+    }
+
+    /*
+     * render the conditions in rows, each in its own JPanel
+     */
+    int filterIndex = 0;
+    for (FeatureMatcherI filter : filters)
+    {
+      JPanel row = addFilter(filter, attNames, filterIndex);
+      row.setBorder(BorderFactory.createLineBorder(debugBorderColour));
+      chooseFiltersPanel.add(row);
+      filterIndex++;
+    }
+
+    this.validate();
+    this.repaint();
+  }
+
+  /**
+   * A helper method that constructs a row (panel) with one filter condition:
+   * 

+   * a drop-down list of Label, Score and attribute names to choose from
+   * a drop-down list of conditions to choose from
+   * a text field for input of a match pattern
+   * optionally, a 'remove' button
+   * 
+   * The filter values are set as defaults for the input fields. The 'remove'
+   * button is added unless the pattern is empty (incomplete filter condition).
+   * 
+   * Action handlers on these fields provide for
+   * 

+   * validate pattern field - should be numeric if condition is numeric
+   * save filters and refresh display on any (valid) change
+   * remove filter and refresh on 'Remove'
+   * update conditions list on change of Label/Score/Attribute
+   * refresh value field tooltip with min-max range on change of
+   * attribute
+   * 
+   * 
+   * @param filter
+   * @param attNames
+   * @param filterIndex
+   * @return
+   */
+  protected JPanel addFilter(FeatureMatcherI filter,
+          List attNames, int filterIndex)
+  {
+    String[] attName = filter.getAttribute();
+    Condition cond = filter.getMatcher().getCondition();
+    String pattern = filter.getMatcher().getPattern();
+
+    JPanel filterRow = new JPanel(new FlowLayout(FlowLayout.LEFT));
+    filterRow.setBackground(Color.white);
+
+    /*
+     * drop-down choice of attribute, with description as a tooltip 
+     * if we can obtain it
+     */
+    final JComboBox attCombo = populateAttributesDropdown(attNames,
+            true, true);
+    String filterBy = setSelectedAttribute(attCombo, filter);
+
+    JComboBox condCombo = new JComboBox<>();
+
+    JTextField patternField = new JTextField(8);
+    patternField.setText(pattern);
+
+    /*
+     * action handlers that validate and (if valid) apply changes
+     */
+    ActionListener actionListener = new ActionListener()
+    {
+      @Override
+      public void actionPerformed(ActionEvent e)
+      {
+        if (validateFilter(patternField, condCombo))
+        {
+          if (updateFilter(attCombo, condCombo, patternField, filterIndex))
+          {
+            filtersChanged();
+          }
+        }
+      }
+    };
+    ItemListener itemListener = new ItemListener()
+    {
+      @Override
+      public void itemStateChanged(ItemEvent e)
+      {
+        actionListener.actionPerformed(null);
+      }
+    };
+
+    if (filter == FeatureMatcher.NULL_MATCHER) // the 'add a condition' row
+    {
+      attCombo.setSelectedIndex(0);
+    }
+    else
+    {
+      attCombo.setSelectedItem(
+              FeatureMatcher.toAttributeDisplayName(attName));
+    }
+    attCombo.addItemListener(new ItemListener()
+    {
+      @Override
+      public void itemStateChanged(ItemEvent e)
+      {
+        /*
+         * on change of attribute, refresh the conditions list to
+         * ensure it is appropriate for the attribute datatype
+         */
+        populateConditions((String) attCombo.getSelectedItem(),
+                (Condition) condCombo.getSelectedItem(), condCombo,
+                patternField);
+        actionListener.actionPerformed(null);
+      }
+    });
+
+    filterRow.add(attCombo);
+
+    /*
+     * drop-down choice of test condition
+     */
+    populateConditions(filterBy, cond, condCombo, patternField);
+    condCombo.setPreferredSize(new Dimension(150, 20));
+    condCombo.addItemListener(itemListener);
+    filterRow.add(condCombo);
+
+    /*
+     * pattern to match against
+     */
+    patternField.addActionListener(actionListener);
+    patternField.addFocusListener(new FocusAdapter()
+    {
+      @Override
+      public void focusLost(FocusEvent e)
+      {
+        actionListener.actionPerformed(null);
+      }
+    });
+    filterRow.add(patternField);
+
+    /*
+     * disable pattern field for condition 'Present / NotPresent'
+     */
+    Condition selectedCondition = (Condition) condCombo.getSelectedItem();
+    if (!selectedCondition.needsAPattern())
+    {
+      patternField.setEnabled(false);
+    }
+
+    /*
+     * if a numeric condition is selected, show the value range
+     * as a tooltip on the value input field
+     */
+    setPatternTooltip(filterBy, selectedCondition, patternField);
+
+    /*
+     * add remove button if filter is populated (non-empty pattern)
+     */
+    if (!patternField.isEnabled()
+            || (pattern != null && pattern.trim().length() > 0))
+    {
+      // todo: gif for button drawing '-' or 'x'
+      JButton removeCondition = new BasicArrowButton(SwingConstants.WEST);
+      removeCondition
+              .setToolTipText(MessageManager.getString("label.delete_row"));
+      removeCondition.addActionListener(new ActionListener()
+      {
+        @Override
+        public void actionPerformed(ActionEvent e)
+        {
+          filters.remove(filterIndex);
+          filtersChanged();
+        }
+      });
+      filterRow.add(removeCondition);
+    }
+
+    return filterRow;
+  }
+
+  /**
+   * Sets the selected item in the Label/Score/Attribute drop-down to match the
+   * filter
+   * 
+   * @param attCombo
+   * @param filter
+   */
+  private String setSelectedAttribute(JComboBox attCombo,
+          FeatureMatcherI filter)
+  {
+    String item = null;
+    if (filter.isByScore())
+    {
+      item = SCORE_18N;
+    }
+    else if (filter.isByLabel())
+    {
+      item = LABEL_18N;
+    }
+    else
+    {
+      item = FeatureMatcher.toAttributeDisplayName(filter.getAttribute());
+    }
+    attCombo.setSelectedItem(item);
+    return item;
+  }
+
+  /**
+   * If a numeric comparison condition is selected, retrieve the min-max range for
+   * the value (score or attribute), and set it as a tooltip on the value file
+   * 
+   * @param attName
+   * @param selectedCondition
+   * @param patternField
+   */
+  private void setPatternTooltip(String attName,
+          Condition selectedCondition, JTextField patternField)
+  {
+    patternField.setToolTipText("");
+
+    if (selectedCondition.isNumeric())
+    {
+      float[] minMax = getMinMax(attName);
+      if (minMax != null)
+      {
+        String tip = String.format("(%s - %s)",
+                DECFMT_2_2.format(minMax[0]), DECFMT_2_2.format(minMax[1]));
+        patternField.setToolTipText(tip);
+      }
+    }
+  }
+
+  /**
+   * Populates the drop-down list of comparison conditions for the given attribute
+   * name. The conditions added depend on the datatype of the attribute values.
+   * The supplied condition is set as the selected item in the list, provided it
+   * is in the list. If the pattern is now invalid (non-numeric pattern for a
+   * numeric condition), it is cleared.
+   * 
+   * @param attName
+   * @param cond
+   * @param condCombo
+   * @param patternField
+   */
+  private void populateConditions(String attName, Condition cond,
+          JComboBox condCombo, JTextField patternField)
+  {
+    Datatype type = FeatureAttributes.getInstance().getDatatype(featureType,
+            FeatureMatcher.fromAttributeDisplayName(attName));
+    if (LABEL_18N.equals(attName))
+    {
+      type = Datatype.Character;
+    }
+    else if (SCORE_18N.equals(attName))
+    {
+      type = Datatype.Number;
+    }
+
+    /*
+     * remove itemListener before starting
+     */
+    ItemListener listener = condCombo.getItemListeners()[0];
+    condCombo.removeItemListener(listener);
+    boolean condIsValid = false;
+    condCombo.removeAllItems();
+    for (Condition c : Condition.values())
+    {
+      if ((c.isNumeric() && type != Datatype.Character)
+              || (!c.isNumeric() && type != Datatype.Number))
+      {
+        condCombo.addItem(c);
+        if (c == cond)
+        {
+          condIsValid = true;
+        }
+      }
+    }
+
+    /*
+     * set the selected condition (does nothing if not in the list)
+     */
+    if (condIsValid)
+    {
+      condCombo.setSelectedItem(cond);
+    }
+    else
+    {
+      condCombo.setSelectedIndex(0);
+    }
+
+    condCombo.addItemListener(listener);
+
+    /*
+     * clear pattern if it is now invalid for condition
+     */
+    if (((Condition) condCombo.getSelectedItem()).isNumeric())
+    {
+      try
+      {
+        String pattern = patternField.getText().trim();
+        if (pattern.length() > 0)
+        {
+          Float.valueOf(pattern);
+        }
+      } catch (NumberFormatException e)
+      {
+        patternField.setText("");
+      }
+    }
+  }
+
+  /**
+   * Answers true unless a numeric condition has been selected with a non-numeric
+   * value. Sets the value field to RED with a tooltip if in error.
+   * 
+   * If the pattern is expected but is empty, this method returns false, but does
+   * not mark the field as invalid. This supports selecting an attribute for a new
+   * condition before a match pattern has been entered.
+   * 
+   * @param value
+   * @param condCombo
+   */
+  protected boolean validateFilter(JTextField value,
+          JComboBox condCombo)
+  {
+    if (value == null || condCombo == null)
+    {
+      return true; // fields not populated
+    }
+
+    Condition cond = (Condition) condCombo.getSelectedItem();
+    if (!cond.needsAPattern())
+    {
+      return true;
+    }
+
+    value.setBackground(Color.white);
+    value.setToolTipText("");
+    String v1 = value.getText().trim();
+    if (v1.length() == 0)
+    {
+      // return false;
+    }
+
+    if (cond.isNumeric() && v1.length() > 0)
+    {
+      try
+      {
+        Float.valueOf(v1);
+      } catch (NumberFormatException e)
+      {
+        value.setBackground(Color.red);
+        value.setToolTipText(
+                MessageManager.getString("label.numeric_required"));
+        return false;
+      }
+    }
+
+    return true;
+  }
+
+  /**
+   * Constructs a filter condition from the given input fields, and replaces the
+   * condition at filterIndex with the new one. Does nothing if the pattern field
+   * is blank (unless the match condition is one that doesn't require a pattern,
+   * e.g. 'Is present'). Answers true if the filter was updated, else false.
+   * 

+   * This method may update the tooltip on the filter value field to show the
+   * value range, if a numeric condition is selected. This ensures the tooltip is
+   * updated when a numeric valued attribute is chosen on the last 'add a filter'
+   * row.
+   * 
+   * @param attCombo
+   * @param condCombo
+   * @param valueField
+   * @param filterIndex
+   */
+  protected boolean updateFilter(JComboBox attCombo,
+          JComboBox condCombo, JTextField valueField,
+          int filterIndex)
+  {
+    String attName = (String) attCombo.getSelectedItem();
+    Condition cond = (Condition) condCombo.getSelectedItem();
+    String pattern = valueField.getText().trim();
+
+    setPatternTooltip(attName, cond, valueField);
+
+    if (pattern.length() == 0 && cond.needsAPattern())
+    {
+      return false;
+    }
+
+    /*
+     * Construct a matcher that operates on Label, Score, 
+     * or named attribute
+     */
+    FeatureMatcherI km = null;
+    if (LABEL_18N.equals(attName))
+    {
+      km = FeatureMatcher.byLabel(cond, pattern);
+    }
+    else if (SCORE_18N.equals(attName))
+    {
+      km = FeatureMatcher.byScore(cond, pattern);
+    }
+    else
+    {
+      km = FeatureMatcher.byAttribute(cond, pattern,
+              FeatureMatcher.fromAttributeDisplayName(attName));
+    }
+
+    filters.set(filterIndex, km);
+
+    return true;
+  }
+
+  /**
+   * Makes the dialog visible, at the Feature Colour tab or at the Filters tab
+   * 
+   * @param coloursTab
+   */
+  public void showTab(boolean coloursTab)
+  {
+    setVisible(true);
+    tabbedPane.setSelectedIndex(coloursTab ? 0 : 1);
+  }
+
+  /**
+   * Action on any change to feature filtering, namely
+   * 

+   * change of selected attribute
+   * change of selected condition
+   * change of match pattern
+   * removal of a condition
+   * 
+   * The inputs are parsed into a combined filter and this is set for the feature
+   * type, and the alignment redrawn.
+   */
+  protected void filtersChanged()
+  {
+    /*
+     * update the filter conditions for the feature type
+     */
+    boolean anded = andFilters.isSelected();
+    FeatureMatcherSetI combined = new FeatureMatcherSet();
+
+    for (FeatureMatcherI filter : filters)
+    {
+      String pattern = filter.getMatcher().getPattern();
+      Condition condition = filter.getMatcher().getCondition();
+      if (pattern.trim().length() > 0 || !condition.needsAPattern())
+      {
+        if (anded)
+        {
+          combined.and(filter);
+        }
+        else
+        {
+          combined.or(filter);
+        }
+      }
+    }
+
+    /*
+     * save the filter conditions in the FeatureRenderer
+     * (note this might now be an empty filter with no conditions)
+     */
+    fr.setFeatureFilter(featureType, combined.isEmpty() ? null : combined);
+    ap.paintAlignment(true, true);
+
+    updateFiltersTab();
+  }
+}
diff --git a/src/jalview/gui/IdPanel.java b/src/jalview/gui/IdPanel.java
index 1f2a3ad..a1726f1 100755
--- a/src/jalview/gui/IdPanel.java
+++ b/src/jalview/gui/IdPanel.java
@@ -108,8 +108,7 @@ public class IdPanel extends JPanel
       SequenceI sequence = av.getAlignment().getSequenceAt(seq);
       StringBuilder tip = new StringBuilder(64);
       seqAnnotReport.createTooltipAnnotationReport(tip, sequence,
-              av.isShowDBRefs(), av.isShowNPFeats(),
-              sp.seqCanvas.fr.getMinMax());
+              av.isShowDBRefs(), av.isShowNPFeats(), sp.seqCanvas.fr);
       setToolTipText(JvSwingUtils.wrapTooltip(true,
               sequence.getDisplayId(true) + " " + tip.toString()));
     }
@@ -331,7 +330,8 @@ public class IdPanel extends JPanel
      *  and any non-positional features
      */
     List nlinks = Preferences.sequenceUrlLinks.getLinksForMenu();
-    for (SequenceFeature sf : sq.getFeatures().getNonPositionalFeatures())
+    List features = sq.getFeatures().getNonPositionalFeatures();
+    for (SequenceFeature sf : features)
     {
       if (sf.links != null)
       {
@@ -342,7 +342,7 @@ public class IdPanel extends JPanel
       }
     }
 
-    PopupMenu pop = new PopupMenu(alignPanel, sq, nlinks,
+    PopupMenu pop = new PopupMenu(alignPanel, sq, features,
             Preferences.getGroupURLLinks());
     pop.show(this, e.getX(), e.getY());
   }
diff --git a/src/jalview/gui/Jalview2XML.java b/src/jalview/gui/Jalview2XML.java
index 4a15024..fdc2847 100644
--- a/src/jalview/gui/Jalview2XML.java
+++ b/src/jalview/gui/Jalview2XML.java
@@ -37,6 +37,10 @@ import jalview.datamodel.SequenceGroup;
 import jalview.datamodel.SequenceI;
 import jalview.datamodel.StructureViewerModel;
 import jalview.datamodel.StructureViewerModel.StructureData;
+import jalview.datamodel.features.FeatureMatcher;
+import jalview.datamodel.features.FeatureMatcherI;
+import jalview.datamodel.features.FeatureMatcherSet;
+import jalview.datamodel.features.FeatureMatcherSetI;
 import jalview.ext.varna.RnaModel;
 import jalview.gui.StructureViewer.ViewerType;
 import jalview.io.DataSourceType;
@@ -48,6 +52,8 @@ import jalview.schemabinding.version2.Annotation;
 import jalview.schemabinding.version2.AnnotationColours;
 import jalview.schemabinding.version2.AnnotationElement;
 import jalview.schemabinding.version2.CalcIdParam;
+import jalview.schemabinding.version2.Colour;
+import jalview.schemabinding.version2.CompoundMatcher;
 import jalview.schemabinding.version2.DBRef;
 import jalview.schemabinding.version2.Features;
 import jalview.schemabinding.version2.Group;
@@ -60,6 +66,8 @@ import jalview.schemabinding.version2.MapListFrom;
 import jalview.schemabinding.version2.MapListTo;
 import jalview.schemabinding.version2.Mapping;
 import jalview.schemabinding.version2.MappingChoice;
+import jalview.schemabinding.version2.MatchCondition;
+import jalview.schemabinding.version2.MatcherSet;
 import jalview.schemabinding.version2.OtherData;
 import jalview.schemabinding.version2.PdbentryItem;
 import jalview.schemabinding.version2.Pdbids;
@@ -75,6 +83,9 @@ import jalview.schemabinding.version2.ThresholdLine;
 import jalview.schemabinding.version2.Tree;
 import jalview.schemabinding.version2.UserColours;
 import jalview.schemabinding.version2.Viewport;
+import jalview.schemabinding.version2.types.ColourThreshTypeType;
+import jalview.schemabinding.version2.types.FeatureMatcherByType;
+import jalview.schemabinding.version2.types.NoValueColour;
 import jalview.schemes.AnnotationColourGradient;
 import jalview.schemes.ColourSchemeI;
 import jalview.schemes.ColourSchemeProperty;
@@ -83,10 +94,12 @@ import jalview.schemes.ResidueProperties;
 import jalview.schemes.UserColourScheme;
 import jalview.structure.StructureSelectionManager;
 import jalview.structures.models.AAStructureBindingModel;
+import jalview.util.Format;
 import jalview.util.MessageManager;
 import jalview.util.Platform;
 import jalview.util.StringUtils;
 import jalview.util.jarInputStreamProvider;
+import jalview.util.matcher.Condition;
 import jalview.viewmodel.AlignmentViewport;
 import jalview.viewmodel.ViewportRanges;
 import jalview.viewmodel.seqfeatures.FeatureRendererSettings;
@@ -115,6 +128,7 @@ import java.net.MalformedURLException;
 import java.net.URL;
 import java.util.ArrayList;
 import java.util.Arrays;
+import java.util.Collections;
 import java.util.Enumeration;
 import java.util.HashMap;
 import java.util.HashSet;
@@ -879,15 +893,33 @@ public class Jalview2XML
         }
         if (sf.otherDetails != null)
         {
-          String key;
-          Iterator keys = sf.otherDetails.keySet().iterator();
-          while (keys.hasNext())
+          /*
+           * save feature attributes, which may be simple strings or
+           * map valued (have sub-attributes)
+           */
+          for (Entry entry : sf.otherDetails.entrySet())
           {
-            key = keys.next();
-            OtherData keyValue = new OtherData();
-            keyValue.setKey(key);
-            keyValue.setValue(sf.otherDetails.get(key).toString());
-            features.addOtherData(keyValue);
+            String key = entry.getKey();
+            Object value = entry.getValue();
+            if (value instanceof Map)
+            {
+              for (Entry subAttribute : ((Map) value)
+                      .entrySet())
+              {
+                OtherData otherData = new OtherData();
+                otherData.setKey(key);
+                otherData.setKey2(subAttribute.getKey());
+                otherData.setValue(subAttribute.getValue().toString());
+                features.addOtherData(otherData);
+              }
+            }
+            else
+            {
+              OtherData otherData = new OtherData();
+              otherData.setKey(key);
+              otherData.setValue(value.toString());
+              features.addOtherData(otherData);
+            }
           }
         }
 
@@ -1313,19 +1345,33 @@ public class Jalview2XML
       {
         jalview.schemabinding.version2.FeatureSettings fs = new jalview.schemabinding.version2.FeatureSettings();
 
-        String[] renderOrder = ap.getSeqPanel().seqCanvas
-                .getFeatureRenderer().getRenderOrder()
-                .toArray(new String[0]);
+        FeatureRenderer fr = ap.getSeqPanel().seqCanvas
+                .getFeatureRenderer();
+        String[] renderOrder = fr.getRenderOrder().toArray(new String[0]);
 
         Vector settingsAdded = new Vector<>();
         if (renderOrder != null)
         {
           for (String featureType : renderOrder)
           {
-            FeatureColourI fcol = ap.getSeqPanel().seqCanvas
-                    .getFeatureRenderer().getFeatureStyle(featureType);
             Setting setting = new Setting();
             setting.setType(featureType);
+
+            /*
+             * save any filter for the feature type
+             */
+            FeatureMatcherSetI filter = fr.getFeatureFilter(featureType);
+            if (filter != null)  {
+              Iterator filters = filter.getMatchers().iterator();
+              FeatureMatcherI firstFilter = filters.next();
+              setting.setMatcherSet(Jalview2XML.marshalFilter(
+                      firstFilter, filters, filter.isAnded()));
+            }
+
+            /*
+             * save colour scheme for the feature type
+             */
+            FeatureColourI fcol = fr.getFeatureStyle(featureType);
             if (!fcol.isSimpleColour())
             {
               setting.setColour(fcol.getMaxColour().getRGB());
@@ -1333,8 +1379,25 @@ public class Jalview2XML
               setting.setMin(fcol.getMin());
               setting.setMax(fcol.getMax());
               setting.setColourByLabel(fcol.isColourByLabel());
+              if (fcol.isColourByAttribute())
+              {
+                setting.setAttributeName(fcol.getAttributeName());
+              }
               setting.setAutoScale(fcol.isAutoScaled());
               setting.setThreshold(fcol.getThreshold());
+              Color noColour = fcol.getNoColour();
+              if (noColour == null)
+              {
+                setting.setNoValueColour(NoValueColour.NONE);
+              }
+              else if (noColour.equals(fcol.getMaxColour()))
+              {
+                setting.setNoValueColour(NoValueColour.MAX);
+              }
+              else
+              {
+                setting.setNoValueColour(NoValueColour.MIN);
+              }
               // -1 = No threshold, 0 = Below, 1 = Above
               setting.setThreshstate(fcol.isAboveThreshold() ? 1
                       : (fcol.isBelowThreshold() ? 0 : -1));
@@ -1346,7 +1409,7 @@ public class Jalview2XML
 
             setting.setDisplay(
                     av.getFeaturesDisplayed().isVisible(featureType));
-            float rorder = ap.getSeqPanel().seqCanvas.getFeatureRenderer()
+            float rorder = fr
                     .getOrder(featureType);
             if (rorder > -1)
             {
@@ -1358,8 +1421,7 @@ public class Jalview2XML
         }
 
         // is groups actually supposed to be a map here ?
-        Iterator en = ap.getSeqPanel().seqCanvas
-                .getFeatureRenderer().getFeatureGroups().iterator();
+        Iterator en = fr.getFeatureGroups().iterator();
         Vector groupsAdded = new Vector<>();
         while (en.hasNext())
         {
@@ -1370,8 +1432,7 @@ public class Jalview2XML
           }
           Group g = new Group();
           g.setName(grp);
-          g.setDisplay(((Boolean) ap.getSeqPanel().seqCanvas
-                  .getFeatureRenderer().checkGroupVisibility(grp, false))
+          g.setDisplay(((Boolean) fr.checkGroupVisibility(grp, false))
                           .booleanValue());
           fs.addGroup(g);
           groupsAdded.addElement(grp);
@@ -2962,19 +3023,46 @@ public class Jalview2XML
                     features[f].getEnd(), features[f].getScore(),
                     features[f].getFeatureGroup());
             sf.setStatus(features[f].getStatus());
+
+            /*
+             * load any feature attributes - include map-valued attributes
+             */
+            Map> mapAttributes = new HashMap<>();
             for (int od = 0; od < features[f].getOtherDataCount(); od++)
             {
               OtherData keyValue = features[f].getOtherData(od);
-              if (keyValue.getKey().startsWith("LINK"))
+              String attributeName = keyValue.getKey();
+              String attributeValue = keyValue.getValue();
+              if (attributeName.startsWith("LINK"))
               {
-                sf.addLink(keyValue.getValue());
+                sf.addLink(attributeValue);
               }
               else
               {
-                sf.setValue(keyValue.getKey(), keyValue.getValue());
+                String subAttribute = keyValue.getKey2();
+                if (subAttribute == null)
+                {
+                  // simple string-valued attribute
+                  sf.setValue(attributeName, attributeValue);
+                }
+                else
+                {
+                  // attribute 'key' has sub-attribute 'key2'
+                  if (!mapAttributes.containsKey(attributeName))
+                  {
+                    mapAttributes.put(attributeName, new HashMap<>());
+                  }
+                  mapAttributes.get(attributeName).put(subAttribute,
+                          attributeValue);
+                }
               }
-
             }
+            for (Entry> mapAttribute : mapAttributes
+                    .entrySet())
+            {
+              sf.setValue(mapAttribute.getKey(), mapAttribute.getValue());
+            }
+
             // adds feature to datasequence's feature set (since Jalview 2.10)
             al.getSequenceAt(i).addSequenceFeature(sf);
           }
@@ -4550,9 +4638,11 @@ public class Jalview2XML
       af.viewport.setShowGroupConservation(false);
     }
 
-    // recover featre settings
+    // recover feature settings
     if (jms.getFeatureSettings() != null)
     {
+      FeatureRenderer fr = af.alignPanel.getSeqPanel().seqCanvas
+              .getFeatureRenderer();
       FeaturesDisplayed fdi;
       af.viewport.setFeaturesDisplayed(fdi = new FeaturesDisplayed());
       String[] renderOrder = new String[jms.getFeatureSettings()
@@ -4564,14 +4654,51 @@ public class Jalview2XML
               .getSettingCount(); fs++)
       {
         Setting setting = jms.getFeatureSettings().getSetting(fs);
+        String featureType = setting.getType();
+
+        /*
+         * restore feature filters (if any)
+         */
+        MatcherSet filters = setting.getMatcherSet();
+        if (filters != null)
+        {
+          FeatureMatcherSetI filter = Jalview2XML
+                  .unmarshalFilter(featureType, filters);
+          if (!filter.isEmpty())
+          {
+            fr.setFeatureFilter(featureType, filter);
+          }
+        }
+
+        /*
+         * restore feature colour scheme
+         */
+        Color maxColour = new Color(setting.getColour());
         if (setting.hasMincolour())
         {
-          FeatureColourI gc = setting.hasMin()
-                  ? new FeatureColour(new Color(setting.getMincolour()),
-                          new Color(setting.getColour()), setting.getMin(),
-                          setting.getMax())
-                  : new FeatureColour(new Color(setting.getMincolour()),
-                          new Color(setting.getColour()), 0, 1);
+          /*
+           * minColour is always set unless a simple colour
+           * (including for colour by label though it doesn't use it)
+           */
+          Color minColour = new Color(setting.getMincolour());
+          Color noValueColour = minColour;
+          NoValueColour noColour = setting.getNoValueColour();
+          if (noColour == NoValueColour.NONE)
+          {
+            noValueColour = null;
+          }
+          else if (noColour == NoValueColour.MAX)
+          {
+            noValueColour = maxColour;
+          }
+          float min = setting.hasMin() ? setting.getMin() : 0f;
+          float max = setting.hasMin() ? setting.getMax() : 1f;
+          FeatureColourI gc = new FeatureColour(minColour, maxColour,
+                  noValueColour, min, max);
+          if (setting.getAttributeNameCount() > 0)
+          {
+            gc.setAttributeName(setting.getAttributeName());
+          }
           if (setting.hasThreshold())
           {
             gc.setThreshold(setting.getThreshold());
@@ -4596,26 +4723,26 @@ public class Jalview2XML
             gc.setColourByLabel(setting.getColourByLabel());
           }
           // and put in the feature colour table.
-          featureColours.put(setting.getType(), gc);
+          featureColours.put(featureType, gc);
         }
         else
         {
-          featureColours.put(setting.getType(),
-                  new FeatureColour(new Color(setting.getColour())));
+          featureColours.put(featureType,
+                  new FeatureColour(maxColour));
         }
-        renderOrder[fs] = setting.getType();
+        renderOrder[fs] = featureType;
         if (setting.hasOrder())
         {
-          featureOrder.put(setting.getType(), setting.getOrder());
+          featureOrder.put(featureType, setting.getOrder());
         }
         else
         {
-          featureOrder.put(setting.getType(), new Float(
+          featureOrder.put(featureType, new Float(
                   fs / jms.getFeatureSettings().getSettingCount()));
         }
         if (setting.getDisplay())
         {
-          fdi.setVisible(setting.getType());
+          fdi.setVisible(featureType);
         }
       }
       Map fgtable = new Hashtable<>();
@@ -4629,9 +4756,7 @@ public class Jalview2XML
       // jms.getFeatureSettings().getTransparency() : 0.0, featureOrder);
       FeatureRendererSettings frs = new FeatureRendererSettings(renderOrder,
               fgtable, featureColours, 1.0f, featureOrder);
-      af.alignPanel.getSeqPanel().seqCanvas.getFeatureRenderer()
-              .transferSettings(frs);
-
+      fr.transferSettings(frs);
     }
 
     if (view.getHiddenColumnsCount() > 0)
@@ -5333,7 +5458,7 @@ public class Jalview2XML
 
     if (this.frefedSequence == null)
     {
-      frefedSequence = new Vector();
+      frefedSequence = new Vector<>();
     }
 
     viewportsAdded.clear();
@@ -5585,4 +5710,289 @@ public class Jalview2XML
   {
     return counter++;
   }
+
+  /**
+   * Populates an XML model of the feature colour scheme for one feature type
+   * 
+   * @param featureType
+   * @param fcol
+   * @return
+   */
+  protected static jalview.schemabinding.version2.Colour marshalColour(
+          String featureType, FeatureColourI fcol)
+  {
+    jalview.schemabinding.version2.Colour col = new jalview.schemabinding.version2.Colour();
+    if (fcol.isSimpleColour())
+    {
+      col.setRGB(Format.getHexString(fcol.getColour()));
+    }
+    else
+    {
+      col.setRGB(Format.getHexString(fcol.getMaxColour()));
+      col.setMin(fcol.getMin());
+      col.setMax(fcol.getMax());
+      col.setMinRGB(jalview.util.Format.getHexString(fcol.getMinColour()));
+      col.setAutoScale(fcol.isAutoScaled());
+      col.setThreshold(fcol.getThreshold());
+      col.setColourByLabel(fcol.isColourByLabel());
+      col.setThreshType(fcol.isAboveThreshold() ? ColourThreshTypeType.ABOVE
+              : (fcol.isBelowThreshold() ? ColourThreshTypeType.BELOW
+                      : ColourThreshTypeType.NONE));
+      if (fcol.isColourByAttribute())
+      {
+        col.setAttributeName(fcol.getAttributeName());
+      }
+      Color noColour = fcol.getNoColour();
+      if (noColour == null)
+      {
+        col.setNoValueColour(NoValueColour.NONE);
+      }
+      else if (noColour == fcol.getMaxColour())
+      {
+        col.setNoValueColour(NoValueColour.MAX);
+      }
+      else
+      {
+        col.setNoValueColour(NoValueColour.MIN);
+      }
+    }
+    col.setName(featureType);
+    return col;
+  }
+
+  /**
+   * Populates an XML model of the feature filter(s) for one feature type
+   * 
+   * @param firstMatcher
+   *          the first (or only) match condition)
+   * @param filter
+   *          remaining match conditions (if any)
+   * @param and
+   *          if true, conditions are and-ed, else or-ed
+   */
+  protected static MatcherSet marshalFilter(FeatureMatcherI firstMatcher,
+          Iterator filters, boolean and)
+  {
+    MatcherSet result = new MatcherSet();
+  
+    if (filters.hasNext())
+    {
+      /*
+       * compound matcher
+       */
+      CompoundMatcher compound = new CompoundMatcher();
+      compound.setAnd(and);
+      MatcherSet matcher1 = marshalFilter(firstMatcher,
+              Collections.emptyIterator(), and);
+      compound.addMatcherSet(matcher1);
+      FeatureMatcherI nextMatcher = filters.next();
+      MatcherSet matcher2 = marshalFilter(nextMatcher, filters, and);
+      compound.addMatcherSet(matcher2);
+      result.setCompoundMatcher(compound);
+    }
+    else
+    {
+      /*
+       * single condition matcher
+       */
+      MatchCondition matcherModel = new MatchCondition();
+      matcherModel.setCondition(
+              firstMatcher.getMatcher().getCondition().getStableName());
+      matcherModel.setValue(firstMatcher.getMatcher().getPattern());
+      if (firstMatcher.isByAttribute())
+      {
+        matcherModel.setBy(FeatureMatcherByType.BYATTRIBUTE);
+        matcherModel.setAttributeName(firstMatcher.getAttribute());
+      }
+      else if (firstMatcher.isByLabel())
+      {
+        matcherModel.setBy(FeatureMatcherByType.BYLABEL);
+      }
+      else if (firstMatcher.isByScore())
+      {
+        matcherModel.setBy(FeatureMatcherByType.BYSCORE);
+      }
+      result.setMatchCondition(matcherModel);
+    }
+  
+    return result;
+  }
+
+  /**
+   * Loads one XML model of a feature filter to a Jalview object
+   * 
+   * @param featureType
+   * @param matcherSetModel
+   * @return
+   */
+  protected static FeatureMatcherSetI unmarshalFilter(
+          String featureType, MatcherSet matcherSetModel)
+  {
+    FeatureMatcherSetI result = new FeatureMatcherSet();
+    try
+    {
+      unmarshalFilterConditions(result, matcherSetModel, true);
+    } catch (IllegalStateException e)
+    {
+      // mixing AND and OR conditions perhaps
+      System.err.println(
+              String.format("Error reading filter conditions for '%s': %s",
+                      featureType, e.getMessage()));
+      // return as much as was parsed up to the error
+    }
+  
+    return result;
+  }
+
+  /**
+   * Adds feature match conditions to matcherSet as unmarshalled from XML
+   * (possibly recursively for compound conditions)
+   * 
+   * @param matcherSet
+   * @param matcherSetModel
+   * @param and
+   *          if true, multiple conditions are AND-ed, else they are OR-ed
+   * @throws IllegalStateException
+   *           if AND and OR conditions are mixed
+   */
+  protected static void unmarshalFilterConditions(
+          FeatureMatcherSetI matcherSet, MatcherSet matcherSetModel,
+          boolean and)
+  {
+    MatchCondition mc = matcherSetModel.getMatchCondition();
+    if (mc != null)
+    {
+      /*
+       * single condition
+       */
+      FeatureMatcherByType filterBy = mc.getBy();
+      Condition cond = Condition.fromString(mc.getCondition());
+      String pattern = mc.getValue();
+      FeatureMatcherI matchCondition = null;
+      if (filterBy == FeatureMatcherByType.BYLABEL)
+      {
+        matchCondition = FeatureMatcher.byLabel(cond, pattern);
+      }
+      else if (filterBy == FeatureMatcherByType.BYSCORE)
+      {
+        matchCondition = FeatureMatcher.byScore(cond, pattern);
+  
+      }
+      else if (filterBy == FeatureMatcherByType.BYATTRIBUTE)
+      {
+        String[] attNames = mc.getAttributeName();
+        matchCondition = FeatureMatcher.byAttribute(cond, pattern,
+                attNames);
+      }
+  
+      /*
+       * note this throws IllegalStateException if AND-ing to a 
+       * previously OR-ed compound condition, or vice versa
+       */
+      if (and)
+      {
+        matcherSet.and(matchCondition);
+      }
+      else
+      {
+        matcherSet.or(matchCondition);
+      }
+    }
+    else
+    {
+      /*
+       * compound condition
+       */
+      MatcherSet[] matchers = matcherSetModel.getCompoundMatcher()
+              .getMatcherSet();
+      boolean anded = matcherSetModel.getCompoundMatcher().getAnd();
+      if (matchers.length == 2)
+      {
+        unmarshalFilterConditions(matcherSet, matchers[0], anded);
+        unmarshalFilterConditions(matcherSet, matchers[1], anded);
+      }
+      else
+      {
+        System.err.println("Malformed compound filter condition");
+      }
+    }
+  }
+
+  /**
+   * Loads one XML model of a feature colour to a Jalview object
+   * 
+   * @param colourModel
+   * @return
+   */
+  protected static FeatureColourI unmarshalColour(
+          jalview.schemabinding.version2.Colour colourModel)
+  {
+    FeatureColourI colour = null;
+  
+    if (colourModel.hasMax())
+    {
+      Color mincol = null;
+      Color maxcol = null;
+      Color noValueColour = null;
+  
+      try
+      {
+        mincol = new Color(Integer.parseInt(colourModel.getMinRGB(), 16));
+        maxcol = new Color(Integer.parseInt(colourModel.getRGB(), 16));
+      } catch (Exception e)
+      {
+        Cache.log.warn("Couldn't parse out graduated feature color.", e);
+      }
+  
+      NoValueColour noCol = colourModel.getNoValueColour();
+      if (noCol == NoValueColour.MIN)
+      {
+        noValueColour = mincol;
+      }
+      else if (noCol == NoValueColour.MAX)
+      {
+        noValueColour = maxcol;
+      }
+  
+      colour = new FeatureColour(mincol, maxcol, noValueColour,
+              colourModel.getMin(),
+              colourModel.getMax());
+      String[] attributes = colourModel.getAttributeName();
+      if (attributes != null && attributes.length > 0)
+      {
+        colour.setAttributeName(attributes);
+      }
+      if (colourModel.hasAutoScale())
+      {
+        colour.setAutoScaled(colourModel.getAutoScale());
+      }
+      if (colourModel.hasColourByLabel())
+      {
+        colour.setColourByLabel(colourModel.getColourByLabel());
+      }
+      if (colourModel.hasThreshold())
+      {
+        colour.setThreshold(colourModel.getThreshold());
+      }
+      ColourThreshTypeType ttyp = colourModel.getThreshType();
+      if (ttyp != null)
+      {
+        if (ttyp == ColourThreshTypeType.ABOVE)
+        {
+          colour.setAboveThreshold(true);
+        }
+        else if (ttyp == ColourThreshTypeType.BELOW)
+        {
+          colour.setBelowThreshold(true);
+        }
+      }
+    }
+    else
+    {
+      Color color = new Color(Integer.parseInt(colourModel.getRGB(), 16));
+      colour = new FeatureColour(color);
+    }
+  
+    return colour;
+  }
 }
diff --git a/src/jalview/gui/JalviewDialog.java b/src/jalview/gui/JalviewDialog.java
index 05f5ffc..1d7bf3d 100644
--- a/src/jalview/gui/JalviewDialog.java
+++ b/src/jalview/gui/JalviewDialog.java
@@ -27,8 +27,8 @@ import java.awt.Dimension;
 import java.awt.Rectangle;
 import java.awt.event.ActionEvent;
 import java.awt.event.ActionListener;
+import java.awt.event.WindowAdapter;
 import java.awt.event.WindowEvent;
-import java.awt.event.WindowListener;
 
 import javax.swing.JButton;
 import javax.swing.JDialog;
@@ -118,55 +118,14 @@ public abstract class JalviewDialog extends JPanel
         closeDialog();
       }
     });
-    frame.addWindowListener(new WindowListener()
+    frame.addWindowListener(new WindowAdapter()
     {
-
-      @Override
-      public void windowOpened(WindowEvent e)
-      {
-        // TODO Auto-generated method stub
-
-      }
-
-      @Override
-      public void windowIconified(WindowEvent e)
-      {
-        // TODO Auto-generated method stub
-
-      }
-
-      @Override
-      public void windowDeiconified(WindowEvent e)
-      {
-        // TODO Auto-generated method stub
-
-      }
-
-      @Override
-      public void windowDeactivated(WindowEvent e)
-      {
-        // TODO Auto-generated method stub
-
-      }
-
       @Override
       public void windowClosing(WindowEvent e)
       {
         // user has cancelled the dialog
         closeDialog();
       }
-
-      @Override
-      public void windowClosed(WindowEvent e)
-      {
-      }
-
-      @Override
-      public void windowActivated(WindowEvent e)
-      {
-        // TODO Auto-generated method stub
-
-      }
     });
   }
 
@@ -177,8 +136,8 @@ public abstract class JalviewDialog extends JPanel
   {
     try
     {
-      frame.dispose();
       raiseClosed();
+      frame.dispose();
     } catch (Exception ex)
     {
     }
diff --git a/src/jalview/gui/JvSwingUtils.java b/src/jalview/gui/JvSwingUtils.java
index 0a765cb..4658668 100644
--- a/src/jalview/gui/JvSwingUtils.java
+++ b/src/jalview/gui/JvSwingUtils.java
@@ -24,14 +24,20 @@ import jalview.util.MessageManager;
 
 import java.awt.BorderLayout;
 import java.awt.Color;
+import java.awt.Component;
 import java.awt.Font;
 import java.awt.GridLayout;
 import java.awt.Rectangle;
 import java.awt.event.ActionListener;
+import java.awt.event.MouseAdapter;
+import java.awt.event.MouseEvent;
+import java.util.List;
 import java.util.Objects;
 
 import javax.swing.AbstractButton;
+import javax.swing.BorderFactory;
 import javax.swing.JButton;
+import javax.swing.JComboBox;
 import javax.swing.JComponent;
 import javax.swing.JLabel;
 import javax.swing.JMenu;
@@ -39,6 +45,8 @@ import javax.swing.JMenuItem;
 import javax.swing.JPanel;
 import javax.swing.JScrollBar;
 import javax.swing.SwingConstants;
+import javax.swing.border.Border;
+import javax.swing.border.TitledBorder;
 
 /**
  * useful functions for building Swing GUIs
@@ -304,4 +312,71 @@ public final class JvSwingUtils
     comp.setFont(JvSwingUtils.getLabelFont());
   }
 
+  /**
+   * A helper method to build a drop-down choice of values, with tooltips for
+   * the entries
+   * 
+   * @param entries
+   * @param tooltips
+   */
+  public static JComboBox buildComboWithTooltips(
+          List entries, List tooltips)
+  {
+    JComboBox combo = new JComboBox<>();
+    final ComboBoxTooltipRenderer renderer = new ComboBoxTooltipRenderer();
+    combo.setRenderer(renderer);
+    for (String attName : entries)
+    {
+      combo.addItem(attName);
+    }
+    renderer.setTooltips(tooltips);
+    final MouseAdapter mouseListener = new MouseAdapter()
+    {
+      @Override
+      public void mouseEntered(MouseEvent e)
+      {
+        int j = combo.getSelectedIndex();
+        if (j > -1)
+        {
+          combo.setToolTipText(tooltips.get(j));
+        }
+      }
+      @Override
+      public void mouseExited(MouseEvent e)
+      {
+        combo.setToolTipText(null);
+      }
+    };
+    for (Component c : combo.getComponents())
+    {
+      c.addMouseListener(mouseListener);
+    }
+    return combo;
+  }
+
+  /**
+   * Adds a titled border to the component in the default font and position (top
+   * left), optionally witht italic text
+   * 
+   * @param comp
+   * @param title
+   * @param italic
+   */
+  public static TitledBorder createTitledBorder(JComponent comp,
+          String title, boolean italic)
+  {
+    Font font = comp.getFont();
+    if (italic)
+    {
+      font = new Font(font.getName(), Font.ITALIC, font.getSize());
+    }
+    Border border = BorderFactory.createTitledBorder("");
+    TitledBorder titledBorder = BorderFactory.createTitledBorder(border,
+            title, TitledBorder.LEADING, TitledBorder.DEFAULT_POSITION,
+            font);
+    comp.setBorder(titledBorder);
+
+    return titledBorder;
+  }
+
 }
diff --git a/src/jalview/gui/PopupMenu.java b/src/jalview/gui/PopupMenu.java
index 850a09a..0cf7ef4 100644
--- a/src/jalview/gui/PopupMenu.java
+++ b/src/jalview/gui/PopupMenu.java
@@ -34,7 +34,6 @@ import jalview.datamodel.Annotation;
 import jalview.datamodel.DBRefEntry;
 import jalview.datamodel.HiddenColumns;
 import jalview.datamodel.PDBEntry;
-import jalview.datamodel.Sequence;
 import jalview.datamodel.SequenceFeature;
 import jalview.datamodel.SequenceGroup;
 import jalview.datamodel.SequenceI;
@@ -50,6 +49,7 @@ import jalview.schemes.PIDColourScheme;
 import jalview.util.GroupUrlLink;
 import jalview.util.GroupUrlLink.UrlStringTooLongException;
 import jalview.util.MessageManager;
+import jalview.util.StringUtils;
 import jalview.util.UrlLink;
 
 import java.awt.Color;
@@ -176,25 +176,31 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
    * Creates a new PopupMenu object.
    * 
    * @param ap
-   *          DOCUMENT ME!
    * @param seq
-   *          DOCUMENT ME!
+   * @param features
+   *          non-positional features (for seq not null), or positional features
+   *          at residue (for seq equal to null)
    */
-  public PopupMenu(final AlignmentPanel ap, Sequence seq,
-          List links)
+  public PopupMenu(final AlignmentPanel ap, SequenceI seq,
+          List features)
   {
-    this(ap, seq, links, null);
+    this(ap, seq, features, null);
   }
 
   /**
+   * Constructor
    * 
-   * @param ap
+   * @param alignPanel
    * @param seq
-   * @param links
+   *          the sequence under the cursor if in the Id panel, null if in the
+   *          sequence panel
+   * @param features
+   *          non-positional features if in the Id panel, features at the
+   *          clicked residue if in the sequence panel
    * @param groupLinks
    */
-  public PopupMenu(final AlignmentPanel ap, final SequenceI seq,
-          List links, List groupLinks)
+  public PopupMenu(final AlignmentPanel alignPanel, final SequenceI seq,
+          List features, List groupLinks)
   {
     // /////////////////////////////////////////////////////////
     // If this is activated from the sequence panel, the user may want to
@@ -202,7 +208,7 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
     //
     // If from the IDPanel, we must display the sequence menu
     // ////////////////////////////////////////////////////////
-    this.ap = ap;
+    this.ap = alignPanel;
     sequence = seq;
 
     for (String ff : FileFormats.getInstance().getWritableFormats(true))
@@ -237,9 +243,9 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
     /*
      * And repeat for the current selection group (if there is one):
      */
-    final List selectedGroup = (ap.av.getSelectionGroup() == null
+    final List selectedGroup = (alignPanel.av.getSelectionGroup() == null
             ? Collections. emptyList()
-            : ap.av.getSelectionGroup().getSequences());
+            : alignPanel.av.getSelectionGroup().getSequences());
     buildAnnotationTypesMenus(groupShowAnnotationsMenu,
             groupHideAnnotationsMenu, selectedGroup);
     configureReferenceAnnotationsMenu(groupAddReferenceAnnotations,
@@ -257,7 +263,7 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
     if (seq != null)
     {
       sequenceMenu.setText(sequence.getName());
-      if (seq == ap.av.getAlignment().getSeqrep())
+      if (seq == alignPanel.av.getAlignment().getSeqrep())
       {
         makeReferenceSeq.setText(
                 MessageManager.getString("action.unmark_as_reference"));
@@ -268,7 +274,7 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
                 MessageManager.getString("action.set_as_reference"));
       }
 
-      if (!ap.av.getAlignment().isNucleotide())
+      if (!alignPanel.av.getAlignment().isNucleotide())
       {
         remove(rnaStructureMenu);
       }
@@ -279,7 +285,7 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
          * add menu items to 2D-render any alignment or sequence secondary
          * structure annotation
          */
-        AlignmentAnnotation[] aas = ap.av.getAlignment()
+        AlignmentAnnotation[] aas = alignPanel.av.getAlignment()
                 .getAlignmentAnnotation();
         if (aas != null)
         {
@@ -299,7 +305,7 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
                 @Override
                 public void actionPerformed(ActionEvent e)
                 {
-                  new AppVarna(seq, aa, ap);
+                  new AppVarna(seq, aa, alignPanel);
                 }
               });
               rnaStructureMenu.add(menuItem);
@@ -328,7 +334,7 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
                 public void actionPerformed(ActionEvent e)
                 {
                   // TODO: VARNA does'nt print gaps in the sequence
-                  new AppVarna(seq, aa, ap);
+                  new AppVarna(seq, aa, alignPanel);
                 }
               });
               rnaStructureMenu.add(menuItem);
@@ -353,8 +359,8 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
       });
       add(menuItem);
 
-      if (ap.av.getSelectionGroup() != null
-              && ap.av.getSelectionGroup().getSize() > 1)
+      if (alignPanel.av.getSelectionGroup() != null
+              && alignPanel.av.getSelectionGroup().getSize() > 1)
       {
         menuItem = new JMenuItem(MessageManager
                 .formatMessage("label.represent_group_with", new Object[]
@@ -370,12 +376,12 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
         sequenceMenu.add(menuItem);
       }
 
-      if (ap.av.hasHiddenRows())
+      if (alignPanel.av.hasHiddenRows())
       {
-        final int index = ap.av.getAlignment().findIndex(seq);
+        final int index = alignPanel.av.getAlignment().findIndex(seq);
 
-        if (ap.av.adjustForHiddenSeqs(index)
-                - ap.av.adjustForHiddenSeqs(index - 1) > 1)
+        if (alignPanel.av.adjustForHiddenSeqs(index)
+                - alignPanel.av.adjustForHiddenSeqs(index - 1) > 1)
         {
           menuItem = new JMenuItem(
                   MessageManager.getString("action.reveal_sequences"));
@@ -384,10 +390,10 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
             @Override
             public void actionPerformed(ActionEvent e)
             {
-              ap.av.showSequence(index);
-              if (ap.overviewPanel != null)
+              alignPanel.av.showSequence(index);
+              if (alignPanel.overviewPanel != null)
               {
-                ap.overviewPanel.updateOverviewImage();
+                alignPanel.overviewPanel.updateOverviewImage();
               }
             }
           });
@@ -396,7 +402,7 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
       }
     }
     // for the case when no sequences are even visible
-    if (ap.av.hasHiddenRows())
+    if (alignPanel.av.hasHiddenRows())
     {
       {
         menuItem = new JMenuItem(
@@ -406,10 +412,10 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
           @Override
           public void actionPerformed(ActionEvent e)
           {
-            ap.av.showAllHiddenSeqs();
-            if (ap.overviewPanel != null)
+            alignPanel.av.showAllHiddenSeqs();
+            if (alignPanel.overviewPanel != null)
             {
-              ap.overviewPanel.updateOverviewImage();
+              alignPanel.overviewPanel.updateOverviewImage();
             }
           }
         });
@@ -418,9 +424,9 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
       }
     }
 
-    SequenceGroup sg = ap.av.getSelectionGroup();
+    SequenceGroup sg = alignPanel.av.getSelectionGroup();
     boolean isDefinedGroup = (sg != null)
-            ? ap.av.getAlignment().getGroups().contains(sg)
+            ? alignPanel.av.getAlignment().getGroups().contains(sg)
             : false;
 
     if (sg != null && sg.getSize() > 0)
@@ -458,7 +464,7 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
       Hashtable pdbe = new Hashtable<>(), reppdb = new Hashtable<>();
 
       SequenceI sqass = null;
-      for (SequenceI sq : ap.av.getSequenceSelection())
+      for (SequenceI sq : alignPanel.av.getSequenceSelection())
       {
         Vector pes = sq.getDatasetSequence().getAllPDBEntries();
         if (pes != null && pes.size() > 0)
@@ -508,24 +514,133 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
       rnaStructureMenu.setVisible(false);
     }
 
-    if (links != null && links.size() > 0)
+    addLinks(seq, features);
+
+    if (seq == null)
+    {
+      addFeatureDetails(features);
+    }
+  }
+
+  /**
+   * Add a link to show feature details for each sequence feature
+   * 
+   * @param features
+   */
+  protected void addFeatureDetails(List features)
+  {
+    if (features == null || features.isEmpty())
+    {
+      return;
+    }
+    JMenu details = new JMenu(
+            MessageManager.getString("label.feature_details"));
+    add(details);
+
+    for (final SequenceFeature sf : features)
     {
-      addFeatureLinks(seq, links);
+      int start = sf.getBegin();
+      int end = sf.getEnd();
+      String desc = null;
+      if (start == end)
+      {
+        desc = String.format("%s %d", sf.getType(), start);
+      }
+      else
+      {
+        desc = String.format("%s %d-%d", sf.getType(), start, end);
+      }
+      String tooltip = desc;
+      String description = sf.getDescription();
+      if (description != null)
+      {
+        description = StringUtils.stripHtmlTags(description);
+        if (description.length() > 12)
+        {
+          desc = desc + " " + description.substring(0, 12) + "..";
+        }
+        else
+        {
+          desc = desc + " " + description;
+        }
+        tooltip = tooltip + " " + description;
+      }
+      if (sf.getFeatureGroup() != null)
+      {
+        tooltip = tooltip + (" (" + sf.getFeatureGroup() + ")");
+      }
+      JMenuItem item = new JMenuItem(desc);
+      item.setToolTipText(tooltip);
+      item.addActionListener(new ActionListener()
+      {
+        @Override
+        public void actionPerformed(ActionEvent e)
+        {
+          showFeatureDetails(sf);
+        }
+      });
+      details.add(item);
     }
   }
 
   /**
+   * Opens a panel showing a text report of feature dteails
+   * 
+   * @param sf
+   */
+  protected void showFeatureDetails(SequenceFeature sf)
+  {
+    CutAndPasteHtmlTransfer cap = new CutAndPasteHtmlTransfer();
+    // it appears Java's CSS does not support border-collaps :-(
+    cap.addStylesheetRule("table { border-collapse: collapse;}");
+    cap.addStylesheetRule("table, td, th {border: 1px solid black;}");
+    cap.setText(sf.getDetailsReport());
+
+    Desktop.addInternalFrame(cap,
+            MessageManager.getString("label.feature_details"), 500, 500);
+  }
+
+  /**
    * Adds a 'Link' menu item with a sub-menu item for each hyperlink provided.
+   * When seq is not null, these are links for the sequence id, which may be to
+   * external web sites for the sequence accession, and/or links embedded in
+   * non-positional features. When seq is null, only links embedded in the
+   * provided features are added.
    * 
    * @param seq
-   * @param links
+   * @param features
    */
-  void addFeatureLinks(final SequenceI seq, List links)
+  void addLinks(final SequenceI seq, List features)
   {
     JMenu linkMenu = new JMenu(MessageManager.getString("action.link"));
+
+    List nlinks = null;
+    if (seq != null)
+    {
+      nlinks = Preferences.sequenceUrlLinks.getLinksForMenu();
+    }
+    else
+    {
+      nlinks = new ArrayList<>();
+    }
+
+    if (features != null)
+    {
+      for (SequenceFeature sf : features)
+      {
+        if (sf.links != null)
+        {
+          for (String link : sf.links)
+          {
+            nlinks.add(link);
+          }
+        }
+      }
+    }
+
     Map> linkset = new LinkedHashMap<>();
 
-    for (String link : links)
+    for (String link : nlinks)
     {
       UrlLink urlLink = null;
       try
@@ -548,25 +663,18 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
 
     addshowLinks(linkMenu, linkset.values());
 
-    // disable link menu if there are no valid entries
+    // only add link menu if it has entries
     if (linkMenu.getItemCount() > 0)
     {
-      linkMenu.setEnabled(true);
-    }
-    else
-    {
-      linkMenu.setEnabled(false);
-    }
-
-    if (sequence != null)
-    {
-      sequenceMenu.add(linkMenu);
-    }
-    else
-    {
-      add(linkMenu);
+      if (sequence != null)
+      {
+        sequenceMenu.add(linkMenu);
+      }
+      else
+      {
+        add(linkMenu);
+      }
     }
-
   }
 
   /**
@@ -1530,10 +1638,7 @@ public class PopupMenu extends JPopupMenu implements ColourChangeListener
               new Object[]
               { seq.getDisplayId(true) }) + "
");
       new SequenceAnnotationReport(null).createSequenceAnnotationReport(
-              contents, seq, true, true,
-              (ap.getSeqPanel().seqCanvas.fr != null)
-                      ? ap.getSeqPanel().seqCanvas.fr.getMinMax()
-                      : null);
+              contents, seq, true, true, ap.getSeqPanel().seqCanvas.fr);
       contents.append("");
     }
     cap.setText("" + contents.toString() + "");
diff --git a/src/jalview/gui/SeqPanel.java b/src/jalview/gui/SeqPanel.java
index 61cac46..fb6efe5 100644
--- a/src/jalview/gui/SeqPanel.java
+++ b/src/jalview/gui/SeqPanel.java
@@ -59,7 +59,6 @@ import java.awt.event.MouseListener;
 import java.awt.event.MouseMotionListener;
 import java.awt.event.MouseWheelEvent;
 import java.awt.event.MouseWheelListener;
-import java.util.ArrayList;
 import java.util.Collections;
 import java.util.List;
 
@@ -76,12 +75,11 @@ import javax.swing.ToolTipManager;
 public class SeqPanel extends JPanel
         implements MouseListener, MouseMotionListener, MouseWheelListener,
         SequenceListener, SelectionListener
-
 {
-  /** DOCUMENT ME!! */
+  private static final int MAX_TOOLTIP_LENGTH = 300;
+
   public SeqCanvas seqCanvas;
 
-  /** DOCUMENT ME!! */
   public AlignmentPanel ap;
 
   /*
@@ -148,35 +146,33 @@ public class SeqPanel extends JPanel
   SearchResultsI lastSearchResults;
 
   /**
-   * Creates a new SeqPanel object.
+   * Creates a new SeqPanel object
    * 
-   * @param avp
-   *          DOCUMENT ME!
-   * @param p
-   *          DOCUMENT ME!
+   * @param viewport
+   * @param alignPanel
    */
-  public SeqPanel(AlignViewport av, AlignmentPanel ap)
+  public SeqPanel(AlignViewport viewport, AlignmentPanel alignPanel)
   {
     linkImageURL = getClass().getResource("/images/link.gif");
     seqARep = new SequenceAnnotationReport(linkImageURL.toString());
     ToolTipManager.sharedInstance().registerComponent(this);
     ToolTipManager.sharedInstance().setInitialDelay(0);
     ToolTipManager.sharedInstance().setDismissDelay(10000);
-    this.av = av;
+    this.av = viewport;
     setBackground(Color.white);
 
-    seqCanvas = new SeqCanvas(ap);
+    seqCanvas = new SeqCanvas(alignPanel);
     setLayout(new BorderLayout());
     add(seqCanvas, BorderLayout.CENTER);
 
-    this.ap = ap;
+    this.ap = alignPanel;
 
-    if (!av.isDataset())
+    if (!viewport.isDataset())
     {
       addMouseMotionListener(this);
       addMouseListener(this);
       addMouseWheelListener(this);
-      ssm = av.getStructureSelectionManager();
+      ssm = viewport.getStructureSelectionManager();
       ssm.addStructureViewerListener(this);
       ssm.addSelectionListener(this);
     }
@@ -838,7 +834,7 @@ public class SeqPanel extends JPanel
       List features = ap.getFeatureRenderer()
               .findFeaturesAtColumn(sequence, column + 1);
       seqARep.appendFeatures(tooltipText, pos, features,
-              this.ap.getSeqPanel().seqCanvas.fr.getMinMax());
+              this.ap.getSeqPanel().seqCanvas.fr);
     }
     if (tooltipText.length() == 6) // 
     {
@@ -847,6 +843,11 @@ public class SeqPanel extends JPanel
     }
     else
     {
+      if (tooltipText.length() > MAX_TOOLTIP_LENGTH) // constant
+      {
+        tooltipText.setLength(MAX_TOOLTIP_LENGTH);
+        tooltipText.append("...");
+      }
       String textString = tooltipText.toString();
       if (lastTooltip == null || !lastTooltip.equals(textString))
       {
@@ -1825,21 +1826,10 @@ public class SeqPanel extends JPanel
     final int column = findColumn(evt);
     final int seq = findSeq(evt);
     SequenceI sequence = av.getAlignment().getSequenceAt(seq);
-    List allFeatures = ap.getFeatureRenderer()
+    List features = ap.getFeatureRenderer()
             .findFeaturesAtColumn(sequence, column + 1);
-    List links = new ArrayList<>();
-    for (SequenceFeature sf : allFeatures)
-    {
-      if (sf.links != null)
-      {
-        for (String link : sf.links)
-        {
-          links.add(link);
-        }
-      }
-    }
 
-    PopupMenu pop = new PopupMenu(ap, null, links);
+    PopupMenu pop = new PopupMenu(ap, null, features);
     pop.show(this, evt.getX(), evt.getY());
   }
 
diff --git a/src/jalview/io/FeaturesFile.java b/src/jalview/io/FeaturesFile.java
index d2282b1..99663c8 100755
--- a/src/jalview/io/FeaturesFile.java
+++ b/src/jalview/io/FeaturesFile.java
@@ -31,6 +31,8 @@ import jalview.datamodel.AlignmentI;
 import jalview.datamodel.SequenceDummy;
 import jalview.datamodel.SequenceFeature;
 import jalview.datamodel.SequenceI;
+import jalview.datamodel.features.FeatureMatcherSet;
+import jalview.datamodel.features.FeatureMatcherSetI;
 import jalview.io.gff.GffHelperBase;
 import jalview.io.gff.GffHelperFactory;
 import jalview.io.gff.GffHelperI;
@@ -68,6 +70,16 @@ import java.util.Map.Entry;
  */
 public class FeaturesFile extends AlignFile implements FeaturesSourceI
 {
+  private static final String TAB_REGEX = "\\t";
+
+  private static final String STARTGROUP = "STARTGROUP";
+
+  private static final String ENDGROUP = "ENDGROUP";
+
+  private static final String STARTFILTERS = "STARTFILTERS";
+
+  private static final String ENDFILTERS = "ENDFILTERS";
+
   private static final String ID_NOT_SPECIFIED = "ID_NOT_SPECIFIED";
 
   private static final String NOTE = "Note";
@@ -169,7 +181,7 @@ public class FeaturesFile extends AlignFile implements FeaturesSourceI
    * @param align
    *          - alignment/dataset containing sequences that are to be annotated
    * @param colours
-   *          - hashtable to store feature colour definitions
+   *          - map to store feature colour definitions
    * @param removeHTML
    *          - process html strings into plain text
    * @param relaxedIdmatching
@@ -180,11 +192,34 @@ public class FeaturesFile extends AlignFile implements FeaturesSourceI
           Map colours, boolean removeHTML,
           boolean relaxedIdmatching)
   {
-    Map gffProps = new HashMap();
+    return parse(align, colours, null, removeHTML, relaxedIdmatching);
+  }
+
+  /**
+   * Parse GFF or Jalview format sequence features file
+   * 
+   * @param align
+   *          - alignment/dataset containing sequences that are to be annotated
+   * @param colours
+   *          - map to store feature colour definitions
+   * @param filters
+   *          - map to store feature filter definitions
+   * @param removeHTML
+   *          - process html strings into plain text
+   * @param relaxedIdmatching
+   *          - when true, ID matches to compound sequence IDs are allowed
+   * @return true if features were added
+   */
+  public boolean parse(AlignmentI align,
+          Map colours,
+          Map filters, boolean removeHTML,
+          boolean relaxedIdmatching)
+  {
+    Map gffProps = new HashMap<>();
     /*
      * keep track of any sequences we try to create from the data
      */
-    List newseqs = new ArrayList();
+    List newseqs = new ArrayList<>();
 
     String line = null;
     try
@@ -204,7 +239,7 @@ public class FeaturesFile extends AlignFile implements FeaturesSourceI
           continue;
         }
 
-        gffColumns = line.split("\\t"); // tab as regex
+        gffColumns = line.split(TAB_REGEX);
         if (gffColumns.length == 1)
         {
           if (line.trim().equalsIgnoreCase("GFF"))
@@ -218,18 +253,23 @@ public class FeaturesFile extends AlignFile implements FeaturesSourceI
           }
         }
 
-        if (gffColumns.length > 1 && gffColumns.length < 4)
+        if (gffColumns.length > 0 && gffColumns.length < 4)
         {
           /*
            * if 2 or 3 tokens, we anticipate either 'startgroup', 'endgroup' or
            * a feature type colour specification
            */
           String ft = gffColumns[0];
-          if (ft.equalsIgnoreCase("startgroup"))
+          if (ft.equalsIgnoreCase(STARTFILTERS))
+          {
+            parseFilters(filters);
+            continue;
+          }
+          if (ft.equalsIgnoreCase(STARTGROUP))
           {
             featureGroup = gffColumns[1];
           }
-          else if (ft.equalsIgnoreCase("endgroup"))
+          else if (ft.equalsIgnoreCase(ENDGROUP))
           {
             // We should check whether this is the current group,
             // but at present there's no way of showing more than 1 group
@@ -290,6 +330,43 @@ public class FeaturesFile extends AlignFile implements FeaturesSourceI
   }
 
   /**
+   * Reads input lines from STARTFILTERS to ENDFILTERS and adds a feature type
+   * filter to the map for each line parsed. After exit from this method,
+   * nextLine() should return the line after ENDFILTERS (or we are already at
+   * end of file if ENDFILTERS was missing).
+   * 
+   * @param filters
+   * @throws IOException
+   */
+  protected void parseFilters(Map filters)
+          throws IOException
+  {
+    String line;
+    while ((line = nextLine()) != null)
+    {
+      if (line.toUpperCase().startsWith(ENDFILTERS))
+      {
+        return;
+      }
+      String[] tokens = line.split(TAB_REGEX);
+      if (tokens.length != 2)
+      {
+        System.err.println(String.format("Invalid token count %d for %d",
+                tokens.length, line));
+      }
+      else
+      {
+        String featureType = tokens[0];
+        FeatureMatcherSetI fm = FeatureMatcherSet.fromString(tokens[1]);
+        if (fm != null && filters != null)
+        {
+          filters.put(featureType, fm);
+        }
+      }
+    }
+  }
+
+  /**
    * Try to parse a Jalview format feature specification and add it as a
    * sequence feature to any matching sequences in the alignment. Returns true
    * if successful (a feature was added), or false if not.
@@ -487,15 +564,16 @@ public class FeaturesFile extends AlignFile implements FeaturesSourceI
   }
 
   /**
-   * Returns contents of a Jalview format features file, for visible features,
-   * as filtered by type and group. Features with a null group are displayed if
-   * their feature type is visible. Non-positional features may optionally be
-   * included (with no check on type or group).
+   * Returns contents of a Jalview format features file, for visible features, as
+   * filtered by type and group. Features with a null group are displayed if their
+   * feature type is visible. Non-positional features may optionally be included
+   * (with no check on type or group).
    * 
    * @param sequences
    *          source of features
    * @param visible
    *          map of colour for each visible feature type
+   * @param featureFilters
    * @param visibleFeatureGroups
    * @param includeNonPositional
    *          if true, include non-positional features (regardless of group or
@@ -504,6 +582,7 @@ public class FeaturesFile extends AlignFile implements FeaturesSourceI
    */
   public String printJalviewFormat(SequenceI[] sequences,
           Map visible,
+          Map featureFilters,
           List visibleFeatureGroups, boolean includeNonPositional)
   {
     if (!includeNonPositional && (visible == null || visible.isEmpty()))
@@ -531,10 +610,15 @@ public class FeaturesFile extends AlignFile implements FeaturesSourceI
             .toArray(new String[visible.keySet().size()]);
 
     /*
+     * feature filters if any
+     */
+    outputFeatureFilters(out, visible, featureFilters);
+
+    /*
      * sort groups alphabetically, and ensure that features with a
      * null or empty group are output after those in named groups
      */
-    List sortedGroups = new ArrayList(visibleFeatureGroups);
+    List sortedGroups = new ArrayList<>(visibleFeatureGroups);
     sortedGroups.remove(null);
     sortedGroups.remove("");
     Collections.sort(sortedGroups);
@@ -560,13 +644,76 @@ public class FeaturesFile extends AlignFile implements FeaturesSourceI
       }
     }
 
-    for (String group : sortedGroups)
+    /*
+     * positional features within groups
+     */
+    foundSome |= outputFeaturesByGroup(out, sortedGroups, types, sequences);
+
+    return foundSome ? out.toString() : "No Features Visible";
+  }
+
+  /**
+   * Outputs any feature filters defined for visible feature types, sandwiched by
+   * STARTFILTERS and ENDFILTERS lines
+   * 
+   * @param out
+   * @param visible
+   * @param featureFilters
+   */
+  void outputFeatureFilters(StringBuilder out,
+          Map visible,
+          Map featureFilters)
+  {
+    if (visible == null || featureFilters == null
+            || featureFilters.isEmpty())
+    {
+      return;
+    }
+
+    boolean first = true;
+    for (String featureType : visible.keySet())
+    {
+      FeatureMatcherSetI filter = featureFilters.get(featureType);
+      if (filter != null)
+      {
+        if (first)
+        {
+          first = false;
+          out.append(newline).append(STARTFILTERS).append(newline);
+        }
+        out.append(featureType).append(TAB).append(filter.toStableString())
+                .append(newline);
+      }
+    }
+    if (!first)
+    {
+      out.append(ENDFILTERS).append(newline).append(newline);
+    }
+
+  }
+
+  /**
+   * Appends output of sequence features within feature groups to the output
+   * buffer. Groups other than the null or empty group are sandwiched by
+   * STARTGROUP and ENDGROUP lines.
+   * 
+   * @param out
+   * @param groups
+   * @param featureTypes
+   * @param sequences
+   * @return
+   */
+  private boolean outputFeaturesByGroup(StringBuilder out,
+          List groups, String[] featureTypes, SequenceI[] sequences)
+  {
+    boolean foundSome = false;
+    for (String group : groups)
     {
       boolean isNamedGroup = (group != null && !"".equals(group));
       if (isNamedGroup)
       {
         out.append(newline);
-        out.append("STARTGROUP").append(TAB);
+        out.append(STARTGROUP).append(TAB);
         out.append(group);
         out.append(newline);
       }
@@ -577,11 +724,11 @@ public class FeaturesFile extends AlignFile implements FeaturesSourceI
       for (int i = 0; i < sequences.length; i++)
       {
         String sequenceName = sequences[i].getName();
-        List features = new ArrayList();
-        if (types.length > 0)
+        List features = new ArrayList<>();
+        if (featureTypes.length > 0)
         {
           features.addAll(sequences[i].getFeatures().getFeaturesForGroup(
-                  true, group, types));
+                  true, group, featureTypes));
         }
 
         for (SequenceFeature sequenceFeature : features)
@@ -593,13 +740,12 @@ public class FeaturesFile extends AlignFile implements FeaturesSourceI
 
       if (isNamedGroup)
       {
-        out.append("ENDGROUP").append(TAB);
+        out.append(ENDGROUP).append(TAB);
         out.append(group);
         out.append(newline);
       }
     }
-
-    return foundSome ? out.toString() : "No Features Visible";
+    return foundSome;
   }
 
   /**
@@ -688,7 +834,7 @@ public class FeaturesFile extends AlignFile implements FeaturesSourceI
       dataset = new Alignment(new SequenceI[] {});
     }
 
-    Map featureColours = new HashMap();
+    Map featureColours = new HashMap<>();
     boolean parseResult = parse(dataset, featureColours, false, true);
     if (!parseResult)
     {
@@ -748,7 +894,7 @@ public class FeaturesFile extends AlignFile implements FeaturesSourceI
 
     for (SequenceI seq : sequences)
     {
-      List features = new ArrayList();
+      List features = new ArrayList<>();
       if (includeNonPositionalFeatures)
       {
         features.addAll(seq.getFeatures().getNonPositionalFeatures());
diff --git a/src/jalview/io/SequenceAnnotationReport.java b/src/jalview/io/SequenceAnnotationReport.java
index f1ebcac..6b82671 100644
--- a/src/jalview/io/SequenceAnnotationReport.java
+++ b/src/jalview/io/SequenceAnnotationReport.java
@@ -20,13 +20,15 @@
  */
 package jalview.io;
 
+import jalview.api.FeatureColourI;
 import jalview.datamodel.DBRefEntry;
 import jalview.datamodel.DBRefSource;
 import jalview.datamodel.SequenceFeature;
 import jalview.datamodel.SequenceI;
-import jalview.io.gff.GffConstants;
 import jalview.util.MessageManager;
+import jalview.util.StringUtils;
 import jalview.util.UrlLink;
+import jalview.viewmodel.seqfeatures.FeatureRendererModel;
 
 import java.util.Arrays;
 import java.util.Collection;
@@ -58,7 +60,7 @@ public class SequenceAnnotationReport
 
   /*
    * Comparator to order DBRefEntry by Source + accession id (case-insensitive),
-   * with 'Primary' sources placed before others
+   * with 'Primary' sources placed before others, and 'chromosome' first of all
    */
   private static Comparator comparator = new Comparator()
   {
@@ -66,6 +68,14 @@ public class SequenceAnnotationReport
     @Override
     public int compare(DBRefEntry ref1, DBRefEntry ref2)
     {
+      if (ref1.isChromosome())
+      {
+        return -1;
+      }
+      if (ref2.isChromosome())
+      {
+        return 1;
+      }
       String s1 = ref1.getSource();
       String s2 = ref2.getSource();
       boolean s1Primary = isPrimarySource(s1);
@@ -78,14 +88,14 @@ public class SequenceAnnotationReport
       {
         return 1;
       }
-      int comp = s1 == null ? -1
-              : (s2 == null ? 1 : s1.compareToIgnoreCase(s2));
+      int comp = s1 == null ? -1 : (s2 == null ? 1 : s1
+              .compareToIgnoreCase(s2));
       if (comp == 0)
       {
         String a1 = ref1.getAccessionId();
         String a2 = ref2.getAccessionId();
-        comp = a1 == null ? -1
-                : (a2 == null ? 1 : a1.compareToIgnoreCase(a2));
+        comp = a1 == null ? -1 : (a2 == null ? 1 : a1
+                .compareToIgnoreCase(a2));
       }
       return comp;
     }
@@ -106,9 +116,9 @@ public class SequenceAnnotationReport
     }
   };
 
-  public SequenceAnnotationReport(String linkImageURL)
+  public SequenceAnnotationReport(String linkURL)
   {
-    this.linkImageURL = linkImageURL;
+    this.linkImageURL = linkURL;
   }
 
   /**
@@ -120,13 +130,13 @@ public class SequenceAnnotationReport
    * @param minmax
    */
   public void appendFeatures(final StringBuilder sb, int rpos,
-          List features, Map minmax)
+          List features, FeatureRendererModel fr)
   {
     if (features != null)
     {
       for (SequenceFeature feature : features)
       {
-        appendFeature(sb, rpos, minmax, feature);
+        appendFeature(sb, rpos, fr, feature);
       }
     }
   }
@@ -140,7 +150,7 @@ public class SequenceAnnotationReport
    * @param feature
    */
   void appendFeature(final StringBuilder sb, int rpos,
-          Map minmax, SequenceFeature feature)
+          FeatureRendererModel fr, SequenceFeature feature)
   {
     if (feature.isContactFeature())
     {
@@ -153,99 +163,92 @@ public class SequenceAnnotationReport
         sb.append(feature.getType()).append(" ").append(feature.getBegin())
                 .append(":").append(feature.getEnd());
       }
+      return;
     }
-    else
+
+    if (sb.length() > 6)
     {
-      if (sb.length() > 6)
+      sb.append("
");
+    }
+    // TODO: remove this hack to display link only features
+    boolean linkOnly = feature.getValue("linkonly") != null;
+    if (!linkOnly)
+    {
+      sb.append(feature.getType()).append(" ");
+      if (rpos != 0)
       {
-        sb.append("
");
+        // we are marking a positional feature
+        sb.append(feature.begin);
       }
-      // TODO: remove this hack to display link only features
-      boolean linkOnly = feature.getValue("linkonly") != null;
-      if (!linkOnly)
+      if (feature.begin != feature.end)
       {
-        sb.append(feature.getType()).append(" ");
-        if (rpos != 0)
-        {
-          // we are marking a positional feature
-          sb.append(feature.begin);
-        }
-        if (feature.begin != feature.end)
-        {
-          sb.append(" ").append(feature.end);
-        }
+        sb.append(" ").append(feature.end);
+      }
 
-        if (feature.getDescription() != null
-                && !feature.description.equals(feature.getType()))
-        {
-          String tmpString = feature.getDescription();
-          String tmp2up = tmpString.toUpperCase();
-          int startTag = tmp2up.indexOf("");
-          if (startTag > -1)
-          {
-            tmpString = tmpString.substring(startTag + 6);
-            tmp2up = tmp2up.substring(startTag + 6);
-          }
-          int endTag = tmp2up.indexOf("");
-          if (endTag > -1)
-          {
-            tmpString = tmpString.substring(0, endTag);
-            tmp2up = tmp2up.substring(0, endTag);
-          }
-          endTag = tmp2up.indexOf("");
-          if (endTag > -1)
-          {
-            tmpString = tmpString.substring(0, endTag);
-          }
+      String description = feature.getDescription();
+      if (description != null && !description.equals(feature.getType()))
+      {
+        description = StringUtils.stripHtmlTags(description);
+        sb.append("; ").append(description);
+      }
 
-          if (startTag > -1)
-          {
-            sb.append("; ").append(tmpString);
-          }
-          else
-          {
-            if (tmpString.indexOf("<") > -1 || tmpString.indexOf(">") > -1)
-            {
-              // The description does not specify html is to
-              // be used, so we must remove < > symbols
-              tmpString = tmpString.replaceAll("<", "<");
-              tmpString = tmpString.replaceAll(">", ">");
+      if (showScore(feature, fr))
+      {
+        sb.append(" Score=").append(String.valueOf(feature.getScore()));
+      }
+      String status = (String) feature.getValue("status");
+      if (status != null && status.length() > 0)
+      {
+        sb.append("; (").append(status).append(")");
+      }
 
-              sb.append("; ");
-              sb.append(tmpString);
-            }
-            else
-            {
-              sb.append("; ").append(tmpString);
-            }
-          }
-        }
-        // check score should be shown
-        if (!Float.isNaN(feature.getScore()))
+      /*
+       * add attribute value if coloured by attribute
+       */
+      if (fr != null)
+      {
+        FeatureColourI fc = fr.getFeatureColours().get(feature.getType());
+        if (fc != null && fc.isColourByAttribute())
         {
-          float[][] rng = (minmax == null) ? null
-                  : minmax.get(feature.getType());
-          if (rng != null && rng[0] != null && rng[0][0] != rng[0][1])
+          String[] attName = fc.getAttributeName();
+          String attVal = feature.getValueAsString(attName);
+          if (attVal != null)
           {
-            sb.append(" Score=").append(String.valueOf(feature.getScore()));
+            sb.append("; ").append(String.join(":", attName)).append("=")
+                    .append(attVal);
           }
         }
-        String status = (String) feature.getValue("status");
-        if (status != null && status.length() > 0)
-        {
-          sb.append("; (").append(status).append(")");
-        }
-        String clinSig = (String) feature
-                .getValue(GffConstants.CLINICAL_SIGNIFICANCE);
-        if (clinSig != null)
-        {
-          sb.append("; ").append(clinSig);
-        }
       }
     }
   }
 
   /**
+   * Answers true if score should be shown, else false. Score is shown if it is
+   * not NaN, and the feature type has a non-trivial min-max score range
+   */
+  boolean showScore(SequenceFeature feature, FeatureRendererModel fr)
+  {
+    if (Float.isNaN(feature.getScore()))
+    {
+      return false;
+    }
+    if (fr == null)
+    {
+      return true;
+    }
+    float[][] minMax = fr.getMinMax().get(feature.getType());
+
+    /*
+     * minMax[0] is the [min, max] score range for positional features
+     */
+    if (minMax == null || minMax[0] == null || minMax[0][0] == minMax[0][1])
+    {
+      return false;
+    }
+    return true;
+  }
+
+  /**
    * Format and appends any hyperlinks for the sequence feature to the string
    * buffer
    * 
@@ -268,19 +271,20 @@ public class SequenceAnnotationReport
           {
             for (List urllink : createLinksFrom(null, urlstring))
             {
-              sb.append("
 "
+              sb.append("
 "
                       + (urllink.get(0).toLowerCase()
-                              .equals(urllink.get(1).toLowerCase())
-                                      ? urllink.get(0)
-                                      : (urllink.get(0) + ":"
-                                              + urllink.get(1)))
-                      + "
");
+                              .equals(urllink.get(1).toLowerCase()) ? urllink
+                              .get(0) : (urllink.get(0) + ":" + urllink
+                              .get(1))) + "
");
             }
           } catch (Exception x)
           {
-            System.err.println(
-                    "problem when creating links from " + urlstring);
+            System.err.println("problem when creating links from "
+                    + urlstring);
             x.printStackTrace();
           }
         }
@@ -298,7 +302,7 @@ public class SequenceAnnotationReport
    */
   Collection> createLinksFrom(SequenceI seq, String link)
   {
-    Map> urlSets = new LinkedHashMap>();
+    Map> urlSets = new LinkedHashMap<>();
     UrlLink urlLink = new UrlLink(link);
     if (!urlLink.isValid())
     {
@@ -313,10 +317,10 @@ public class SequenceAnnotationReport
 
   public void createSequenceAnnotationReport(final StringBuilder tip,
           SequenceI sequence, boolean showDbRefs, boolean showNpFeats,
-          Map minmax)
+          FeatureRendererModel fr)
   {
     createSequenceAnnotationReport(tip, sequence, showDbRefs, showNpFeats,
-            minmax, false);
+            fr, false);
   }
 
   /**
@@ -331,13 +335,13 @@ public class SequenceAnnotationReport
    *          whether to include database references for the sequence
    * @param showNpFeats
    *          whether to include non-positional sequence features
-   * @param minmax
+   * @param fr
    * @param summary
    * @return
    */
   int createSequenceAnnotationReport(final StringBuilder sb,
           SequenceI sequence, boolean showDbRefs, boolean showNpFeats,
-          Map minmax, boolean summary)
+          FeatureRendererModel fr, boolean summary)
   {
     String tmp;
     sb.append("");
@@ -354,7 +358,7 @@ public class SequenceAnnotationReport
     {
       ds = ds.getDatasetSequence();
     }
-    
+
     if (showDbRefs)
     {
       maxWidth = Math.max(maxWidth, appendDbRefs(sb, ds, summary));
@@ -369,7 +373,7 @@ public class SequenceAnnotationReport
               .getNonPositionalFeatures())
       {
         int sz = -sb.length();
-        appendFeature(sb, 0, minmax, sf);
+        appendFeature(sb, 0, fr, sf);
         sz += sb.length();
         maxWidth = Math.max(maxWidth, sz);
       }
@@ -458,8 +462,7 @@ public class SequenceAnnotationReport
     }
     if (moreSources)
     {
-      sb.append("
").append(source)
-              .append(COMMA).append(ELLIPSIS);
+      sb.append("
").append(source).append(COMMA).append(ELLIPSIS);
     }
     if (ellipsis)
     {
@@ -473,10 +476,10 @@ public class SequenceAnnotationReport
 
   public void createTooltipAnnotationReport(final StringBuilder tip,
           SequenceI sequence, boolean showDbRefs, boolean showNpFeats,
-          Map minmax)
+          FeatureRendererModel fr)
   {
-    int maxWidth = createSequenceAnnotationReport(tip, sequence, showDbRefs,
-            showNpFeats, minmax, true);
+    int maxWidth = createSequenceAnnotationReport(tip, sequence,
+            showDbRefs, showNpFeats, fr, true);
 
     if (maxWidth > 60)
     {
diff --git a/src/jalview/io/gff/Gff3Helper.java b/src/jalview/io/gff/Gff3Helper.java
index c7e1d7a..a25a014 100644
--- a/src/jalview/io/gff/Gff3Helper.java
+++ b/src/jalview/io/gff/Gff3Helper.java
@@ -39,6 +39,8 @@ import java.util.Map;
  */
 public class Gff3Helper extends GffHelperBase
 {
+  public static final String ALLELES = "alleles";
+
   protected static final String TARGET = "Target";
 
   protected static final String ID = "ID";
@@ -399,7 +401,7 @@ public class Gff3Helper extends GffHelperBase
       /*
        * Ensembl returns dna variants as 'alleles'
        */
-      desc = StringUtils.listToDelimitedString(attributes.get("alleles"),
+      desc = StringUtils.listToDelimitedString(attributes.get(ALLELES),
               ",");
     }
 
diff --git a/src/jalview/io/gff/SequenceOntologyI.java b/src/jalview/io/gff/SequenceOntologyI.java
index c0570e0..307e1d1 100644
--- a/src/jalview/io/gff/SequenceOntologyI.java
+++ b/src/jalview/io/gff/SequenceOntologyI.java
@@ -42,6 +42,15 @@ public interface SequenceOntologyI
   // SO:0001060
   public static final String SEQUENCE_VARIANT = "sequence_variant";
 
+  // SO:0001819
+  public static final String SYNONYMOUS_VARIANT = "synonymous_variant";
+
+  // SO:0001992
+  public static final String NONSYNONYMOUS_VARIANT = "nonsynonymous_variant";
+
+  // SO:0001587
+  public static final String STOP_GAINED = "stop_gained";
+
   // SO:0000147
   public static final String EXON = "exon";
 
diff --git a/src/jalview/io/gff/SequenceOntologyLite.java b/src/jalview/io/gff/SequenceOntologyLite.java
index f989f7b..72e906c 100644
--- a/src/jalview/io/gff/SequenceOntologyLite.java
+++ b/src/jalview/io/gff/SequenceOntologyLite.java
@@ -44,7 +44,7 @@ public class SequenceOntologyLite implements SequenceOntologyI
    * initial selection of types of interest when processing Ensembl features
    * NB unlike the full SequenceOntology we don't traverse indirect
    * child-parent relationships here so e.g. need to list every sub-type
-   * of gene (direct or indirect) that is of interest
+   * (direct or indirect) that is of interest
    */
   // @formatter:off
   private final String[][] TERMS = new String[][] {
@@ -75,16 +75,26 @@ public class SequenceOntologyLite implements SequenceOntologyI
     // there are many more sub-types of ncRNA...
     
     /*
-     * sequence_variant sub-types:
+     * sequence_variant sub-types
      */
     { "sequence_variant", "sequence_variant" },
+    { "structural_variant", "sequence_variant" },
     { "feature_variant", "sequence_variant" },
     { "gene_variant", "sequence_variant" },
+    { "transcript_variant", "sequence_variant" },
     // NB Ensembl uses NMD_transcript_variant as if a 'transcript'
     // but we model it here correctly as per the SO
     { "NMD_transcript_variant", "sequence_variant" },
-    { "transcript_variant", "sequence_variant" },
-    { "structural_variant", "sequence_variant" },
+    { "missense_variant", "sequence_variant" },
+    { "synonymous_variant", "sequence_variant" },
+    { "frameshift_variant", "sequence_variant" },
+    { "5_prime_UTR_variant", "sequence_variant" },
+    { "3_prime_UTR_variant", "sequence_variant" },
+    { "stop_gained", "sequence_variant" },
+    { "stop_lost", "sequence_variant" },
+    { "inframe_deletion", "sequence_variant" },
+    { "inframe_insertion", "sequence_variant" },
+    { "splice_region_variant", "sequence_variant" },
     
     /*
      * no sub-types of exon or CDS yet seen in Ensembl
@@ -121,8 +131,8 @@ public class SequenceOntologyLite implements SequenceOntologyI
 
   public SequenceOntologyLite()
   {
-    termsFound = new ArrayList();
-    termsNotFound = new ArrayList();
+    termsFound = new ArrayList<>();
+    termsNotFound = new ArrayList<>();
     loadStaticData();
   }
 
@@ -131,13 +141,13 @@ public class SequenceOntologyLite implements SequenceOntologyI
    */
   private void loadStaticData()
   {
-    parents = new HashMap>();
+    parents = new HashMap<>();
     for (String[] pair : TERMS)
     {
       List p = parents.get(pair[0]);
       if (p == null)
       {
-        p = new ArrayList();
+        p = new ArrayList<>();
         parents.put(pair[0], p);
       }
       p.add(pair[1]);
diff --git a/src/jalview/io/vcf/VCFLoader.java b/src/jalview/io/vcf/VCFLoader.java
new file mode 100644
index 0000000..de2f18a
--- /dev/null
+++ b/src/jalview/io/vcf/VCFLoader.java
@@ -0,0 +1,1474 @@
+package jalview.io.vcf;
+
+import jalview.analysis.AlignmentUtils;
+import jalview.analysis.Dna;
+import jalview.api.AlignViewControllerGuiI;
+import jalview.bin.Cache;
+import jalview.datamodel.DBRefEntry;
+import jalview.datamodel.GeneLociI;
+import jalview.datamodel.Mapping;
+import jalview.datamodel.SequenceFeature;
+import jalview.datamodel.SequenceI;
+import jalview.datamodel.features.FeatureAttributeType;
+import jalview.datamodel.features.FeatureSource;
+import jalview.datamodel.features.FeatureSources;
+import jalview.ext.ensembl.EnsemblMap;
+import jalview.ext.htsjdk.HtsContigDb;
+import jalview.ext.htsjdk.VCFReader;
+import jalview.io.gff.Gff3Helper;
+import jalview.io.gff.SequenceOntologyI;
+import jalview.util.MapList;
+import jalview.util.MappingUtils;
+import jalview.util.MessageManager;
+
+import java.io.File;
+import java.io.IOException;
+import java.util.ArrayList;
+import java.util.HashMap;
+import java.util.List;
+import java.util.Map;
+import java.util.Map.Entry;
+import java.util.regex.Pattern;
+import java.util.regex.PatternSyntaxException;
+
+import htsjdk.samtools.SAMException;
+import htsjdk.samtools.SAMSequenceDictionary;
+import htsjdk.samtools.SAMSequenceRecord;
+import htsjdk.samtools.util.CloseableIterator;
+import htsjdk.variant.variantcontext.Allele;
+import htsjdk.variant.variantcontext.VariantContext;
+import htsjdk.variant.vcf.VCFHeader;
+import htsjdk.variant.vcf.VCFHeaderLine;
+import htsjdk.variant.vcf.VCFHeaderLineCount;
+import htsjdk.variant.vcf.VCFHeaderLineType;
+import htsjdk.variant.vcf.VCFInfoHeaderLine;
+
+/**
+ * A class to read VCF data (using the htsjdk) and add variants as sequence
+ * features on dna and any related protein product sequences
+ * 
+ * @author gmcarstairs
+ */
+public class VCFLoader
+{
+  /**
+   * A class to model the mapping from sequence to VCF coordinates. Cases include
+   * 
+   * a direct 1:1 mapping where the sequence is one of the VCF contigs
+   * a mapping of sequence to chromosomal coordinates, where sequence and VCF
+   * use the same reference assembly
+   * a modified mapping of sequence to chromosomal coordinates, where sequence
+   * and VCF use different reference assembles
+   * 
+   */
+  class VCFMap
+  {
+    final String chromosome;
+
+    final MapList map;
+
+    VCFMap(String chr, MapList m)
+    {
+      chromosome = chr;
+      map = m;
+    }
+
+    @Override
+    public String toString()
+    {
+      return chromosome + ":" + map.toString();
+    }
+  }
+
+  /*
+   * Lookup keys, and default values, for Preference entries that describe
+   * patterns for VCF and VEP fields to capture 
+   */
+  private static final String VEP_FIELDS_PREF = "VEP_FIELDS";
+
+  private static final String VCF_FIELDS_PREF = "VCF_FIELDS";
+
+  private static final String DEFAULT_VCF_FIELDS = ".*";
+
+  private static final String DEFAULT_VEP_FIELDS = ".*";// "Allele,Consequence,IMPACT,SWISSPROT,SIFT,PolyPhen,CLIN_SIG";
+
+  /*
+   * keys to fields of VEP CSQ consequence data
+   * see https://www.ensembl.org/info/docs/tools/vep/vep_formats.html
+   */
+  private static final String CSQ_CONSEQUENCE_KEY = "Consequence";
+  private static final String CSQ_ALLELE_KEY = "Allele";
+  private static final String CSQ_ALLELE_NUM_KEY = "ALLELE_NUM"; // 0 (ref), 1...
+  private static final String CSQ_FEATURE_KEY = "Feature"; // Ensembl stable id
+
+  /*
+   * default VCF INFO key for VEP consequence data
+   * NB this can be overridden running VEP with --vcf_info_field
+   * - we don't handle this case (require identifier to be CSQ)
+   */
+  private static final String CSQ_FIELD = "CSQ";
+
+  /*
+   * separator for fields in consequence data is '|'
+   */
+  private static final String PIPE_REGEX = "\\|";
+
+  /*
+   * key for Allele Frequency output by VEP
+   * see http://www.ensembl.org/info/docs/tools/vep/vep_formats.html
+   */
+  private static final String ALLELE_FREQUENCY_KEY = "AF";
+
+  /*
+   * delimiter that separates multiple consequence data blocks
+   */
+  private static final String COMMA = ",";
+
+  /*
+   * the feature group assigned to a VCF variant in Jalview
+   */
+  private static final String FEATURE_GROUP_VCF = "VCF";
+
+  /*
+   * internal delimiter used to build keys for assemblyMappings
+   * 
+   */
+  private static final String EXCL = "!";
+
+  /*
+   * the VCF file we are processing
+   */
+  protected String vcfFilePath;
+
+  /*
+   * mappings between VCF and sequence reference assembly regions, as 
+   * key = "species!chromosome!fromAssembly!toAssembly
+   * value = Map{fromRange, toRange}
+   */
+  private Map> assemblyMappings;
+
+  private VCFReader reader;
+
+  /*
+   * holds details of the VCF header lines (metadata)
+   */
+  private VCFHeader header;
+
+  /*
+   * a Dictionary of contigs (if present) referenced in the VCF file
+   */
+  private SAMSequenceDictionary dictionary;
+
+  /*
+   * the position (0...) of field in each block of
+   * CSQ (consequence) data (if declared in the VCF INFO header for CSQ)
+   * see http://www.ensembl.org/info/docs/tools/vep/vep_formats.html
+   */
+  private int csqConsequenceFieldIndex = -1;
+  private int csqAlleleFieldIndex = -1;
+  private int csqAlleleNumberFieldIndex = -1;
+  private int csqFeatureFieldIndex = -1;
+
+  // todo the same fields for SnpEff ANN data if wanted
+  // see http://snpeff.sourceforge.net/SnpEff_manual.html#input
+
+  /*
+   * a unique identifier under which to save metadata about feature
+   * attributes (selected INFO field data)
+   */
+  private String sourceId;
+
+  /*
+   * The INFO IDs of data that is both present in the VCF file, and
+   * also matched by any filters for data of interest
+   */
+  List vcfFieldsOfInterest;
+
+  /*
+   * The field offsets and identifiers for VEP (CSQ) data that is both present
+   * in the VCF file, and also matched by any filters for data of interest
+   * for example 0 -> Allele, 1 -> Consequence, ..., 36 -> SIFT, ...
+   */
+  Map vepFieldsOfInterest;
+
+  /**
+   * Constructor given a VCF file
+   * 
+   * @param alignment
+   */
+  public VCFLoader(String vcfFile)
+  {
+    try
+    {
+      initialise(vcfFile);
+    } catch (IOException e)
+    {
+      System.err.println("Error opening VCF file: " + e.getMessage());
+    }
+
+    // map of species!chromosome!fromAssembly!toAssembly to {fromRange, toRange}
+    assemblyMappings = new HashMap<>();
+  }
+
+  /**
+   * Starts a new thread to query and load VCF variant data on to the given
+   * sequences
+   * 
+   * This method is not thread safe - concurrent threads should use separate
+   * instances of this class.
+   * 
+   * @param seqs
+   * @param gui
+   */
+  public void loadVCF(SequenceI[] seqs, final AlignViewControllerGuiI gui)
+  {
+    if (gui != null)
+    {
+      gui.setStatus(MessageManager.getString("label.searching_vcf"));
+    }
+
+    new Thread()
+    {
+      @Override
+      public void run()
+      {
+        VCFLoader.this.doLoad(seqs, gui);
+      }
+    }.start();
+  }
+
+  /**
+   * Reads the specified contig sequence and adds its VCF variants to it
+   * 
+   * @param contig
+   *          the id of a single sequence (contig) to load
+   * @return
+   */
+  public SequenceI loadVCFContig(String contig)
+  {
+    String ref = header.getOtherHeaderLine(VCFHeader.REFERENCE_KEY)
+            .getValue();
+    if (ref.startsWith("file://"))
+    {
+      ref = ref.substring(7);
+    }
+
+    SequenceI seq = null;
+    File dbFile = new File(ref);
+
+    if (dbFile.exists())
+    {
+      HtsContigDb db = new HtsContigDb("", dbFile);
+      seq = db.getSequenceProxy(contig);
+      loadSequenceVCF(seq, ref);
+      db.close();
+    }
+    else
+    {
+      System.err.println("VCF reference not found: " + ref);
+    }
+
+    return seq;
+  }
+
+  /**
+   * Loads VCF on to one or more sequences
+   * 
+   * @param seqs
+   * @param gui
+   *          optional callback handler for messages
+   */
+  protected void doLoad(SequenceI[] seqs, AlignViewControllerGuiI gui)
+  {
+    try
+    {
+      VCFHeaderLine ref = header
+              .getOtherHeaderLine(VCFHeader.REFERENCE_KEY);
+      String vcfAssembly = ref.getValue();
+
+      int varCount = 0;
+      int seqCount = 0;
+
+      /*
+       * query for VCF overlapping each sequence in turn
+       */
+      for (SequenceI seq : seqs)
+      {
+        int added = loadSequenceVCF(seq, vcfAssembly);
+        if (added > 0)
+        {
+          seqCount++;
+          varCount += added;
+          transferAddedFeatures(seq);
+        }
+      }
+      if (gui != null)
+      {
+        String msg = MessageManager.formatMessage("label.added_vcf",
+                varCount, seqCount);
+        gui.setStatus(msg);
+        if (gui.getFeatureSettingsUI() != null)
+        {
+          gui.getFeatureSettingsUI().discoverAllFeatureData();
+        }
+      }
+    } catch (Throwable e)
+    {
+      System.err.println("Error processing VCF: " + e.getMessage());
+      e.printStackTrace();
+      if (gui != null)
+      {
+        gui.setStatus("Error occurred - see console for details");
+      }
+    } finally
+    {
+      if (reader != null)
+      {
+        try
+        {
+          reader.close();
+        } catch (IOException e)
+        {
+          // ignore
+        }
+      }
+      header = null;
+      dictionary = null;
+    }
+  }
+
+  /**
+   * Opens the VCF file and parses header data
+   * 
+   * @param filePath
+   * @throws IOException
+   */
+  private void initialise(String filePath) throws IOException
+  {
+    vcfFilePath = filePath;
+
+    reader = new VCFReader(filePath);
+
+    header = reader.getFileHeader();
+
+    try
+    {
+      dictionary = header.getSequenceDictionary();
+    } catch (SAMException e)
+    {
+      // ignore - thrown if any contig line lacks length info
+    }
+
+    sourceId = filePath;
+
+    saveMetadata(sourceId);
+
+    /*
+     * get offset of CSQ ALLELE_NUM and Feature if declared
+     */
+    parseCsqHeader();
+  }
+
+  /**
+   * Reads metadata (such as INFO field descriptions and datatypes) and saves
+   * them for future reference
+   * 
+   * @param theSourceId
+   */
+  void saveMetadata(String theSourceId)
+  {
+    List vcfFieldPatterns = getFieldMatchers(VCF_FIELDS_PREF,
+            DEFAULT_VCF_FIELDS);
+    vcfFieldsOfInterest = new ArrayList<>();
+
+    FeatureSource metadata = new FeatureSource(theSourceId);
+
+    for (VCFInfoHeaderLine info : header.getInfoHeaderLines())
+    {
+      String attributeId = info.getID();
+      String desc = info.getDescription();
+      VCFHeaderLineType type = info.getType();
+      FeatureAttributeType attType = null;
+      switch (type)
+      {
+      case Character:
+        attType = FeatureAttributeType.Character;
+        break;
+      case Flag:
+        attType = FeatureAttributeType.Flag;
+        break;
+      case Float:
+        attType = FeatureAttributeType.Float;
+        break;
+      case Integer:
+        attType = FeatureAttributeType.Integer;
+        break;
+      case String:
+        attType = FeatureAttributeType.String;
+        break;
+      }
+      metadata.setAttributeName(attributeId, desc);
+      metadata.setAttributeType(attributeId, attType);
+
+      if (isFieldWanted(attributeId, vcfFieldPatterns))
+      {
+        vcfFieldsOfInterest.add(attributeId);
+      }
+    }
+
+    FeatureSources.getInstance().addSource(theSourceId, metadata);
+  }
+
+  /**
+   * Answers true if the field id is matched by any of the filter patterns, else
+   * false. Matching is against regular expression patterns, and is not
+   * case-sensitive.
+   * 
+   * @param id
+   * @param filters
+   * @return
+   */
+  private boolean isFieldWanted(String id, List filters)
+  {
+    for (Pattern p : filters)
+    {
+      if (p.matcher(id.toUpperCase()).matches())
+      {
+        return true;
+      }
+    }
+    return false;
+  }
+
+  /**
+   * Records 'wanted' fields defined in the CSQ INFO header (if there is one).
+   * Also records the position of selected fields (Allele, ALLELE_NUM, Feature)
+   * required for processing.
+   * 

+   * CSQ fields are declared in the CSQ INFO Description e.g.
+   * 

+   * Description="Consequence ...from ... VEP. Format: Allele|Consequence|...
+   */
+  protected void parseCsqHeader()
+  {
+    List vepFieldFilters = getFieldMatchers(VEP_FIELDS_PREF,
+            DEFAULT_VEP_FIELDS);
+    vepFieldsOfInterest = new HashMap<>();
+
+    VCFInfoHeaderLine csqInfo = header.getInfoHeaderLine(CSQ_FIELD);
+    if (csqInfo == null)
+    {
+      return;
+    }
+
+    /*
+     * parse out the pipe-separated list of CSQ fields; we assume here that
+     * these form the last part of the description, and contain no spaces
+     */
+    String desc = csqInfo.getDescription();
+    int spacePos = desc.lastIndexOf(" ");
+    desc = desc.substring(spacePos + 1);
+
+    if (desc != null)
+    {
+      String[] format = desc.split(PIPE_REGEX);
+      int index = 0;
+      for (String field : format)
+      {
+        if (CSQ_CONSEQUENCE_KEY.equals(field))
+        {
+          csqConsequenceFieldIndex = index;
+        }
+        if (CSQ_ALLELE_NUM_KEY.equals(field))
+        {
+          csqAlleleNumberFieldIndex = index;
+        }
+        if (CSQ_ALLELE_KEY.equals(field))
+        {
+          csqAlleleFieldIndex = index;
+        }
+        if (CSQ_FEATURE_KEY.equals(field))
+        {
+          csqFeatureFieldIndex = index;
+        }
+
+        if (isFieldWanted(field, vepFieldFilters))
+        {
+          vepFieldsOfInterest.put(index, field);
+        }
+
+        index++;
+      }
+    }
+  }
+
+  /**
+   * Reads the Preference value for the given key, with default specified if no
+   * preference set. The value is interpreted as a comma-separated list of
+   * regular expressions, and converted into a list of compiled patterns ready
+   * for matching. Patterns are forced to upper-case for non-case-sensitive
+   * matching.
+   * 

+   * This supports user-defined filters for fields of interest to capture while
+   * processing data. For example, VCF_FIELDS = AF,AC* would mean that VCF INFO
+   * fields with an ID of AF, or starting with AC, would be matched.
+   * 
+   * @param key
+   * @param def
+   * @return
+   */
+  private List getFieldMatchers(String key, String def)
+  {
+    String pref = Cache.getDefault(key, def);
+    List patterns = new ArrayList<>();
+    String[] tokens = pref.split(",");
+    for (String token : tokens)
+    {
+      try
+      {
+      patterns.add(Pattern.compile(token.toUpperCase()));
+      } catch (PatternSyntaxException e)
+      {
+        System.err.println("Invalid pattern ignored: " + token);
+      }
+    }
+    return patterns;
+  }
+
+  /**
+   * Transfers VCF features to sequences to which this sequence has a mapping.
+   * If the mapping is 3:1, computes peptide variants from nucleotide variants.
+   * 
+   * @param seq
+   */
+  protected void transferAddedFeatures(SequenceI seq)
+  {
+    DBRefEntry[] dbrefs = seq.getDBRefs();
+    if (dbrefs == null)
+    {
+      return;
+    }
+    for (DBRefEntry dbref : dbrefs)
+    {
+      Mapping mapping = dbref.getMap();
+      if (mapping == null || mapping.getTo() == null)
+      {
+        continue;
+      }
+
+      SequenceI mapTo = mapping.getTo();
+      MapList map = mapping.getMap();
+      if (map.getFromRatio() == 3)
+      {
+        /*
+         * dna-to-peptide product mapping
+         */
+        AlignmentUtils.computeProteinFeatures(seq, mapTo, map);
+      }
+      else
+      {
+        /*
+         * nucleotide-to-nucleotide mapping e.g. transcript to CDS
+         */
+        List features = seq.getFeatures()
+                .getPositionalFeatures(SequenceOntologyI.SEQUENCE_VARIANT);
+        for (SequenceFeature sf : features)
+        {
+          if (FEATURE_GROUP_VCF.equals(sf.getFeatureGroup()))
+          {
+            transferFeature(sf, mapTo, map);
+          }
+        }
+      }
+    }
+  }
+
+  /**
+   * Tries to add overlapping variants read from a VCF file to the given sequence,
+   * and returns the number of variant features added
+   * 
+   * @param seq
+   * @param vcfAssembly
+   * @return
+   */
+  protected int loadSequenceVCF(SequenceI seq, String vcfAssembly)
+  {
+    VCFMap vcfMap = getVcfMap(seq, vcfAssembly);
+    if (vcfMap == null)
+    {
+      return 0;
+    }
+
+    /*
+     * work with the dataset sequence here
+     */
+    SequenceI dss = seq.getDatasetSequence();
+    if (dss == null)
+    {
+      dss = seq;
+    }
+    return addVcfVariants(dss, vcfMap);
+  }
+
+  /**
+   * Answers a map from sequence coordinates to VCF chromosome ranges
+   * 
+   * @param seq
+   * @param vcfAssembly
+   * @return
+   */
+  private VCFMap getVcfMap(SequenceI seq, String vcfAssembly)
+  {
+    /*
+     * simplest case: sequence has id and length matching a VCF contig
+     */
+    VCFMap vcfMap = null;
+    if (dictionary != null)
+    {
+      vcfMap = getContigMap(seq);
+    }
+    if (vcfMap != null)
+    {
+      return vcfMap;
+    }
+
+    /*
+     * otherwise, map to VCF from chromosomal coordinates 
+     * of the sequence (if known)
+     */
+    GeneLociI seqCoords = seq.getGeneLoci();
+    if (seqCoords == null)
+    {
+      Cache.log.warn(String.format(
+              "Can't query VCF for %s as chromosome coordinates not known",
+              seq.getName()));
+      return null;
+    }
+
+    String species = seqCoords.getSpeciesId();
+    String chromosome = seqCoords.getChromosomeId();
+    String seqRef = seqCoords.getAssemblyId();
+    MapList map = seqCoords.getMap();
+
+    if (!vcfSpeciesMatchesSequence(vcfAssembly, species))
+    {
+      return null;
+    }
+
+    if (vcfAssemblyMatchesSequence(vcfAssembly, seqRef))
+    {
+      return new VCFMap(chromosome, map);
+    }
+
+    if (!"GRCh38".equalsIgnoreCase(seqRef) // Ensembl
+            || !vcfAssembly.contains("Homo_sapiens_assembly19")) // gnomAD
+    {
+      return null;
+    }
+
+    /*
+     * map chromosomal coordinates from sequence to VCF if the VCF
+     * data has a different reference assembly to the sequence
+     */
+    // TODO generalise for cases other than GRCh38 -> GRCh37 !
+    // - or get the user to choose in a dialog
+
+    List toVcfRanges = new ArrayList<>();
+    List fromSequenceRanges = new ArrayList<>();
+    String toRef = "GRCh37";
+
+    for (int[] range : map.getToRanges())
+    {
+      int[] fromRange = map.locateInFrom(range[0], range[1]);
+      if (fromRange == null)
+      {
+        // corrupted map?!?
+        continue;
+      }
+
+      int[] newRange = mapReferenceRange(range, chromosome, "human", seqRef,
+              toRef);
+      if (newRange == null)
+      {
+        Cache.log.error(
+                String.format("Failed to map %s:%s:%s:%d:%d to %s", species,
+                        chromosome, seqRef, range[0], range[1], toRef));
+        continue;
+      }
+      else
+      {
+        toVcfRanges.add(newRange);
+        fromSequenceRanges.add(fromRange);
+      }
+    }
+
+    return new VCFMap(chromosome,
+            new MapList(fromSequenceRanges, toVcfRanges, 1, 1));
+  }
+
+  /**
+   * If the sequence id matches a contig declared in the VCF file, and the
+   * sequence length matches the contig length, then returns a 1:1 map of the
+   * sequence to the contig, else returns null
+   * 
+   * @param seq
+   * @return
+   */
+  private VCFMap getContigMap(SequenceI seq)
+  {
+    String id = seq.getName();
+    SAMSequenceRecord contig = dictionary.getSequence(id);
+    if (contig != null)
+    {
+      int len = seq.getLength();
+      if (len == contig.getSequenceLength())
+      {
+        MapList map = new MapList(new int[] { 1, len },
+                new int[]
+                { 1, len }, 1, 1);
+        return new VCFMap(id, map);
+      }
+    }
+    return null;
+  }
+
+  /**
+   * Answers true if we determine that the VCF data uses the same reference
+   * assembly as the sequence, else false
+   * 
+   * @param vcfAssembly
+   * @param seqRef
+   * @return
+   */
+  private boolean vcfAssemblyMatchesSequence(String vcfAssembly,
+          String seqRef)
+  {
+    // TODO improve on this stub, which handles gnomAD and
+    // hopes for the best for other cases
+
+    if ("GRCh38".equalsIgnoreCase(seqRef) // Ensembl
+            && vcfAssembly.contains("Homo_sapiens_assembly19")) // gnomAD
+    {
+      return false;
+    }
+    return true;
+  }
+
+  /**
+   * Answers true if the species inferred from the VCF reference identifier
+   * matches that for the sequence
+   * 
+   * @param vcfAssembly
+   * @param speciesId
+   * @return
+   */
+  boolean vcfSpeciesMatchesSequence(String vcfAssembly, String speciesId)
+  {
+    // PROBLEM 1
+    // there are many aliases for species - how to equate one with another?
+    // PROBLEM 2
+    // VCF ##reference header is an unstructured URI - how to extract species?
+    // perhaps check if ref includes any (Ensembl) alias of speciesId??
+    // TODO ask the user to confirm this??
+
+    if (vcfAssembly.contains("Homo_sapiens") // gnomAD exome data example
+            && "HOMO_SAPIENS".equals(speciesId)) // Ensembl species id
+    {
+      return true;
+    }
+
+    if (vcfAssembly.contains("c_elegans") // VEP VCF response example
+            && "CAENORHABDITIS_ELEGANS".equals(speciesId)) // Ensembl
+    {
+      return true;
+    }
+
+    // this is not a sustainable solution...
+
+    return false;
+  }
+
+  /**
+   * Queries the VCF reader for any variants that overlap the mapped chromosome
+   * ranges of the sequence, and adds as variant features. Returns the number of
+   * overlapping variants found.
+   * 
+   * @param seq
+   * @param map
+   *          mapping from sequence to VCF coordinates
+   * @return
+   */
+  protected int addVcfVariants(SequenceI seq, VCFMap map)
+  {
+    boolean forwardStrand = map.map.isToForwardStrand();
+
+    /*
+     * query the VCF for overlaps of each contiguous chromosomal region
+     */
+    int count = 0;
+
+    for (int[] range : map.map.getToRanges())
+    {
+      int vcfStart = Math.min(range[0], range[1]);
+      int vcfEnd = Math.max(range[0], range[1]);
+      CloseableIterator variants = reader
+              .query(map.chromosome, vcfStart, vcfEnd);
+      while (variants.hasNext())
+      {
+        VariantContext variant = variants.next();
+
+        int[] featureRange = map.map.locateInFrom(variant.getStart(),
+                variant.getEnd());
+
+        if (featureRange != null)
+        {
+          int featureStart = Math.min(featureRange[0], featureRange[1]);
+          int featureEnd = Math.max(featureRange[0], featureRange[1]);
+          count += addAlleleFeatures(seq, variant, featureStart, featureEnd,
+                  forwardStrand);
+        }
+      }
+      variants.close();
+    }
+
+    return count;
+  }
+
+  /**
+   * A convenience method to get the AF value for the given alternate allele
+   * index
+   * 
+   * @param variant
+   * @param alleleIndex
+   * @return
+   */
+  protected float getAlleleFrequency(VariantContext variant, int alleleIndex)
+  {
+    float score = 0f;
+    String attributeValue = getAttributeValue(variant,
+            ALLELE_FREQUENCY_KEY, alleleIndex);
+    if (attributeValue != null)
+    {
+      try
+      {
+        score = Float.parseFloat(attributeValue);
+      } catch (NumberFormatException e)
+      {
+        // leave as 0
+      }
+    }
+
+    return score;
+  }
+
+  /**
+   * A convenience method to get an attribute value for an alternate allele
+   * 
+   * @param variant
+   * @param attributeName
+   * @param alleleIndex
+   * @return
+   */
+  protected String getAttributeValue(VariantContext variant,
+          String attributeName, int alleleIndex)
+  {
+    Object att = variant.getAttribute(attributeName);
+
+    if (att instanceof String)
+    {
+      return (String) att;
+    }
+    else if (att instanceof ArrayList)
+    {
+      return ((List) att).get(alleleIndex);
+    }
+
+    return null;
+  }
+
+  /**
+   * Adds one variant feature for each allele in the VCF variant record, and
+   * returns the number of features added.
+   * 
+   * @param seq
+   * @param variant
+   * @param featureStart
+   * @param featureEnd
+   * @param forwardStrand
+   * @return
+   */
+  protected int addAlleleFeatures(SequenceI seq, VariantContext variant,
+          int featureStart, int featureEnd, boolean forwardStrand)
+  {
+    int added = 0;
+
+    /*
+     * Javadoc says getAlternateAlleles() imposes no order on the list returned
+     * so we proceed defensively to get them in strict order
+     */
+    int altAlleleCount = variant.getAlternateAlleles().size();
+    for (int i = 0; i < altAlleleCount; i++)
+    {
+      added += addAlleleFeature(seq, variant, i, featureStart, featureEnd,
+              forwardStrand);
+    }
+    return added;
+  }
+
+  /**
+   * Inspects one allele and attempts to add a variant feature for it to the
+   * sequence. The additional data associated with this allele is extracted to
+   * store in the feature's key-value map. Answers the number of features added (0
+   * or 1).
+   * 
+   * @param seq
+   * @param variant
+   * @param altAlleleIndex
+   *          (0, 1..)
+   * @param featureStart
+   * @param featureEnd
+   * @param forwardStrand
+   * @return
+   */
+  protected int addAlleleFeature(SequenceI seq, VariantContext variant,
+          int altAlleleIndex, int featureStart, int featureEnd,
+          boolean forwardStrand)
+  {
+    String reference = variant.getReference().getBaseString();
+    Allele alt = variant.getAlternateAllele(altAlleleIndex);
+    String allele = alt.getBaseString();
+
+    /*
+     * insertion after a genomic base, if on reverse strand, has to be 
+     * converted to insertion of complement after the preceding position 
+     */
+    int referenceLength = reference.length();
+    if (!forwardStrand && allele.length() > referenceLength
+            && allele.startsWith(reference))
+    {
+      featureStart -= referenceLength;
+      featureEnd = featureStart;
+      char insertAfter = seq.getCharAt(featureStart - seq.getStart());
+      reference = Dna.reverseComplement(String.valueOf(insertAfter));
+      allele = allele.substring(referenceLength) + reference;
+    }
+
+    /*
+     * build the ref,alt allele description e.g. "G,A", using the base
+     * complement if the sequence is on the reverse strand
+     */
+    StringBuilder sb = new StringBuilder();
+    sb.append(forwardStrand ? reference : Dna.reverseComplement(reference));
+    sb.append(COMMA);
+    sb.append(forwardStrand ? allele : Dna.reverseComplement(allele));
+    String alleles = sb.toString(); // e.g. G,A
+
+    /*
+     * pick out the consequence data (if any) that is for the current allele
+     * and feature (transcript) that matches the current sequence
+     */
+    String consequence = getConsequenceForAlleleAndFeature(variant, CSQ_FIELD,
+            altAlleleIndex, csqAlleleFieldIndex,
+            csqAlleleNumberFieldIndex, seq.getName().toLowerCase(),
+            csqFeatureFieldIndex);
+
+    /*
+     * pick out the ontology term for the consequence type
+     */
+    String type = SequenceOntologyI.SEQUENCE_VARIANT;
+    if (consequence != null)
+    {
+      type = getOntologyTerm(consequence);
+    }
+
+    float score = getAlleleFrequency(variant, altAlleleIndex);
+
+    SequenceFeature sf = new SequenceFeature(type, alleles, featureStart,
+            featureEnd, score, FEATURE_GROUP_VCF);
+    sf.setSource(sourceId);
+
+    sf.setValue(Gff3Helper.ALLELES, alleles);
+
+    addAlleleProperties(variant, sf, altAlleleIndex, consequence);
+
+    seq.addSequenceFeature(sf);
+
+    return 1;
+  }
+
+  /**
+   * Determines the Sequence Ontology term to use for the variant feature type in
+   * Jalview. The default is 'sequence_variant', but a more specific term is used
+   * if:
+   * 

+   * VEP (or SnpEff) Consequence annotation is included in the VCF
+   * sequence id can be matched to VEP Feature (or SnpEff Feature_ID)
+   * 
+   * 
+   * @param consequence
+   * @return
+   * @see http://www.sequenceontology.org/browser/current_svn/term/SO:0001060
+   */
+  String getOntologyTerm(String consequence)
+  {
+    String type = SequenceOntologyI.SEQUENCE_VARIANT;
+
+    /*
+     * could we associate Consequence data with this allele and feature (transcript)?
+     * if so, prefer the consequence term from that data
+     */
+    if (csqAlleleFieldIndex == -1) // && snpEffAlleleFieldIndex == -1
+    {
+      /*
+       * no Consequence data so we can't refine the ontology term
+       */
+      return type;
+    }
+
+    if (consequence != null)
+    {
+      String[] csqFields = consequence.split(PIPE_REGEX);
+      if (csqFields.length > csqConsequenceFieldIndex)
+      {
+        type = csqFields[csqConsequenceFieldIndex];
+      }
+    }
+    else
+    {
+      // todo the same for SnpEff consequence data matching if wanted
+    }
+
+    /*
+     * if of the form (e.g.) missense_variant&splice_region_variant,
+     * just take the first ('most severe') consequence
+     */
+    if (type != null)
+    {
+      int pos = type.indexOf('&');
+      if (pos > 0)
+      {
+        type = type.substring(0, pos);
+      }
+    }
+    return type;
+  }
+
+  /**
+   * Returns matched consequence data if it can be found, else null.
+   * 
+   * inspects the VCF data for key 'vcfInfoId'
+   * splits this on comma (to distinct consequences)
+   * returns the first consequence (if any) where
+   * 
+   * the allele matches the altAlleleIndex'th allele of variant
+   * the feature matches the sequence name (e.g. transcript id)
+   * 
+   * 
+   * If matched, the consequence is returned (as pipe-delimited fields).
+   * 
+   * @param variant
+   * @param vcfInfoId
+   * @param altAlleleIndex
+   * @param alleleFieldIndex
+   * @param alleleNumberFieldIndex
+   * @param seqName
+   * @param featureFieldIndex
+   * @return
+   */
+  private String getConsequenceForAlleleAndFeature(VariantContext variant,
+          String vcfInfoId, int altAlleleIndex, int alleleFieldIndex,
+          int alleleNumberFieldIndex,
+          String seqName, int featureFieldIndex)
+  {
+    if (alleleFieldIndex == -1 || featureFieldIndex == -1)
+    {
+      return null;
+    }
+    Object value = variant.getAttribute(vcfInfoId);
+
+    if (value == null || !(value instanceof List))
+    {
+      return null;
+    }
+
+    /*
+     * inspect each consequence in turn (comma-separated blocks
+     * extracted by htsjdk)
+     */
+    List consequences = (List) value;
+
+    for (String consequence : consequences)
+    {
+      String[] csqFields = consequence.split(PIPE_REGEX);
+      if (csqFields.length > featureFieldIndex)
+      {
+        String featureIdentifier = csqFields[featureFieldIndex];
+        if (featureIdentifier.length() > 4
+                && seqName.indexOf(featureIdentifier.toLowerCase()) > -1)
+        {
+          /*
+           * feature (transcript) matched - now check for allele match
+           */
+          if (matchAllele(variant, altAlleleIndex, csqFields,
+                  alleleFieldIndex, alleleNumberFieldIndex))
+          {
+            return consequence;
+          }
+        }
+      }
+    }
+    return null;
+  }
+
+  private boolean matchAllele(VariantContext variant, int altAlleleIndex,
+          String[] csqFields, int alleleFieldIndex,
+          int alleleNumberFieldIndex)
+  {
+    /*
+     * if ALLELE_NUM is present, it must match altAlleleIndex
+     * NB first alternate allele is 1 for ALLELE_NUM, 0 for altAlleleIndex
+     */
+    if (alleleNumberFieldIndex > -1)
+    {
+      if (csqFields.length <= alleleNumberFieldIndex)
+      {
+        return false;
+      }
+      String alleleNum = csqFields[alleleNumberFieldIndex];
+      return String.valueOf(altAlleleIndex + 1).equals(alleleNum);
+    }
+
+    /*
+     * else consequence allele must match variant allele
+     */
+    if (alleleFieldIndex > -1 && csqFields.length > alleleFieldIndex)
+    {
+      String csqAllele = csqFields[alleleFieldIndex];
+      String vcfAllele = variant.getAlternateAllele(altAlleleIndex)
+              .getBaseString();
+      return csqAllele.equals(vcfAllele);
+    }
+    return false;
+  }
+
+  /**
+   * Add any allele-specific VCF key-value data to the sequence feature
+   * 
+   * @param variant
+   * @param sf
+   * @param altAlelleIndex
+   *          (0, 1..)
+   * @param consequence
+   *          if not null, the consequence specific to this sequence (transcript
+   *          feature) and allele
+   */
+  protected void addAlleleProperties(VariantContext variant,
+          SequenceFeature sf, final int altAlelleIndex, String consequence)
+  {
+    Map atts = variant.getAttributes();
+
+    for (Entry att : atts.entrySet())
+    {
+      String key = att.getKey();
+
+      /*
+       * extract Consequence data (if present) that we are able to
+       * associated with the allele for this variant feature
+       */
+      if (CSQ_FIELD.equals(key))
+      {
+        addConsequences(variant, sf, consequence);
+        continue;
+      }
+
+      /*
+       * filter out fields we don't want to capture
+       */
+      if (!vcfFieldsOfInterest.contains(key))
+      {
+        continue;
+      }
+
+      /*
+       * filter out fields we don't want to capture
+       */
+      if (!vcfFieldsOfInterest.contains(key))
+      {
+        continue;
+      }
+
+      /*
+       * we extract values for other data which are allele-specific; 
+       * these may be per alternate allele (INFO[key].Number = 'A') 
+       * or per allele including reference (INFO[key].Number = 'R') 
+       */
+      VCFInfoHeaderLine infoHeader = header.getInfoHeaderLine(key);
+      if (infoHeader == null)
+      {
+        /*
+         * can't be sure what data belongs to this allele, so
+         * play safe and don't take any
+         */
+        continue;
+      }
+
+      VCFHeaderLineCount number = infoHeader.getCountType();
+      int index = altAlelleIndex;
+      if (number == VCFHeaderLineCount.R)
+      {
+        /*
+         * one value per allele including reference, so bump index
+         * e.g. the 3rd value is for the  2nd alternate allele
+         */
+        index++;
+      }
+      else if (number != VCFHeaderLineCount.A)
+      {
+        /*
+         * don't save other values as not allele-related
+         */
+        continue;
+      }
+
+      /*
+       * take the index'th value
+       */
+      String value = getAttributeValue(variant, key, index);
+      if (value != null)
+      {
+        sf.setValue(key, value);
+      }
+    }
+  }
+
+  /**
+   * Inspects CSQ data blocks (consequences) and adds attributes on the sequence
+   * feature.
+   * 
+   * If myConsequence is not null, then this is the specific
+   * consequence data (pipe-delimited fields) that is for the current allele and
+   * transcript (sequence) being processed)
+   * 
+   * @param variant
+   * @param sf
+   * @param myConsequence
+   */
+  protected void addConsequences(VariantContext variant, SequenceFeature sf,
+          String myConsequence)
+  {
+    Object value = variant.getAttribute(CSQ_FIELD);
+
+    if (value == null || !(value instanceof List))
+    {
+      return;
+    }
+
+    List consequences = (List) value;
+
+    /*
+     * inspect CSQ consequences; restrict to the consequence
+     * associated with the current transcript (Feature)
+     */
+    Map csqValues = new HashMap<>();
+
+    for (String consequence : consequences)
+    {
+      if (myConsequence == null || myConsequence.equals(consequence))
+      {
+        String[] csqFields = consequence.split(PIPE_REGEX);
+
+        /*
+         * inspect individual fields of this consequence, copying non-null
+         * values which are 'fields of interest'
+         */
+        int i = 0;
+        for (String field : csqFields)
+        {
+          if (field != null && field.length() > 0)
+          {
+            String id = vepFieldsOfInterest.get(i);
+            if (id != null)
+            {
+              csqValues.put(id, field);
+            }
+          }
+          i++;
+        }
+      }
+    }
+
+    if (!csqValues.isEmpty())
+    {
+      sf.setValue(CSQ_FIELD, csqValues);
+    }
+  }
+
+  /**
+   * A convenience method to complement a dna base and return the string value
+   * of its complement
+   * 
+   * @param reference
+   * @return
+   */
+  protected String complement(byte[] reference)
+  {
+    return String.valueOf(Dna.getComplement((char) reference[0]));
+  }
+
+  /**
+   * Determines the location of the query range (chromosome positions) in a
+   * different reference assembly.
+   * 

+   * If the range is just a subregion of one for which we already have a mapping
+   * (for example, an exon sub-region of a gene), then the mapping is just
+   * computed arithmetically.
+   * 

+   * Otherwise, calls the Ensembl REST service that maps from one assembly
+   * reference's coordinates to another's
+   * 
+   * @param queryRange
+   *          start-end chromosomal range in 'fromRef' coordinates
+   * @param chromosome
+   * @param species
+   * @param fromRef
+   *          assembly reference for the query coordinates
+   * @param toRef
+   *          assembly reference we wish to translate to
+   * @return the start-end range in 'toRef' coordinates
+   */
+  protected int[] mapReferenceRange(int[] queryRange, String chromosome,
+          String species, String fromRef, String toRef)
+  {
+    /*
+     * first try shorcut of computing the mapping as a subregion of one
+     * we already have (e.g. for an exon, if we have the gene mapping)
+     */
+    int[] mappedRange = findSubsumedRangeMapping(queryRange, chromosome,
+            species, fromRef, toRef);
+    if (mappedRange != null)
+    {
+      return mappedRange;
+    }
+
+    /*
+     * call (e.g.) http://rest.ensembl.org/map/human/GRCh38/17:45051610..45109016:1/GRCh37
+     */
+    EnsemblMap mapper = new EnsemblMap();
+    int[] mapping = mapper.getAssemblyMapping(species, chromosome, fromRef,
+            toRef, queryRange);
+
+    if (mapping == null)
+    {
+      // mapping service failure
+      return null;
+    }
+
+    /*
+     * save mapping for possible future re-use
+     */
+    String key = makeRangesKey(chromosome, species, fromRef, toRef);
+    if (!assemblyMappings.containsKey(key))
+    {
+      assemblyMappings.put(key, new HashMap());
+    }
+
+    assemblyMappings.get(key).put(queryRange, mapping);
+
+    return mapping;
+  }
+
+  /**
+   * If we already have a 1:1 contiguous mapping which subsumes the given query
+   * range, this method just calculates and returns the subset of that mapping,
+   * else it returns null. In practical terms, if a gene has a contiguous
+   * mapping between (for example) GRCh37 and GRCh38, then we assume that its
+   * subsidiary exons occupy unchanged relative positions, and just compute
+   * these as offsets, rather than do another lookup of the mapping.
+   * 

+   * If in future these assumptions prove invalid (e.g. for bacterial dna?!),
+   * simply remove this method or let it always return null.
+   * 

+   * Warning: many rapid calls to the /map service map result in a 429 overload
+   * error response
+   * 
+   * @param queryRange
+   * @param chromosome
+   * @param species
+   * @param fromRef
+   * @param toRef
+   * @return
+   */
+  protected int[] findSubsumedRangeMapping(int[] queryRange, String chromosome,
+          String species, String fromRef, String toRef)
+  {
+    String key = makeRangesKey(chromosome, species, fromRef, toRef);
+    if (assemblyMappings.containsKey(key))
+    {
+      Map mappedRanges = assemblyMappings.get(key);
+      for (Entry mappedRange : mappedRanges.entrySet())
+      {
+        int[] fromRange = mappedRange.getKey();
+        int[] toRange = mappedRange.getValue();
+        if (fromRange[1] - fromRange[0] == toRange[1] - toRange[0])
+        {
+          /*
+           * mapping is 1:1 in length, so we trust it to have no discontinuities
+           */
+          if (MappingUtils.rangeContains(fromRange, queryRange))
+          {
+            /*
+             * fromRange subsumes our query range
+             */
+            int offset = queryRange[0] - fromRange[0];
+            int mappedRangeFrom = toRange[0] + offset;
+            int mappedRangeTo = mappedRangeFrom + (queryRange[1] - queryRange[0]);
+            return new int[] { mappedRangeFrom, mappedRangeTo };
+          }
+        }
+      }
+    }
+    return null;
+  }
+
+  /**
+   * Transfers the sequence feature to the target sequence, locating its start
+   * and end range based on the mapping. Features which do not overlap the
+   * target sequence are ignored.
+   * 
+   * @param sf
+   * @param targetSequence
+   * @param mapping
+   *          mapping from the feature's coordinates to the target sequence
+   */
+  protected void transferFeature(SequenceFeature sf,
+          SequenceI targetSequence, MapList mapping)
+  {
+    int[] mappedRange = mapping.locateInTo(sf.getBegin(), sf.getEnd());
+  
+    if (mappedRange != null)
+    {
+      String group = sf.getFeatureGroup();
+      int newBegin = Math.min(mappedRange[0], mappedRange[1]);
+      int newEnd = Math.max(mappedRange[0], mappedRange[1]);
+      SequenceFeature copy = new SequenceFeature(sf, newBegin, newEnd,
+              group, sf.getScore());
+      targetSequence.addSequenceFeature(copy);
+    }
+  }
+
+  /**
+   * Formats a ranges map lookup key
+   * 
+   * @param chromosome
+   * @param species
+   * @param fromRef
+   * @param toRef
+   * @return
+   */
+  protected static String makeRangesKey(String chromosome, String species,
+          String fromRef, String toRef)
+  {
+    return species + EXCL + chromosome + EXCL + fromRef + EXCL
+            + toRef;
+  }
+}
diff --git a/src/jalview/jbgui/GAlignFrame.java b/src/jalview/jbgui/GAlignFrame.java
index 86d0c85..1cf482d 100755
--- a/src/jalview/jbgui/GAlignFrame.java
+++ b/src/jalview/jbgui/GAlignFrame.java
@@ -147,6 +147,8 @@ public class GAlignFrame extends JInternalFrame
 
   protected JMenuItem runGroovy = new JMenuItem();
 
+  protected JMenuItem loadVcf;
+
   protected JCheckBoxMenuItem autoCalculate = new JCheckBoxMenuItem();
 
   protected JCheckBoxMenuItem sortByTree = new JCheckBoxMenuItem();
@@ -1308,6 +1310,16 @@ public class GAlignFrame extends JInternalFrame
         associatedData_actionPerformed(e);
       }
     });
+    loadVcf = new JMenuItem(MessageManager.getString("label.load_vcf_file"));
+    loadVcf.setToolTipText(MessageManager.getString("label.load_vcf"));
+    loadVcf.addActionListener(new ActionListener()
+    {
+      @Override
+      public void actionPerformed(ActionEvent e)
+      {
+        loadVcf_actionPerformed();
+      }
+    });
     autoCalculate.setText(
             MessageManager.getString("label.autocalculate_consensus"));
     autoCalculate.setState(
@@ -1710,6 +1722,7 @@ public class GAlignFrame extends JInternalFrame
     fileMenu.add(exportAnnotations);
     fileMenu.add(loadTreeMenuItem);
     fileMenu.add(associatedData);
+    fileMenu.add(loadVcf);
     fileMenu.addSeparator();
     fileMenu.add(closeMenuItem);
 
@@ -1855,6 +1868,10 @@ public class GAlignFrame extends JInternalFrame
     // selectMenu.add(listenToViewSelections);
   }
 
+  protected void loadVcf_actionPerformed()
+  {
+  }
+
   /**
    * Constructs the entries on the Colour menu (but does not add them to the
    * menu).
diff --git a/src/jalview/jbgui/GCutAndPasteHtmlTransfer.java b/src/jalview/jbgui/GCutAndPasteHtmlTransfer.java
index abc0b3d..a6e0ace 100644
--- a/src/jalview/jbgui/GCutAndPasteHtmlTransfer.java
+++ b/src/jalview/jbgui/GCutAndPasteHtmlTransfer.java
@@ -39,6 +39,8 @@ import javax.swing.JMenuBar;
 import javax.swing.JMenuItem;
 import javax.swing.JPanel;
 import javax.swing.JScrollPane;
+import javax.swing.text.EditorKit;
+import javax.swing.text.html.HTMLEditorKit;
 
 /**
  * DOCUMENT ME!
@@ -85,6 +87,7 @@ public class GCutAndPasteHtmlTransfer extends JInternalFrame
   {
     try
     {
+      textarea.setEditorKit(new HTMLEditorKit());
       setJMenuBar(editMenubar);
       jbInit();
     } catch (Exception e)
@@ -272,4 +275,20 @@ public class GCutAndPasteHtmlTransfer extends JInternalFrame
   {
 
   }
+
+  /**
+   * Adds the given stylesheet rule to the Html editor. However note that CSS
+   * support is limited.
+   * 
+   * @param rule
+   * @see javax.swing.text.html.CSS
+   */
+  public void addStylesheetRule(String rule)
+  {
+    EditorKit editorKit = textarea.getEditorKit();
+    if (editorKit != null)
+    {
+      ((HTMLEditorKit) editorKit).getStyleSheet().addRule(rule);
+    }
+  }
 }
diff --git a/src/jalview/renderer/seqfeatures/FeatureRenderer.java b/src/jalview/renderer/seqfeatures/FeatureRenderer.java
index 1f47da3..795cd36 100644
--- a/src/jalview/renderer/seqfeatures/FeatureRenderer.java
+++ b/src/jalview/renderer/seqfeatures/FeatureRenderer.java
@@ -304,14 +304,19 @@ public class FeatureRenderer extends FeatureRendererModel
       List overlaps = seq.getFeatures().findFeatures(
               visiblePositions.getBegin(), visiblePositions.getEnd(), type);
 
-      filterFeaturesForDisplay(overlaps, fc);
+      if (fc.isSimpleColour())
+      {
+        filterFeaturesForDisplay(overlaps);
+      }
 
       for (SequenceFeature sf : overlaps)
       {
-        Color featureColour = fc.getColor(sf);
+        Color featureColour = getColor(sf, fc);
         if (featureColour == null)
         {
-          // score feature outwith threshold for colouring
+          /*
+           * feature excluded by visibility settings, filters, or colour threshold
+           */
           continue;
         }
 
diff --git a/src/jalview/schemabinding/version2/.castor.cdr b/src/jalview/schemabinding/version2/.castor.cdr
index 0a01103..e1100a8 100644
--- a/src/jalview/schemabinding/version2/.castor.cdr
+++ b/src/jalview/schemabinding/version2/.castor.cdr
@@ -1,4 +1,4 @@
-#Mon Jun 20 15:44:52 BST 2016
+#Thu Dec 14 09:10:14 GMT 2017
 jalview.schemabinding.version2.ThresholdLine=jalview.schemabinding.version2.descriptors.ThresholdLineDescriptor
 jalview.schemabinding.version2.SequenceSetProperties=jalview.schemabinding.version2.descriptors.SequenceSetPropertiesDescriptor
 jalview.schemabinding.version2.StructureState=jalview.schemabinding.version2.descriptors.StructureStateDescriptor
@@ -10,7 +10,9 @@ jalview.schemabinding.version2.OtherData=jalview.schemabinding.version2.descript
 jalview.schemabinding.version2.Setting=jalview.schemabinding.version2.descriptors.SettingDescriptor
 jalview.schemabinding.version2.AlcodonFrame=jalview.schemabinding.version2.descriptors.AlcodonFrameDescriptor
 jalview.schemabinding.version2.AnnotationElement=jalview.schemabinding.version2.descriptors.AnnotationElementDescriptor
+jalview.schemabinding.version2.FeatureMatcherSet=jalview.schemabinding.version2.descriptors.FeatureMatcherSetDescriptor
 jalview.schemabinding.version2.SecondaryStructure=jalview.schemabinding.version2.descriptors.SecondaryStructureDescriptor
+jalview.schemabinding.version2.MatchCondition=jalview.schemabinding.version2.descriptors.MatchConditionDescriptor
 jalview.schemabinding.version2.SequenceSet=jalview.schemabinding.version2.descriptors.SequenceSetDescriptor
 jalview.schemabinding.version2.Viewport=jalview.schemabinding.version2.descriptors.ViewportDescriptor
 jalview.schemabinding.version2.RnaViewer=jalview.schemabinding.version2.descriptors.RnaViewerDescriptor
@@ -20,31 +22,32 @@ jalview.schemabinding.version2.UserColourScheme=jalview.schemabinding.version2.d
 jalview.schemabinding.version2.DBRef=jalview.schemabinding.version2.descriptors.DBRefDescriptor
 jalview.schemabinding.version2.AlcodMap=jalview.schemabinding.version2.descriptors.AlcodMapDescriptor
 jalview.schemabinding.version2.Annotation=jalview.schemabinding.version2.descriptors.AnnotationDescriptor
-jalview.schemabinding.version2.Wsparameters=jalview.schemabinding.version2.descriptors.WsparametersDescriptor
 jalview.schemabinding.version2.JSeq=jalview.schemabinding.version2.descriptors.JSeqDescriptor
+jalview.schemabinding.version2.MatcherSet=jalview.schemabinding.version2.descriptors.MatcherSetDescriptor
 jalview.schemabinding.version2.Sequence=jalview.schemabinding.version2.descriptors.SequenceDescriptor
 jalview.schemabinding.version2.WebServiceParameterSet=jalview.schemabinding.version2.descriptors.WebServiceParameterSetDescriptor
 jalview.schemabinding.version2.Alcodon=jalview.schemabinding.version2.descriptors.AlcodonDescriptor
+jalview.schemabinding.version2.Filter=jalview.schemabinding.version2.descriptors.FilterDescriptor
 jalview.schemabinding.version2.AnnotationColours=jalview.schemabinding.version2.descriptors.AnnotationColoursDescriptor
 jalview.schemabinding.version2.Pdbids=jalview.schemabinding.version2.descriptors.PdbidsDescriptor
 jalview.schemabinding.version2.AnnotationColourScheme=jalview.schemabinding.version2.descriptors.AnnotationColourSchemeDescriptor
 jalview.schemabinding.version2.Mapping=jalview.schemabinding.version2.descriptors.MappingDescriptor
-jalview.schemabinding.version2.MappingChoice=jalview.schemabinding.version2.descriptors.MappingChoiceDescriptor
+jalview.schemabinding.version2.CompoundMatcher=jalview.schemabinding.version2.descriptors.CompoundMatcherDescriptor
+jalview.schemabinding.version2.JalviewModelSequence=jalview.schemabinding.version2.descriptors.JalviewModelSequenceDescriptor
 jalview.schemabinding.version2.Group=jalview.schemabinding.version2.descriptors.GroupDescriptor
+jalview.schemabinding.version2.MappingChoice=jalview.schemabinding.version2.descriptors.MappingChoiceDescriptor
 jalview.schemabinding.version2.Feature=jalview.schemabinding.version2.descriptors.FeatureDescriptor
-jalview.schemabinding.version2.JalviewModelSequence=jalview.schemabinding.version2.descriptors.JalviewModelSequenceDescriptor
 jalview.schemabinding.version2.UserColours=jalview.schemabinding.version2.descriptors.UserColoursDescriptor
 jalview.schemabinding.version2.Colour=jalview.schemabinding.version2.descriptors.ColourDescriptor
-jalview.schemabinding.version2.MapListFrom=jalview.schemabinding.version2.descriptors.MapListFromDescriptor
 jalview.schemabinding.version2.PdbentryItem=jalview.schemabinding.version2.descriptors.PdbentryItemDescriptor
-jalview.schemabinding.version2.JGroup=jalview.schemabinding.version2.descriptors.JGroupDescriptor
+jalview.schemabinding.version2.MapListFrom=jalview.schemabinding.version2.descriptors.MapListFromDescriptor
 jalview.schemabinding.version2.FeatureSettings=jalview.schemabinding.version2.descriptors.FeatureSettingsDescriptor
-jalview.schemabinding.version2.VamsasModel=jalview.schemabinding.version2.descriptors.VamsasModelDescriptor
-jalview.schemabinding.version2.JalviewUserColours=jalview.schemabinding.version2.descriptors.JalviewUserColoursDescriptor
+jalview.schemabinding.version2.JGroup=jalview.schemabinding.version2.descriptors.JGroupDescriptor
 jalview.schemabinding.version2.MapListTo=jalview.schemabinding.version2.descriptors.MapListToDescriptor
+jalview.schemabinding.version2.JalviewUserColours=jalview.schemabinding.version2.descriptors.JalviewUserColoursDescriptor
+jalview.schemabinding.version2.VamsasModel=jalview.schemabinding.version2.descriptors.VamsasModelDescriptor
 jalview.schemabinding.version2.Pdbentry=jalview.schemabinding.version2.descriptors.PdbentryDescriptor
 jalview.schemabinding.version2.HiddenColumns=jalview.schemabinding.version2.descriptors.HiddenColumnsDescriptor
 jalview.schemabinding.version2.Features=jalview.schemabinding.version2.descriptors.FeaturesDescriptor
-jalview.schemabinding.version2.DseqFor=jalview.schemabinding.version2.descriptors.DseqForDescriptor
 jalview.schemabinding.version2.VAMSAS=jalview.schemabinding.version2.descriptors.VAMSASDescriptor
-jalview.schemabinding.version2.MappingChoiceItem=jalview.schemabinding.version2.descriptors.MappingChoiceItemDescriptor
+jalview.schemabinding.version2.FeatureMatcher=jalview.schemabinding.version2.descriptors.FeatureMatcherDescriptor
diff --git a/src/jalview/schemabinding/version2/Colour.java b/src/jalview/schemabinding/version2/Colour.java
index 9d5a916..d1c7297 100644
--- a/src/jalview/schemabinding/version2/Colour.java
+++ b/src/jalview/schemabinding/version2/Colour.java
@@ -27,7 +27,8 @@ public class Colour implements java.io.Serializable
   // --------------------------/
 
   /**
-   * Field _name.
+   * Single letter residue code for an alignment colour scheme, or feature type
+   * for a feature colour scheme
    */
   private java.lang.String _name;
 
@@ -42,9 +43,15 @@ public class Colour implements java.io.Serializable
   private java.lang.String _minRGB;
 
   /**
-   * loosely specified enumeration: NONE,ABOVE, or BELOW
+   * Field _noValueColour.
    */
-  private java.lang.String _threshType;
+  private jalview.schemabinding.version2.types.NoValueColour _noValueColour = jalview.schemabinding.version2.types.NoValueColour
+          .valueOf("Min");
+
+  /**
+   * Field _threshType.
+   */
+  private jalview.schemabinding.version2.types.ColourThreshTypeType _threshType;
 
   /**
    * Field _threshold.
@@ -96,6 +103,11 @@ public class Colour implements java.io.Serializable
    */
   private boolean _has_autoScale;
 
+  /**
+   * name of feature attribute to colour by, or attribute and sub-attribute
+   */
+  private java.util.Vector _attributeNameList;
+
   // ----------------/
   // - Constructors -/
   // ----------------/
@@ -103,6 +115,9 @@ public class Colour implements java.io.Serializable
   public Colour()
   {
     super();
+    setNoValueColour(jalview.schemabinding.version2.types.NoValueColour
+            .valueOf("Min"));
+    this._attributeNameList = new java.util.Vector();
   }
 
   // -----------/
@@ -110,41 +125,140 @@ public class Colour implements java.io.Serializable
   // -----------/
 
   /**
-     */
+   * 
+   * 
+   * @param vAttributeName
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   */
+  public void addAttributeName(final java.lang.String vAttributeName)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    // check for the maximum size
+    if (this._attributeNameList.size() >= 2)
+    {
+      throw new IndexOutOfBoundsException(
+              "addAttributeName has a maximum of 2");
+    }
+
+    this._attributeNameList.addElement(vAttributeName);
+  }
+
+  /**
+   * 
+   * 
+   * @param index
+   * @param vAttributeName
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   */
+  public void addAttributeName(final int index,
+          final java.lang.String vAttributeName)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    // check for the maximum size
+    if (this._attributeNameList.size() >= 2)
+    {
+      throw new IndexOutOfBoundsException(
+              "addAttributeName has a maximum of 2");
+    }
+
+    this._attributeNameList.add(index, vAttributeName);
+  }
+
+  /**
+   */
   public void deleteAutoScale()
   {
     this._has_autoScale = false;
   }
 
   /**
-     */
+   */
   public void deleteColourByLabel()
   {
     this._has_colourByLabel = false;
   }
 
   /**
-     */
+   */
   public void deleteMax()
   {
     this._has_max = false;
   }
 
   /**
-     */
+   */
   public void deleteMin()
   {
     this._has_min = false;
   }
 
   /**
-     */
+   */
   public void deleteThreshold()
   {
     this._has_threshold = false;
   }
 
   /**
+   * Method enumerateAttributeName.
+   * 
+   * @return an Enumeration over all java.lang.String elements
+   */
+  public java.util.Enumeration enumerateAttributeName()
+  {
+    return this._attributeNameList.elements();
+  }
+
+  /**
+   * Method getAttributeName.
+   * 
+   * @param index
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   * @return the value of the java.lang.String at the given index
+   */
+  public java.lang.String getAttributeName(final int index)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    // check bounds for index
+    if (index < 0 || index >= this._attributeNameList.size())
+    {
+      throw new IndexOutOfBoundsException("getAttributeName: Index value '"
+              + index + "' not in range [0.."
+              + (this._attributeNameList.size() - 1) + "]");
+    }
+
+    return (java.lang.String) _attributeNameList.get(index);
+  }
+
+  /**
+   * Method getAttributeName.Returns the contents of the collection in an Array.
+   * 

+   * Note: Just in case the collection contents are changing in another thread,
+   * we pass a 0-length Array of the correct type into the API call. This way we
+   * know that the Array returned is of exactly the correct length.
+   * 
+   * @return this collection as an Array
+   */
+  public java.lang.String[] getAttributeName()
+  {
+    java.lang.String[] array = new java.lang.String[0];
+    return (java.lang.String[]) this._attributeNameList.toArray(array);
+  }
+
+  /**
+   * Method getAttributeNameCount.
+   * 
+   * @return the size of this collection
+   */
+  public int getAttributeNameCount()
+  {
+    return this._attributeNameList.size();
+  }
+
+  /**
    * Returns the value of field 'autoScale'.
    * 
    * @return the value of field 'AutoScale'.
@@ -195,7 +309,9 @@ public class Colour implements java.io.Serializable
   }
 
   /**
-   * Returns the value of field 'name'.
+   * Returns the value of field 'name'. The field 'name' has the following
+   * description: Single letter residue code for an alignment colour scheme, or
+   * feature type for a feature colour scheme
    * 
    * @return the value of field 'Name'.
    */
@@ -205,6 +321,16 @@ public class Colour implements java.io.Serializable
   }
 
   /**
+   * Returns the value of field 'noValueColour'.
+   * 
+   * @return the value of field 'NoValueColour'.
+   */
+  public jalview.schemabinding.version2.types.NoValueColour getNoValueColour()
+  {
+    return this._noValueColour;
+  }
+
+  /**
    * Returns the value of field 'RGB'.
    * 
    * @return the value of field 'RGB'.
@@ -215,12 +341,11 @@ public class Colour implements java.io.Serializable
   }
 
   /**
-   * Returns the value of field 'threshType'. The field 'threshType' has the
-   * following description: loosely specified enumeration: NONE,ABOVE, or BELOW
+   * Returns the value of field 'threshType'.
    * 
    * @return the value of field 'ThreshType'.
    */
-  public java.lang.String getThreshType()
+  public jalview.schemabinding.version2.types.ColourThreshTypeType getThreshType()
   {
     return this._threshType;
   }
@@ -360,6 +485,76 @@ public class Colour implements java.io.Serializable
   }
 
   /**
+   */
+  public void removeAllAttributeName()
+  {
+    this._attributeNameList.clear();
+  }
+
+  /**
+   * Method removeAttributeName.
+   * 
+   * @param vAttributeName
+   * @return true if the object was removed from the collection.
+   */
+  public boolean removeAttributeName(final java.lang.String vAttributeName)
+  {
+    boolean removed = _attributeNameList.remove(vAttributeName);
+    return removed;
+  }
+
+  /**
+   * Method removeAttributeNameAt.
+   * 
+   * @param index
+   * @return the element removed from the collection
+   */
+  public java.lang.String removeAttributeNameAt(final int index)
+  {
+    java.lang.Object obj = this._attributeNameList.remove(index);
+    return (java.lang.String) obj;
+  }
+
+  /**
+   * 
+   * 
+   * @param index
+   * @param vAttributeName
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   */
+  public void setAttributeName(final int index,
+          final java.lang.String vAttributeName)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    // check bounds for index
+    if (index < 0 || index >= this._attributeNameList.size())
+    {
+      throw new IndexOutOfBoundsException("setAttributeName: Index value '"
+              + index + "' not in range [0.."
+              + (this._attributeNameList.size() - 1) + "]");
+    }
+
+    this._attributeNameList.set(index, vAttributeName);
+  }
+
+  /**
+   * 
+   * 
+   * @param vAttributeNameArray
+   */
+  public void setAttributeName(final java.lang.String[] vAttributeNameArray)
+  {
+    // -- copy array
+    _attributeNameList.clear();
+
+    for (int i = 0; i < vAttributeNameArray.length; i++)
+    {
+      this._attributeNameList.add(vAttributeNameArray[i]);
+    }
+  }
+
+  /**
    * Sets the value of field 'autoScale'.
    * 
    * @param autoScale
@@ -419,7 +614,9 @@ public class Colour implements java.io.Serializable
   }
 
   /**
-   * Sets the value of field 'name'.
+   * Sets the value of field 'name'. The field 'name' has the following
+   * description: Single letter residue code for an alignment colour scheme, or
+   * feature type for a feature colour scheme
    * 
    * @param name
    *          the value of field 'name'.
@@ -430,6 +627,18 @@ public class Colour implements java.io.Serializable
   }
 
   /**
+   * Sets the value of field 'noValueColour'.
+   * 
+   * @param noValueColour
+   *          the value of field 'noValueColour'.
+   */
+  public void setNoValueColour(
+          final jalview.schemabinding.version2.types.NoValueColour noValueColour)
+  {
+    this._noValueColour = noValueColour;
+  }
+
+  /**
    * Sets the value of field 'RGB'.
    * 
    * @param RGB
@@ -441,13 +650,13 @@ public class Colour implements java.io.Serializable
   }
 
   /**
-   * Sets the value of field 'threshType'. The field 'threshType' has the
-   * following description: loosely specified enumeration: NONE,ABOVE, or BELOW
+   * Sets the value of field 'threshType'.
    * 
    * @param threshType
    *          the value of field 'threshType'.
    */
-  public void setThreshType(final java.lang.String threshType)
+  public void setThreshType(
+          final jalview.schemabinding.version2.types.ColourThreshTypeType threshType)
   {
     this._threshType = threshType;
   }
@@ -480,8 +689,8 @@ public class Colour implements java.io.Serializable
           throws org.exolab.castor.xml.MarshalException,
           org.exolab.castor.xml.ValidationException
   {
-    return (jalview.schemabinding.version2.Colour) Unmarshaller.unmarshal(
-            jalview.schemabinding.version2.Colour.class, reader);
+    return (jalview.schemabinding.version2.Colour) Unmarshaller
+            .unmarshal(jalview.schemabinding.version2.Colour.class, reader);
   }
 
   /**
diff --git a/src/jalview/schemabinding/version2/CompoundMatcher.java b/src/jalview/schemabinding/version2/CompoundMatcher.java
new file mode 100644
index 0000000..27714e2
--- /dev/null
+++ b/src/jalview/schemabinding/version2/CompoundMatcher.java
@@ -0,0 +1,374 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2;
+
+//---------------------------------/
+//- Imported classes and packages -/
+//---------------------------------/
+
+import org.exolab.castor.xml.Marshaller;
+import org.exolab.castor.xml.Unmarshaller;
+
+/**
+ * Class CompoundMatcher.
+ * 
+ * @version $Revision$ $Date$
+ */
+public class CompoundMatcher implements java.io.Serializable
+{
+
+  // --------------------------/
+  // - Class/Member Variables -/
+  // --------------------------/
+
+  /**
+   * If true, matchers are AND-ed, if false they are OR-ed
+   */
+  private boolean _and;
+
+  /**
+   * keeps track of state for field: _and
+   */
+  private boolean _has_and;
+
+  /**
+   * Field _matcherSetList.
+   */
+  private java.util.Vector _matcherSetList;
+
+  // ----------------/
+  // - Constructors -/
+  // ----------------/
+
+  public CompoundMatcher()
+  {
+    super();
+    this._matcherSetList = new java.util.Vector();
+  }
+
+  // -----------/
+  // - Methods -/
+  // -----------/
+
+  /**
+   * 
+   * 
+   * @param vMatcherSet
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   */
+  public void addMatcherSet(
+          final jalview.schemabinding.version2.MatcherSet vMatcherSet)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    // check for the maximum size
+    if (this._matcherSetList.size() >= 2)
+    {
+      throw new IndexOutOfBoundsException(
+              "addMatcherSet has a maximum of 2");
+    }
+
+    this._matcherSetList.addElement(vMatcherSet);
+  }
+
+  /**
+   * 
+   * 
+   * @param index
+   * @param vMatcherSet
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   */
+  public void addMatcherSet(final int index,
+          final jalview.schemabinding.version2.MatcherSet vMatcherSet)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    // check for the maximum size
+    if (this._matcherSetList.size() >= 2)
+    {
+      throw new IndexOutOfBoundsException(
+              "addMatcherSet has a maximum of 2");
+    }
+
+    this._matcherSetList.add(index, vMatcherSet);
+  }
+
+  /**
+   */
+  public void deleteAnd()
+  {
+    this._has_and = false;
+  }
+
+  /**
+   * Method enumerateMatcherSet.
+   * 
+   * @return an Enumeration over all jalview.schemabinding.version2.MatcherSet
+   *         elements
+   */
+  public java.util.Enumeration enumerateMatcherSet()
+  {
+    return this._matcherSetList.elements();
+  }
+
+  /**
+   * Returns the value of field 'and'. The field 'and' has the following
+   * description: If true, matchers are AND-ed, if false they are OR-ed
+   * 
+   * @return the value of field 'And'.
+   */
+  public boolean getAnd()
+  {
+    return this._and;
+  }
+
+  /**
+   * Method getMatcherSet.
+   * 
+   * @param index
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   * @return the value of the jalview.schemabinding.version2.MatcherSet at the
+   *         given index
+   */
+  public jalview.schemabinding.version2.MatcherSet getMatcherSet(
+          final int index) throws java.lang.IndexOutOfBoundsException
+  {
+    // check bounds for index
+    if (index < 0 || index >= this._matcherSetList.size())
+    {
+      throw new IndexOutOfBoundsException(
+              "getMatcherSet: Index value '" + index + "' not in range [0.."
+                      + (this._matcherSetList.size() - 1) + "]");
+    }
+
+    return (jalview.schemabinding.version2.MatcherSet) _matcherSetList
+            .get(index);
+  }
+
+  /**
+   * Method getMatcherSet.Returns the contents of the collection in an Array.
+   * 

+   * Note: Just in case the collection contents are changing in another thread,
+   * we pass a 0-length Array of the correct type into the API call. This way we
+   * know that the Array returned is of exactly the correct length.
+   * 
+   * @return this collection as an Array
+   */
+  public jalview.schemabinding.version2.MatcherSet[] getMatcherSet()
+  {
+    jalview.schemabinding.version2.MatcherSet[] array = new jalview.schemabinding.version2.MatcherSet[0];
+    return (jalview.schemabinding.version2.MatcherSet[]) this._matcherSetList
+            .toArray(array);
+  }
+
+  /**
+   * Method getMatcherSetCount.
+   * 
+   * @return the size of this collection
+   */
+  public int getMatcherSetCount()
+  {
+    return this._matcherSetList.size();
+  }
+
+  /**
+   * Method hasAnd.
+   * 
+   * @return true if at least one And has been added
+   */
+  public boolean hasAnd()
+  {
+    return this._has_and;
+  }
+
+  /**
+   * Returns the value of field 'and'. The field 'and' has the following
+   * description: If true, matchers are AND-ed, if false they are OR-ed
+   * 
+   * @return the value of field 'And'.
+   */
+  public boolean isAnd()
+  {
+    return this._and;
+  }
+
+  /**
+   * Method isValid.
+   * 
+   * @return true if this object is valid according to the schema
+   */
+  public boolean isValid()
+  {
+    try
+    {
+      validate();
+    } catch (org.exolab.castor.xml.ValidationException vex)
+    {
+      return false;
+    }
+    return true;
+  }
+
+  /**
+   * 
+   * 
+   * @param out
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   */
+  public void marshal(final java.io.Writer out)
+          throws org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    Marshaller.marshal(this, out);
+  }
+
+  /**
+   * 
+   * 
+   * @param handler
+   * @throws java.io.IOException
+   *           if an IOException occurs during marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   */
+  public void marshal(final org.xml.sax.ContentHandler handler)
+          throws java.io.IOException,
+          org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    Marshaller.marshal(this, handler);
+  }
+
+  /**
+   */
+  public void removeAllMatcherSet()
+  {
+    this._matcherSetList.clear();
+  }
+
+  /**
+   * Method removeMatcherSet.
+   * 
+   * @param vMatcherSet
+   * @return true if the object was removed from the collection.
+   */
+  public boolean removeMatcherSet(
+          final jalview.schemabinding.version2.MatcherSet vMatcherSet)
+  {
+    boolean removed = _matcherSetList.remove(vMatcherSet);
+    return removed;
+  }
+
+  /**
+   * Method removeMatcherSetAt.
+   * 
+   * @param index
+   * @return the element removed from the collection
+   */
+  public jalview.schemabinding.version2.MatcherSet removeMatcherSetAt(
+          final int index)
+  {
+    java.lang.Object obj = this._matcherSetList.remove(index);
+    return (jalview.schemabinding.version2.MatcherSet) obj;
+  }
+
+  /**
+   * Sets the value of field 'and'. The field 'and' has the following
+   * description: If true, matchers are AND-ed, if false they are OR-ed
+   * 
+   * @param and
+   *          the value of field 'and'.
+   */
+  public void setAnd(final boolean and)
+  {
+    this._and = and;
+    this._has_and = true;
+  }
+
+  /**
+   * 
+   * 
+   * @param index
+   * @param vMatcherSet
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   */
+  public void setMatcherSet(final int index,
+          final jalview.schemabinding.version2.MatcherSet vMatcherSet)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    // check bounds for index
+    if (index < 0 || index >= this._matcherSetList.size())
+    {
+      throw new IndexOutOfBoundsException(
+              "setMatcherSet: Index value '" + index + "' not in range [0.."
+                      + (this._matcherSetList.size() - 1) + "]");
+    }
+
+    this._matcherSetList.set(index, vMatcherSet);
+  }
+
+  /**
+   * 
+   * 
+   * @param vMatcherSetArray
+   */
+  public void setMatcherSet(
+          final jalview.schemabinding.version2.MatcherSet[] vMatcherSetArray)
+  {
+    // -- copy array
+    _matcherSetList.clear();
+
+    for (int i = 0; i < vMatcherSetArray.length; i++)
+    {
+      this._matcherSetList.add(vMatcherSetArray[i]);
+    }
+  }
+
+  /**
+   * Method unmarshal.
+   * 
+   * @param reader
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   * @return the unmarshaled jalview.schemabinding.version2.CompoundMatcher
+   */
+  public static jalview.schemabinding.version2.CompoundMatcher unmarshal(
+          final java.io.Reader reader)
+          throws org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    return (jalview.schemabinding.version2.CompoundMatcher) Unmarshaller
+            .unmarshal(jalview.schemabinding.version2.CompoundMatcher.class,
+                    reader);
+  }
+
+  /**
+   * 
+   * 
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   */
+  public void validate() throws org.exolab.castor.xml.ValidationException
+  {
+    org.exolab.castor.xml.Validator validator = new org.exolab.castor.xml.Validator();
+    validator.validate(this);
+  }
+
+}
diff --git a/src/jalview/schemabinding/version2/FeatureMatcher.java b/src/jalview/schemabinding/version2/FeatureMatcher.java
new file mode 100644
index 0000000..4d29cab
--- /dev/null
+++ b/src/jalview/schemabinding/version2/FeatureMatcher.java
@@ -0,0 +1,383 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2;
+
+//---------------------------------/
+//- Imported classes and packages -/
+//---------------------------------/
+
+import org.exolab.castor.xml.Marshaller;
+import org.exolab.castor.xml.Unmarshaller;
+
+/**
+ * Class FeatureMatcher.
+ * 
+ * @version $Revision$ $Date$
+ */
+public class FeatureMatcher implements java.io.Serializable
+{
+
+  // --------------------------/
+  // - Class/Member Variables -/
+  // --------------------------/
+
+  /**
+   * Field _by.
+   */
+  private jalview.schemabinding.version2.types.FeatureMatcherByType _by;
+
+  /**
+   * name of feature attribute to filter on, or attribute and sub-attribute
+   */
+  private java.util.Vector _attributeNameList;
+
+  /**
+   * Field _condition.
+   */
+  private java.lang.String _condition;
+
+  /**
+   * Field _value.
+   */
+  private java.lang.String _value;
+
+  // ----------------/
+  // - Constructors -/
+  // ----------------/
+
+  public FeatureMatcher()
+  {
+    super();
+    this._attributeNameList = new java.util.Vector();
+  }
+
+  // -----------/
+  // - Methods -/
+  // -----------/
+
+  /**
+   * 
+   * 
+   * @param vAttributeName
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   */
+  public void addAttributeName(final java.lang.String vAttributeName)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    // check for the maximum size
+    if (this._attributeNameList.size() >= 2)
+    {
+      throw new IndexOutOfBoundsException(
+              "addAttributeName has a maximum of 2");
+    }
+
+    this._attributeNameList.addElement(vAttributeName);
+  }
+
+  /**
+   * 
+   * 
+   * @param index
+   * @param vAttributeName
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   */
+  public void addAttributeName(final int index,
+          final java.lang.String vAttributeName)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    // check for the maximum size
+    if (this._attributeNameList.size() >= 2)
+    {
+      throw new IndexOutOfBoundsException(
+              "addAttributeName has a maximum of 2");
+    }
+
+    this._attributeNameList.add(index, vAttributeName);
+  }
+
+  /**
+   * Method enumerateAttributeName.
+   * 
+   * @return an Enumeration over all java.lang.String elements
+   */
+  public java.util.Enumeration enumerateAttributeName()
+  {
+    return this._attributeNameList.elements();
+  }
+
+  /**
+   * Method getAttributeName.
+   * 
+   * @param index
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   * @return the value of the java.lang.String at the given index
+   */
+  public java.lang.String getAttributeName(final int index)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    // check bounds for index
+    if (index < 0 || index >= this._attributeNameList.size())
+    {
+      throw new IndexOutOfBoundsException("getAttributeName: Index value '"
+              + index + "' not in range [0.."
+              + (this._attributeNameList.size() - 1) + "]");
+    }
+
+    return (java.lang.String) _attributeNameList.get(index);
+  }
+
+  /**
+   * Method getAttributeName.Returns the contents of the collection in an Array.
+   * 

+   * Note: Just in case the collection contents are changing in another thread,
+   * we pass a 0-length Array of the correct type into the API call. This way we
+   * know that the Array returned is of exactly the correct length.
+   * 
+   * @return this collection as an Array
+   */
+  public java.lang.String[] getAttributeName()
+  {
+    java.lang.String[] array = new java.lang.String[0];
+    return (java.lang.String[]) this._attributeNameList.toArray(array);
+  }
+
+  /**
+   * Method getAttributeNameCount.
+   * 
+   * @return the size of this collection
+   */
+  public int getAttributeNameCount()
+  {
+    return this._attributeNameList.size();
+  }
+
+  /**
+   * Returns the value of field 'by'.
+   * 
+   * @return the value of field 'By'.
+   */
+  public jalview.schemabinding.version2.types.FeatureMatcherByType getBy()
+  {
+    return this._by;
+  }
+
+  /**
+   * Returns the value of field 'condition'.
+   * 
+   * @return the value of field 'Condition'.
+   */
+  public java.lang.String getCondition()
+  {
+    return this._condition;
+  }
+
+  /**
+   * Returns the value of field 'value'.
+   * 
+   * @return the value of field 'Value'.
+   */
+  public java.lang.String getValue()
+  {
+    return this._value;
+  }
+
+  /**
+   * Method isValid.
+   * 
+   * @return true if this object is valid according to the schema
+   */
+  public boolean isValid()
+  {
+    try
+    {
+      validate();
+    } catch (org.exolab.castor.xml.ValidationException vex)
+    {
+      return false;
+    }
+    return true;
+  }
+
+  /**
+   * 
+   * 
+   * @param out
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   */
+  public void marshal(final java.io.Writer out)
+          throws org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    Marshaller.marshal(this, out);
+  }
+
+  /**
+   * 
+   * 
+   * @param handler
+   * @throws java.io.IOException
+   *           if an IOException occurs during marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   */
+  public void marshal(final org.xml.sax.ContentHandler handler)
+          throws java.io.IOException,
+          org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    Marshaller.marshal(this, handler);
+  }
+
+  /**
+   */
+  public void removeAllAttributeName()
+  {
+    this._attributeNameList.clear();
+  }
+
+  /**
+   * Method removeAttributeName.
+   * 
+   * @param vAttributeName
+   * @return true if the object was removed from the collection.
+   */
+  public boolean removeAttributeName(final java.lang.String vAttributeName)
+  {
+    boolean removed = _attributeNameList.remove(vAttributeName);
+    return removed;
+  }
+
+  /**
+   * Method removeAttributeNameAt.
+   * 
+   * @param index
+   * @return the element removed from the collection
+   */
+  public java.lang.String removeAttributeNameAt(final int index)
+  {
+    java.lang.Object obj = this._attributeNameList.remove(index);
+    return (java.lang.String) obj;
+  }
+
+  /**
+   * 
+   * 
+   * @param index
+   * @param vAttributeName
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   */
+  public void setAttributeName(final int index,
+          final java.lang.String vAttributeName)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    // check bounds for index
+    if (index < 0 || index >= this._attributeNameList.size())
+    {
+      throw new IndexOutOfBoundsException("setAttributeName: Index value '"
+              + index + "' not in range [0.."
+              + (this._attributeNameList.size() - 1) + "]");
+    }
+
+    this._attributeNameList.set(index, vAttributeName);
+  }
+
+  /**
+   * 
+   * 
+   * @param vAttributeNameArray
+   */
+  public void setAttributeName(final java.lang.String[] vAttributeNameArray)
+  {
+    // -- copy array
+    _attributeNameList.clear();
+
+    for (int i = 0; i < vAttributeNameArray.length; i++)
+    {
+      this._attributeNameList.add(vAttributeNameArray[i]);
+    }
+  }
+
+  /**
+   * Sets the value of field 'by'.
+   * 
+   * @param by
+   *          the value of field 'by'.
+   */
+  public void setBy(
+          final jalview.schemabinding.version2.types.FeatureMatcherByType by)
+  {
+    this._by = by;
+  }
+
+  /**
+   * Sets the value of field 'condition'.
+   * 
+   * @param condition
+   *          the value of field 'condition'.
+   */
+  public void setCondition(final java.lang.String condition)
+  {
+    this._condition = condition;
+  }
+
+  /**
+   * Sets the value of field 'value'.
+   * 
+   * @param value
+   *          the value of field 'value'.
+   */
+  public void setValue(final java.lang.String value)
+  {
+    this._value = value;
+  }
+
+  /**
+   * Method unmarshal.
+   * 
+   * @param reader
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   * @return the unmarshaled jalview.schemabinding.version2.FeatureMatcher
+   */
+  public static jalview.schemabinding.version2.FeatureMatcher unmarshal(
+          final java.io.Reader reader)
+          throws org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    return (jalview.schemabinding.version2.FeatureMatcher) Unmarshaller
+            .unmarshal(jalview.schemabinding.version2.FeatureMatcher.class,
+                    reader);
+  }
+
+  /**
+   * 
+   * 
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   */
+  public void validate() throws org.exolab.castor.xml.ValidationException
+  {
+    org.exolab.castor.xml.Validator validator = new org.exolab.castor.xml.Validator();
+    validator.validate(this);
+  }
+
+}
diff --git a/src/jalview/schemabinding/version2/FeatureMatcherSet.java b/src/jalview/schemabinding/version2/FeatureMatcherSet.java
new file mode 100644
index 0000000..2d79a98
--- /dev/null
+++ b/src/jalview/schemabinding/version2/FeatureMatcherSet.java
@@ -0,0 +1,200 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2;
+
+//---------------------------------/
+//- Imported classes and packages -/
+//---------------------------------/
+
+import org.exolab.castor.xml.Marshaller;
+import org.exolab.castor.xml.Unmarshaller;
+
+/**
+ * A feature match condition, which may be simple or compound
+ * 
+ * @version $Revision$ $Date$
+ */
+public class FeatureMatcherSet implements java.io.Serializable
+{
+
+  // --------------------------/
+  // - Class/Member Variables -/
+  // --------------------------/
+
+  /**
+   * Internal choice value storage
+   */
+  private java.lang.Object _choiceValue;
+
+  /**
+   * Field _matchCondition.
+   */
+  private MatchCondition _matchCondition;
+
+  /**
+   * Field _compoundMatcher.
+   */
+  private CompoundMatcher _compoundMatcher;
+
+  // ----------------/
+  // - Constructors -/
+  // ----------------/
+
+  public FeatureMatcherSet()
+  {
+    super();
+  }
+
+  // -----------/
+  // - Methods -/
+  // -----------/
+
+  /**
+   * Returns the value of field 'choiceValue'. The field 'choiceValue' has the
+   * following description: Internal choice value storage
+   * 
+   * @return the value of field 'ChoiceValue'.
+   */
+  public java.lang.Object getChoiceValue()
+  {
+    return this._choiceValue;
+  }
+
+  /**
+   * Returns the value of field 'compoundMatcher'.
+   * 
+   * @return the value of field 'CompoundMatcher'.
+   */
+  public CompoundMatcher getCompoundMatcher()
+  {
+    return this._compoundMatcher;
+  }
+
+  /**
+   * Returns the value of field 'matchCondition'.
+   * 
+   * @return the value of field 'MatchCondition'.
+   */
+  public MatchCondition getMatchCondition()
+  {
+    return this._matchCondition;
+  }
+
+  /**
+   * Method isValid.
+   * 
+   * @return true if this object is valid according to the schema
+   */
+  public boolean isValid()
+  {
+    try
+    {
+      validate();
+    } catch (org.exolab.castor.xml.ValidationException vex)
+    {
+      return false;
+    }
+    return true;
+  }
+
+  /**
+   * 
+   * 
+   * @param out
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   */
+  public void marshal(final java.io.Writer out)
+          throws org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    Marshaller.marshal(this, out);
+  }
+
+  /**
+   * 
+   * 
+   * @param handler
+   * @throws java.io.IOException
+   *           if an IOException occurs during marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   */
+  public void marshal(final org.xml.sax.ContentHandler handler)
+          throws java.io.IOException,
+          org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    Marshaller.marshal(this, handler);
+  }
+
+  /**
+   * Sets the value of field 'compoundMatcher'.
+   * 
+   * @param compoundMatcher
+   *          the value of field 'compoundMatcher'.
+   */
+  public void setCompoundMatcher(final CompoundMatcher compoundMatcher)
+  {
+    this._compoundMatcher = compoundMatcher;
+    this._choiceValue = compoundMatcher;
+  }
+
+  /**
+   * Sets the value of field 'matchCondition'.
+   * 
+   * @param matchCondition
+   *          the value of field 'matchCondition'.
+   */
+  public void setMatchCondition(final MatchCondition matchCondition)
+  {
+    this._matchCondition = matchCondition;
+    this._choiceValue = matchCondition;
+  }
+
+  /**
+   * Method unmarshal.
+   * 
+   * @param reader
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   * @return the unmarshaled jalview.schemabinding.version2.FeatureMatcherSet
+   */
+  public static jalview.schemabinding.version2.FeatureMatcherSet unmarshal(
+          final java.io.Reader reader)
+          throws org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    return (jalview.schemabinding.version2.FeatureMatcherSet) Unmarshaller
+            .unmarshal(
+                    jalview.schemabinding.version2.FeatureMatcherSet.class,
+                    reader);
+  }
+
+  /**
+   * 
+   * 
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   */
+  public void validate() throws org.exolab.castor.xml.ValidationException
+  {
+    org.exolab.castor.xml.Validator validator = new org.exolab.castor.xml.Validator();
+    validator.validate(this);
+  }
+
+}
diff --git a/src/jalview/schemabinding/version2/Filter.java b/src/jalview/schemabinding/version2/Filter.java
new file mode 100644
index 0000000..45323a7
--- /dev/null
+++ b/src/jalview/schemabinding/version2/Filter.java
@@ -0,0 +1,181 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2;
+
+//---------------------------------/
+//- Imported classes and packages -/
+//---------------------------------/
+
+import org.exolab.castor.xml.Marshaller;
+import org.exolab.castor.xml.Unmarshaller;
+
+/**
+ * Class Filter.
+ * 
+ * @version $Revision$ $Date$
+ */
+public class Filter implements java.io.Serializable
+{
+
+  // --------------------------/
+  // - Class/Member Variables -/
+  // --------------------------/
+
+  /**
+   * Field _featureType.
+   */
+  private java.lang.String _featureType;
+
+  /**
+   * Field _matcherSet.
+   */
+  private jalview.schemabinding.version2.MatcherSet _matcherSet;
+
+  // ----------------/
+  // - Constructors -/
+  // ----------------/
+
+  public Filter()
+  {
+    super();
+  }
+
+  // -----------/
+  // - Methods -/
+  // -----------/
+
+  /**
+   * Returns the value of field 'featureType'.
+   * 
+   * @return the value of field 'FeatureType'.
+   */
+  public java.lang.String getFeatureType()
+  {
+    return this._featureType;
+  }
+
+  /**
+   * Returns the value of field 'matcherSet'.
+   * 
+   * @return the value of field 'MatcherSet'.
+   */
+  public jalview.schemabinding.version2.MatcherSet getMatcherSet()
+  {
+    return this._matcherSet;
+  }
+
+  /**
+   * Method isValid.
+   * 
+   * @return true if this object is valid according to the schema
+   */
+  public boolean isValid()
+  {
+    try
+    {
+      validate();
+    } catch (org.exolab.castor.xml.ValidationException vex)
+    {
+      return false;
+    }
+    return true;
+  }
+
+  /**
+   * 
+   * 
+   * @param out
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   */
+  public void marshal(final java.io.Writer out)
+          throws org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    Marshaller.marshal(this, out);
+  }
+
+  /**
+   * 
+   * 
+   * @param handler
+   * @throws java.io.IOException
+   *           if an IOException occurs during marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   */
+  public void marshal(final org.xml.sax.ContentHandler handler)
+          throws java.io.IOException,
+          org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    Marshaller.marshal(this, handler);
+  }
+
+  /**
+   * Sets the value of field 'featureType'.
+   * 
+   * @param featureType
+   *          the value of field 'featureType'.
+   */
+  public void setFeatureType(final java.lang.String featureType)
+  {
+    this._featureType = featureType;
+  }
+
+  /**
+   * Sets the value of field 'matcherSet'.
+   * 
+   * @param matcherSet
+   *          the value of field 'matcherSet'.
+   */
+  public void setMatcherSet(
+          final jalview.schemabinding.version2.MatcherSet matcherSet)
+  {
+    this._matcherSet = matcherSet;
+  }
+
+  /**
+   * Method unmarshal.
+   * 
+   * @param reader
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   * @return the unmarshaled jalview.schemabinding.version2.Filter
+   */
+  public static jalview.schemabinding.version2.Filter unmarshal(
+          final java.io.Reader reader)
+          throws org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    return (jalview.schemabinding.version2.Filter) Unmarshaller
+            .unmarshal(jalview.schemabinding.version2.Filter.class, reader);
+  }
+
+  /**
+   * 
+   * 
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   */
+  public void validate() throws org.exolab.castor.xml.ValidationException
+  {
+    org.exolab.castor.xml.Validator validator = new org.exolab.castor.xml.Validator();
+    validator.validate(this);
+  }
+
+}
diff --git a/src/jalview/schemabinding/version2/JalviewUserColours.java b/src/jalview/schemabinding/version2/JalviewUserColours.java
index 042f092..c8d52ac 100644
--- a/src/jalview/schemabinding/version2/JalviewUserColours.java
+++ b/src/jalview/schemabinding/version2/JalviewUserColours.java
@@ -42,6 +42,11 @@ public class JalviewUserColours implements java.io.Serializable
    */
   private java.util.Vector _colourList;
 
+  /**
+   * Field _filterList.
+   */
+  private java.util.Vector _filterList;
+
   // ----------------/
   // - Constructors -/
   // ----------------/
@@ -50,6 +55,7 @@ public class JalviewUserColours implements java.io.Serializable
   {
     super();
     this._colourList = new java.util.Vector();
+    this._filterList = new java.util.Vector();
   }
 
   // -----------/
@@ -84,6 +90,33 @@ public class JalviewUserColours implements java.io.Serializable
   }
 
   /**
+   * 
+   * 
+   * @param vFilter
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   */
+  public void addFilter(final Filter vFilter)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    this._filterList.addElement(vFilter);
+  }
+
+  /**
+   * 
+   * 
+   * @param index
+   * @param vFilter
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   */
+  public void addFilter(final int index, final Filter vFilter)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    this._filterList.add(index, vFilter);
+  }
+
+  /**
    * Method enumerateColour.
    * 
    * @return an Enumeration over all Colour elements
@@ -94,6 +127,16 @@ public class JalviewUserColours implements java.io.Serializable
   }
 
   /**
+   * Method enumerateFilter.
+   * 
+   * @return an Enumeration over all Filter elements
+   */
+  public java.util.Enumeration enumerateFilter()
+  {
+    return this._filterList.elements();
+  }
+
+  /**
    * Method getColour.
    * 
    * @param index
@@ -107,9 +150,9 @@ public class JalviewUserColours implements java.io.Serializable
     // check bounds for index
     if (index < 0 || index >= this._colourList.size())
     {
-      throw new IndexOutOfBoundsException("getColour: Index value '"
-              + index + "' not in range [0.."
-              + (this._colourList.size() - 1) + "]");
+      throw new IndexOutOfBoundsException(
+              "getColour: Index value '" + index + "' not in range [0.."
+                      + (this._colourList.size() - 1) + "]");
     }
 
     return (Colour) _colourList.get(index);
@@ -141,6 +184,53 @@ public class JalviewUserColours implements java.io.Serializable
   }
 
   /**
+   * Method getFilter.
+   * 
+   * @param index
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   * @return the value of the Filter at the given index
+   */
+  public Filter getFilter(final int index)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    // check bounds for index
+    if (index < 0 || index >= this._filterList.size())
+    {
+      throw new IndexOutOfBoundsException(
+              "getFilter: Index value '" + index + "' not in range [0.."
+                      + (this._filterList.size() - 1) + "]");
+    }
+
+    return (Filter) _filterList.get(index);
+  }
+
+  /**
+   * Method getFilter.Returns the contents of the collection in an Array.
+   * 

+   * Note: Just in case the collection contents are changing in another thread,
+   * we pass a 0-length Array of the correct type into the API call. This way we
+   * know that the Array returned is of exactly the correct length.
+   * 
+   * @return this collection as an Array
+   */
+  public Filter[] getFilter()
+  {
+    Filter[] array = new Filter[0];
+    return (Filter[]) this._filterList.toArray(array);
+  }
+
+  /**
+   * Method getFilterCount.
+   * 
+   * @return the size of this collection
+   */
+  public int getFilterCount()
+  {
+    return this._filterList.size();
+  }
+
+  /**
    * Returns the value of field 'schemeName'.
    * 
    * @return the value of field 'SchemeName'.
@@ -217,13 +307,20 @@ public class JalviewUserColours implements java.io.Serializable
   }
 
   /**
-     */
+   */
   public void removeAllColour()
   {
     this._colourList.clear();
   }
 
   /**
+   */
+  public void removeAllFilter()
+  {
+    this._filterList.clear();
+  }
+
+  /**
    * Method removeColour.
    * 
    * @param vColour
@@ -248,6 +345,30 @@ public class JalviewUserColours implements java.io.Serializable
   }
 
   /**
+   * Method removeFilter.
+   * 
+   * @param vFilter
+   * @return true if the object was removed from the collection.
+   */
+  public boolean removeFilter(final Filter vFilter)
+  {
+    boolean removed = _filterList.remove(vFilter);
+    return removed;
+  }
+
+  /**
+   * Method removeFilterAt.
+   * 
+   * @param index
+   * @return the element removed from the collection
+   */
+  public Filter removeFilterAt(final int index)
+  {
+    java.lang.Object obj = this._filterList.remove(index);
+    return (Filter) obj;
+  }
+
+  /**
    * 
    * 
    * @param index
@@ -261,9 +382,9 @@ public class JalviewUserColours implements java.io.Serializable
     // check bounds for index
     if (index < 0 || index >= this._colourList.size())
     {
-      throw new IndexOutOfBoundsException("setColour: Index value '"
-              + index + "' not in range [0.."
-              + (this._colourList.size() - 1) + "]");
+      throw new IndexOutOfBoundsException(
+              "setColour: Index value '" + index + "' not in range [0.."
+                      + (this._colourList.size() - 1) + "]");
     }
 
     this._colourList.set(index, vColour);
@@ -286,6 +407,44 @@ public class JalviewUserColours implements java.io.Serializable
   }
 
   /**
+   * 
+   * 
+   * @param index
+   * @param vFilter
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   */
+  public void setFilter(final int index, final Filter vFilter)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    // check bounds for index
+    if (index < 0 || index >= this._filterList.size())
+    {
+      throw new IndexOutOfBoundsException(
+              "setFilter: Index value '" + index + "' not in range [0.."
+                      + (this._filterList.size() - 1) + "]");
+    }
+
+    this._filterList.set(index, vFilter);
+  }
+
+  /**
+   * 
+   * 
+   * @param vFilterArray
+   */
+  public void setFilter(final Filter[] vFilterArray)
+  {
+    // -- copy array
+    _filterList.clear();
+
+    for (int i = 0; i < vFilterArray.length; i++)
+    {
+      this._filterList.add(vFilterArray[i]);
+    }
+  }
+
+  /**
    * Sets the value of field 'schemeName'.
    * 
    * @param schemeName
diff --git a/src/jalview/schemabinding/version2/MatchCondition.java b/src/jalview/schemabinding/version2/MatchCondition.java
new file mode 100644
index 0000000..af2f3f5
--- /dev/null
+++ b/src/jalview/schemabinding/version2/MatchCondition.java
@@ -0,0 +1,126 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2;
+
+//---------------------------------/
+//- Imported classes and packages -/
+//---------------------------------/
+
+import org.exolab.castor.xml.Marshaller;
+import org.exolab.castor.xml.Unmarshaller;
+
+/**
+ * Class MatchCondition.
+ * 
+ * @version $Revision$ $Date$
+ */
+public class MatchCondition extends FeatureMatcher
+        implements java.io.Serializable
+{
+
+  // ----------------/
+  // - Constructors -/
+  // ----------------/
+
+  public MatchCondition()
+  {
+    super();
+  }
+
+  // -----------/
+  // - Methods -/
+  // -----------/
+
+  /**
+   * Method isValid.
+   * 
+   * @return true if this object is valid according to the schema
+   */
+  public boolean isValid()
+  {
+    try
+    {
+      validate();
+    } catch (org.exolab.castor.xml.ValidationException vex)
+    {
+      return false;
+    }
+    return true;
+  }
+
+  /**
+   * 
+   * 
+   * @param out
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   */
+  public void marshal(final java.io.Writer out)
+          throws org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    Marshaller.marshal(this, out);
+  }
+
+  /**
+   * 
+   * 
+   * @param handler
+   * @throws java.io.IOException
+   *           if an IOException occurs during marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   */
+  public void marshal(final org.xml.sax.ContentHandler handler)
+          throws java.io.IOException,
+          org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    Marshaller.marshal(this, handler);
+  }
+
+  /**
+   * Method unmarshal.
+   * 
+   * @param reader
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   * @return the unmarshaled jalview.schemabinding.version2.FeatureMatcher
+   */
+  public static jalview.schemabinding.version2.FeatureMatcher unmarshal(
+          final java.io.Reader reader)
+          throws org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    return (jalview.schemabinding.version2.FeatureMatcher) Unmarshaller
+            .unmarshal(jalview.schemabinding.version2.MatchCondition.class,
+                    reader);
+  }
+
+  /**
+   * 
+   * 
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   */
+  public void validate() throws org.exolab.castor.xml.ValidationException
+  {
+    org.exolab.castor.xml.Validator validator = new org.exolab.castor.xml.Validator();
+    validator.validate(this);
+  }
+
+}
diff --git a/src/jalview/schemabinding/version2/MatcherSet.java b/src/jalview/schemabinding/version2/MatcherSet.java
new file mode 100644
index 0000000..6fde9e4
--- /dev/null
+++ b/src/jalview/schemabinding/version2/MatcherSet.java
@@ -0,0 +1,126 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2;
+
+//---------------------------------/
+//- Imported classes and packages -/
+//---------------------------------/
+
+import org.exolab.castor.xml.Marshaller;
+import org.exolab.castor.xml.Unmarshaller;
+
+/**
+ * optional filter(s) applied to the feature type
+ * 
+ * @version $Revision$ $Date$
+ */
+public class MatcherSet extends FeatureMatcherSet
+        implements java.io.Serializable
+{
+
+  // ----------------/
+  // - Constructors -/
+  // ----------------/
+
+  public MatcherSet()
+  {
+    super();
+  }
+
+  // -----------/
+  // - Methods -/
+  // -----------/
+
+  /**
+   * Method isValid.
+   * 
+   * @return true if this object is valid according to the schema
+   */
+  public boolean isValid()
+  {
+    try
+    {
+      validate();
+    } catch (org.exolab.castor.xml.ValidationException vex)
+    {
+      return false;
+    }
+    return true;
+  }
+
+  /**
+   * 
+   * 
+   * @param out
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   */
+  public void marshal(final java.io.Writer out)
+          throws org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    Marshaller.marshal(this, out);
+  }
+
+  /**
+   * 
+   * 
+   * @param handler
+   * @throws java.io.IOException
+   *           if an IOException occurs during marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   */
+  public void marshal(final org.xml.sax.ContentHandler handler)
+          throws java.io.IOException,
+          org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    Marshaller.marshal(this, handler);
+  }
+
+  /**
+   * Method unmarshal.
+   * 
+   * @param reader
+   * @throws org.exolab.castor.xml.MarshalException
+   *           if object is null or if any SAXException is thrown during
+   *           marshaling
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   * @return the unmarshaled jalview.schemabinding.version2.FeatureMatcherSet
+   */
+  public static jalview.schemabinding.version2.FeatureMatcherSet unmarshal(
+          final java.io.Reader reader)
+          throws org.exolab.castor.xml.MarshalException,
+          org.exolab.castor.xml.ValidationException
+  {
+    return (jalview.schemabinding.version2.FeatureMatcherSet) Unmarshaller
+            .unmarshal(jalview.schemabinding.version2.MatcherSet.class,
+                    reader);
+  }
+
+  /**
+   * 
+   * 
+   * @throws org.exolab.castor.xml.ValidationException
+   *           if this object is an invalid instance according to the schema
+   */
+  public void validate() throws org.exolab.castor.xml.ValidationException
+  {
+    org.exolab.castor.xml.Validator validator = new org.exolab.castor.xml.Validator();
+    validator.validate(this);
+  }
+
+}
diff --git a/src/jalview/schemabinding/version2/OtherData.java b/src/jalview/schemabinding/version2/OtherData.java
index fb6b276..31797fe 100644
--- a/src/jalview/schemabinding/version2/OtherData.java
+++ b/src/jalview/schemabinding/version2/OtherData.java
@@ -7,8 +7,8 @@
 
 package jalview.schemabinding.version2;
 
-//---------------------------------/
-//- Imported classes and packages -/
+  //---------------------------------/
+ //- Imported classes and packages -/
 //---------------------------------/
 
 import org.exolab.castor.xml.Marshaller;
@@ -19,163 +19,181 @@ import org.exolab.castor.xml.Unmarshaller;
  * 
  * @version $Revision$ $Date$
  */
-public class OtherData implements java.io.Serializable
-{
-
-  // --------------------------/
-  // - Class/Member Variables -/
-  // --------------------------/
-
-  /**
-   * Field _key.
-   */
-  private java.lang.String _key;
-
-  /**
-   * Field _value.
-   */
-  private java.lang.String _value;
-
-  // ----------------/
-  // - Constructors -/
-  // ----------------/
-
-  public OtherData()
-  {
-    super();
-  }
-
-  // -----------/
-  // - Methods -/
-  // -----------/
-
-  /**
-   * Returns the value of field 'key'.
-   * 
-   * @return the value of field 'Key'.
-   */
-  public java.lang.String getKey()
-  {
-    return this._key;
-  }
-
-  /**
-   * Returns the value of field 'value'.
-   * 
-   * @return the value of field 'Value'.
-   */
-  public java.lang.String getValue()
-  {
-    return this._value;
-  }
-
-  /**
-   * Method isValid.
-   * 
-   * @return true if this object is valid according to the schema
-   */
-  public boolean isValid()
-  {
-    try
-    {
-      validate();
-    } catch (org.exolab.castor.xml.ValidationException vex)
-    {
-      return false;
+public class OtherData implements java.io.Serializable {
+
+
+      //--------------------------/
+     //- Class/Member Variables -/
+    //--------------------------/
+
+    /**
+     * Field _key.
+     */
+    private java.lang.String _key;
+
+    /**
+     * key2 may be used for a sub-attribute of key
+     */
+    private java.lang.String _key2;
+
+    /**
+     * Field _value.
+     */
+    private java.lang.String _value;
+
+
+      //----------------/
+     //- Constructors -/
+    //----------------/
+
+    public OtherData() {
+        super();
+    }
+
+
+      //-----------/
+     //- Methods -/
+    //-----------/
+
+    /**
+     * Returns the value of field 'key'.
+     * 
+     * @return the value of field 'Key'.
+     */
+    public java.lang.String getKey(
+    ) {
+        return this._key;
+    }
+
+    /**
+     * Returns the value of field 'key2'. The field 'key2' has the
+     * following description: key2 may be used for a sub-attribute
+     * of key
+     * 
+     * @return the value of field 'Key2'.
+     */
+    public java.lang.String getKey2(
+    ) {
+        return this._key2;
+    }
+
+    /**
+     * Returns the value of field 'value'.
+     * 
+     * @return the value of field 'Value'.
+     */
+    public java.lang.String getValue(
+    ) {
+        return this._value;
+    }
+
+    /**
+     * Method isValid.
+     * 
+     * @return true if this object is valid according to the schema
+     */
+    public boolean isValid(
+    ) {
+        try {
+            validate();
+        } catch (org.exolab.castor.xml.ValidationException vex) {
+            return false;
+        }
+        return true;
+    }
+
+    /**
+     * 
+     * 
+     * @param out
+     * @throws org.exolab.castor.xml.MarshalException if object is
+     * null or if any SAXException is thrown during marshaling
+     * @throws org.exolab.castor.xml.ValidationException if this
+     * object is an invalid instance according to the schema
+     */
+    public void marshal(
+            final java.io.Writer out)
+    throws org.exolab.castor.xml.MarshalException, org.exolab.castor.xml.ValidationException {
+        Marshaller.marshal(this, out);
+    }
+
+    /**
+     * 
+     * 
+     * @param handler
+     * @throws java.io.IOException if an IOException occurs during
+     * marshaling
+     * @throws org.exolab.castor.xml.ValidationException if this
+     * object is an invalid instance according to the schema
+     * @throws org.exolab.castor.xml.MarshalException if object is
+     * null or if any SAXException is thrown during marshaling
+     */
+    public void marshal(
+            final org.xml.sax.ContentHandler handler)
+    throws java.io.IOException, org.exolab.castor.xml.MarshalException, org.exolab.castor.xml.ValidationException {
+        Marshaller.marshal(this, handler);
+    }
+
+    /**
+     * Sets the value of field 'key'.
+     * 
+     * @param key the value of field 'key'.
+     */
+    public void setKey(
+            final java.lang.String key) {
+        this._key = key;
+    }
+
+    /**
+     * Sets the value of field 'key2'. The field 'key2' has the
+     * following description: key2 may be used for a sub-attribute
+     * of key
+     * 
+     * @param key2 the value of field 'key2'.
+     */
+    public void setKey2(
+            final java.lang.String key2) {
+        this._key2 = key2;
+    }
+
+    /**
+     * Sets the value of field 'value'.
+     * 
+     * @param value the value of field 'value'.
+     */
+    public void setValue(
+            final java.lang.String value) {
+        this._value = value;
+    }
+
+    /**
+     * Method unmarshal.
+     * 
+     * @param reader
+     * @throws org.exolab.castor.xml.MarshalException if object is
+     * null or if any SAXException is thrown during marshaling
+     * @throws org.exolab.castor.xml.ValidationException if this
+     * object is an invalid instance according to the schema
+     * @return the unmarshaled
+     * jalview.schemabinding.version2.OtherData
+     */
+    public static jalview.schemabinding.version2.OtherData unmarshal(
+            final java.io.Reader reader)
+    throws org.exolab.castor.xml.MarshalException, org.exolab.castor.xml.ValidationException {
+        return (jalview.schemabinding.version2.OtherData) Unmarshaller.unmarshal(jalview.schemabinding.version2.OtherData.class, reader);
+    }
+
+    /**
+     * 
+     * 
+     * @throws org.exolab.castor.xml.ValidationException if this
+     * object is an invalid instance according to the schema
+     */
+    public void validate(
+    )
+    throws org.exolab.castor.xml.ValidationException {
+        org.exolab.castor.xml.Validator validator = new org.exolab.castor.xml.Validator();
+        validator.validate(this);
     }
-    return true;
-  }
-
-  /**
-   * 
-   * 
-   * @param out
-   * @throws org.exolab.castor.xml.MarshalException
-   *           if object is null or if any SAXException is thrown during
-   *           marshaling
-   * @throws org.exolab.castor.xml.ValidationException
-   *           if this object is an invalid instance according to the schema
-   */
-  public void marshal(final java.io.Writer out)
-          throws org.exolab.castor.xml.MarshalException,
-          org.exolab.castor.xml.ValidationException
-  {
-    Marshaller.marshal(this, out);
-  }
-
-  /**
-   * 
-   * 
-   * @param handler
-   * @throws java.io.IOException
-   *           if an IOException occurs during marshaling
-   * @throws org.exolab.castor.xml.ValidationException
-   *           if this object is an invalid instance according to the schema
-   * @throws org.exolab.castor.xml.MarshalException
-   *           if object is null or if any SAXException is thrown during
-   *           marshaling
-   */
-  public void marshal(final org.xml.sax.ContentHandler handler)
-          throws java.io.IOException,
-          org.exolab.castor.xml.MarshalException,
-          org.exolab.castor.xml.ValidationException
-  {
-    Marshaller.marshal(this, handler);
-  }
-
-  /**
-   * Sets the value of field 'key'.
-   * 
-   * @param key
-   *          the value of field 'key'.
-   */
-  public void setKey(final java.lang.String key)
-  {
-    this._key = key;
-  }
-
-  /**
-   * Sets the value of field 'value'.
-   * 
-   * @param value
-   *          the value of field 'value'.
-   */
-  public void setValue(final java.lang.String value)
-  {
-    this._value = value;
-  }
-
-  /**
-   * Method unmarshal.
-   * 
-   * @param reader
-   * @throws org.exolab.castor.xml.MarshalException
-   *           if object is null or if any SAXException is thrown during
-   *           marshaling
-   * @throws org.exolab.castor.xml.ValidationException
-   *           if this object is an invalid instance according to the schema
-   * @return the unmarshaled jalview.schemabinding.version2.OtherData
-   */
-  public static jalview.schemabinding.version2.OtherData unmarshal(
-          final java.io.Reader reader)
-          throws org.exolab.castor.xml.MarshalException,
-          org.exolab.castor.xml.ValidationException
-  {
-    return (jalview.schemabinding.version2.OtherData) Unmarshaller
-            .unmarshal(jalview.schemabinding.version2.OtherData.class,
-                    reader);
-  }
-
-  /**
-   * 
-   * 
-   * @throws org.exolab.castor.xml.ValidationException
-   *           if this object is an invalid instance according to the schema
-   */
-  public void validate() throws org.exolab.castor.xml.ValidationException
-  {
-    org.exolab.castor.xml.Validator validator = new org.exolab.castor.xml.Validator();
-    validator.validate(this);
-  }
 
 }
diff --git a/src/jalview/schemabinding/version2/Setting.java b/src/jalview/schemabinding/version2/Setting.java
index c458971..59e9522 100644
--- a/src/jalview/schemabinding/version2/Setting.java
+++ b/src/jalview/schemabinding/version2/Setting.java
@@ -73,6 +73,12 @@ public class Setting implements java.io.Serializable
   private boolean _has_mincolour;
 
   /**
+   * Field _noValueColour.
+   */
+  private jalview.schemabinding.version2.types.NoValueColour _noValueColour = jalview.schemabinding.version2.types.NoValueColour
+          .valueOf("Min");
+
+  /**
    * threshold value for graduated feature colour
    * 
    */
@@ -134,6 +140,16 @@ public class Setting implements java.io.Serializable
    */
   private boolean _has_autoScale;
 
+  /**
+   * name of feature attribute to colour by, or attribute and sub-attribute
+   */
+  private java.util.Vector _attributeNameList;
+
+  /**
+   * optional filter(s) applied to the feature type
+   */
+  private jalview.schemabinding.version2.MatcherSet _matcherSet;
+
   // ----------------/
   // - Constructors -/
   // ----------------/
@@ -141,6 +157,9 @@ public class Setting implements java.io.Serializable
   public Setting()
   {
     super();
+    setNoValueColour(jalview.schemabinding.version2.types.NoValueColour
+            .valueOf("Min"));
+    this._attributeNameList = new java.util.Vector();
   }
 
   // -----------/
@@ -148,76 +167,175 @@ public class Setting implements java.io.Serializable
   // -----------/
 
   /**
-     */
+   * 
+   * 
+   * @param vAttributeName
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   */
+  public void addAttributeName(final java.lang.String vAttributeName)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    // check for the maximum size
+    if (this._attributeNameList.size() >= 2)
+    {
+      throw new IndexOutOfBoundsException(
+              "addAttributeName has a maximum of 2");
+    }
+
+    this._attributeNameList.addElement(vAttributeName);
+  }
+
+  /**
+   * 
+   * 
+   * @param index
+   * @param vAttributeName
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   */
+  public void addAttributeName(final int index,
+          final java.lang.String vAttributeName)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    // check for the maximum size
+    if (this._attributeNameList.size() >= 2)
+    {
+      throw new IndexOutOfBoundsException(
+              "addAttributeName has a maximum of 2");
+    }
+
+    this._attributeNameList.add(index, vAttributeName);
+  }
+
+  /**
+   */
   public void deleteAutoScale()
   {
     this._has_autoScale = false;
   }
 
   /**
-     */
+   */
   public void deleteColour()
   {
     this._has_colour = false;
   }
 
   /**
-     */
+   */
   public void deleteColourByLabel()
   {
     this._has_colourByLabel = false;
   }
 
   /**
-     */
+   */
   public void deleteDisplay()
   {
     this._has_display = false;
   }
 
   /**
-     */
+   */
   public void deleteMax()
   {
     this._has_max = false;
   }
 
   /**
-     */
+   */
   public void deleteMin()
   {
     this._has_min = false;
   }
 
   /**
-     */
+   */
   public void deleteMincolour()
   {
     this._has_mincolour = false;
   }
 
   /**
-     */
+   */
   public void deleteOrder()
   {
     this._has_order = false;
   }
 
   /**
-     */
+   */
   public void deleteThreshold()
   {
     this._has_threshold = false;
   }
 
   /**
-     */
+   */
   public void deleteThreshstate()
   {
     this._has_threshstate = false;
   }
 
   /**
+   * Method enumerateAttributeName.
+   * 
+   * @return an Enumeration over all java.lang.String elements
+   */
+  public java.util.Enumeration enumerateAttributeName()
+  {
+    return this._attributeNameList.elements();
+  }
+
+  /**
+   * Method getAttributeName.
+   * 
+   * @param index
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   * @return the value of the java.lang.String at the given index
+   */
+  public java.lang.String getAttributeName(final int index)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    // check bounds for index
+    if (index < 0 || index >= this._attributeNameList.size())
+    {
+      throw new IndexOutOfBoundsException("getAttributeName: Index value '"
+              + index + "' not in range [0.."
+              + (this._attributeNameList.size() - 1) + "]");
+    }
+
+    return (java.lang.String) _attributeNameList.get(index);
+  }
+
+  /**
+   * Method getAttributeName.Returns the contents of the collection in an Array.
+   * 

+   * Note: Just in case the collection contents are changing in another thread,
+   * we pass a 0-length Array of the correct type into the API call. This way we
+   * know that the Array returned is of exactly the correct length.
+   * 
+   * @return this collection as an Array
+   */
+  public java.lang.String[] getAttributeName()
+  {
+    java.lang.String[] array = new java.lang.String[0];
+    return (java.lang.String[]) this._attributeNameList.toArray(array);
+  }
+
+  /**
+   * Method getAttributeNameCount.
+   * 
+   * @return the size of this collection
+   */
+  public int getAttributeNameCount()
+  {
+    return this._attributeNameList.size();
+  }
+
+  /**
    * Returns the value of field 'autoScale'.
    * 
    * @return the value of field 'AutoScale'.
@@ -258,6 +376,17 @@ public class Setting implements java.io.Serializable
   }
 
   /**
+   * Returns the value of field 'matcherSet'. The field 'matcherSet' has the
+   * following description: optional filter(s) applied to the feature type
+   * 
+   * @return the value of field 'MatcherSet'.
+   */
+  public jalview.schemabinding.version2.MatcherSet getMatcherSet()
+  {
+    return this._matcherSet;
+  }
+
+  /**
    * Returns the value of field 'max'.
    * 
    * @return the value of field 'Max'.
@@ -290,6 +419,16 @@ public class Setting implements java.io.Serializable
   }
 
   /**
+   * Returns the value of field 'noValueColour'.
+   * 
+   * @return the value of field 'NoValueColour'.
+   */
+  public jalview.schemabinding.version2.types.NoValueColour getNoValueColour()
+  {
+    return this._noValueColour;
+  }
+
+  /**
    * Returns the value of field 'order'.
    * 
    * @return the value of field 'Order'.
@@ -518,6 +657,76 @@ public class Setting implements java.io.Serializable
   }
 
   /**
+   */
+  public void removeAllAttributeName()
+  {
+    this._attributeNameList.clear();
+  }
+
+  /**
+   * Method removeAttributeName.
+   * 
+   * @param vAttributeName
+   * @return true if the object was removed from the collection.
+   */
+  public boolean removeAttributeName(final java.lang.String vAttributeName)
+  {
+    boolean removed = _attributeNameList.remove(vAttributeName);
+    return removed;
+  }
+
+  /**
+   * Method removeAttributeNameAt.
+   * 
+   * @param index
+   * @return the element removed from the collection
+   */
+  public java.lang.String removeAttributeNameAt(final int index)
+  {
+    java.lang.Object obj = this._attributeNameList.remove(index);
+    return (java.lang.String) obj;
+  }
+
+  /**
+   * 
+   * 
+   * @param index
+   * @param vAttributeName
+   * @throws java.lang.IndexOutOfBoundsException
+   *           if the index given is outside the bounds of the collection
+   */
+  public void setAttributeName(final int index,
+          final java.lang.String vAttributeName)
+          throws java.lang.IndexOutOfBoundsException
+  {
+    // check bounds for index
+    if (index < 0 || index >= this._attributeNameList.size())
+    {
+      throw new IndexOutOfBoundsException("setAttributeName: Index value '"
+              + index + "' not in range [0.."
+              + (this._attributeNameList.size() - 1) + "]");
+    }
+
+    this._attributeNameList.set(index, vAttributeName);
+  }
+
+  /**
+   * 
+   * 
+   * @param vAttributeNameArray
+   */
+  public void setAttributeName(final java.lang.String[] vAttributeNameArray)
+  {
+    // -- copy array
+    _attributeNameList.clear();
+
+    for (int i = 0; i < vAttributeNameArray.length; i++)
+    {
+      this._attributeNameList.add(vAttributeNameArray[i]);
+    }
+  }
+
+  /**
    * Sets the value of field 'autoScale'.
    * 
    * @param autoScale
@@ -566,6 +775,19 @@ public class Setting implements java.io.Serializable
   }
 
   /**
+   * Sets the value of field 'matcherSet'. The field 'matcherSet' has the
+   * following description: optional filter(s) applied to the feature type
+   * 
+   * @param matcherSet
+   *          the value of field 'matcherSet'.
+   */
+  public void setMatcherSet(
+          final jalview.schemabinding.version2.MatcherSet matcherSet)
+  {
+    this._matcherSet = matcherSet;
+  }
+
+  /**
    * Sets the value of field 'max'.
    * 
    * @param max
@@ -604,6 +826,18 @@ public class Setting implements java.io.Serializable
   }
 
   /**
+   * Sets the value of field 'noValueColour'.
+   * 
+   * @param noValueColour
+   *          the value of field 'noValueColour'.
+   */
+  public void setNoValueColour(
+          final jalview.schemabinding.version2.types.NoValueColour noValueColour)
+  {
+    this._noValueColour = noValueColour;
+  }
+
+  /**
    * Sets the value of field 'order'.
    * 
    * @param order
diff --git a/src/jalview/schemabinding/version2/descriptors/ColourDescriptor.java b/src/jalview/schemabinding/version2/descriptors/ColourDescriptor.java
index 8b1ae9e..cca4ef1 100644
--- a/src/jalview/schemabinding/version2/descriptors/ColourDescriptor.java
+++ b/src/jalview/schemabinding/version2/descriptors/ColourDescriptor.java
@@ -18,8 +18,8 @@ import jalview.schemabinding.version2.Colour;
  * 
  * @version $Revision$ $Date$
  */
-public class ColourDescriptor extends
-        org.exolab.castor.xml.util.XMLClassDescriptorImpl
+public class ColourDescriptor
+        extends org.exolab.castor.xml.util.XMLClassDescriptorImpl
 {
 
   // --------------------------/
@@ -55,6 +55,9 @@ public class ColourDescriptor extends
     super();
     _xmlName = "colour";
     _elementDefinition = true;
+
+    // -- set grouping compositor
+    setCompositorAsSequence();
     org.exolab.castor.xml.util.XMLFieldDescriptorImpl desc = null;
     org.exolab.castor.mapping.FieldHandler handler = null;
     org.exolab.castor.xml.FieldValidator fieldValidator = null;
@@ -197,11 +200,57 @@ public class ColourDescriptor extends
       typeValidator.setWhiteSpace("preserve");
     }
     desc.setValidator(fieldValidator);
-    // -- _threshType
+    // -- _noValueColour
     desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
-            java.lang.String.class, "_threshType", "threshType",
+            jalview.schemabinding.version2.types.NoValueColour.class,
+            "_noValueColour", "noValueColour",
             org.exolab.castor.xml.NodeType.Attribute);
+    handler = new org.exolab.castor.xml.XMLFieldHandler()
+    {
+      public java.lang.Object getValue(java.lang.Object object)
+              throws IllegalStateException
+      {
+        Colour target = (Colour) object;
+        return target.getNoValueColour();
+      }
+
+      public void setValue(java.lang.Object object, java.lang.Object value)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          Colour target = (Colour) object;
+          target.setNoValueColour(
+                  (jalview.schemabinding.version2.types.NoValueColour) value);
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      public java.lang.Object newInstance(java.lang.Object parent)
+      {
+        return null;
+      }
+    };
+    handler = new org.exolab.castor.xml.handlers.EnumFieldHandler(
+            jalview.schemabinding.version2.types.NoValueColour.class,
+            handler);
     desc.setImmutable(true);
+    desc.setHandler(handler);
+    desc.setMultivalued(false);
+    addFieldDescriptor(desc);
+
+    // -- validation code for: _noValueColour
+    fieldValidator = new org.exolab.castor.xml.FieldValidator();
+    { // -- local scope
+    }
+    desc.setValidator(fieldValidator);
+    // -- _threshType
+    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
+            jalview.schemabinding.version2.types.ColourThreshTypeType.class,
+            "_threshType", "threshType",
+            org.exolab.castor.xml.NodeType.Attribute);
     handler = new org.exolab.castor.xml.XMLFieldHandler()
     {
       public java.lang.Object getValue(java.lang.Object object)
@@ -217,7 +266,8 @@ public class ColourDescriptor extends
         try
         {
           Colour target = (Colour) object;
-          target.setThreshType((java.lang.String) value);
+          target.setThreshType(
+                  (jalview.schemabinding.version2.types.ColourThreshTypeType) value);
         } catch (java.lang.Exception ex)
         {
           throw new IllegalStateException(ex.toString());
@@ -229,6 +279,10 @@ public class ColourDescriptor extends
         return null;
       }
     };
+    handler = new org.exolab.castor.xml.handlers.EnumFieldHandler(
+            jalview.schemabinding.version2.types.ColourThreshTypeType.class,
+            handler);
+    desc.setImmutable(true);
     desc.setHandler(handler);
     desc.setMultivalued(false);
     addFieldDescriptor(desc);
@@ -236,10 +290,6 @@ public class ColourDescriptor extends
     // -- validation code for: _threshType
     fieldValidator = new org.exolab.castor.xml.FieldValidator();
     { // -- local scope
-      org.exolab.castor.xml.validators.StringValidator typeValidator;
-      typeValidator = new org.exolab.castor.xml.validators.StringValidator();
-      fieldValidator.setValidator(typeValidator);
-      typeValidator.setWhiteSpace("preserve");
     }
     desc.setValidator(fieldValidator);
     // -- _threshold
@@ -437,8 +487,8 @@ public class ColourDescriptor extends
             target.deleteColourByLabel();
             return;
           }
-          target.setColourByLabel(((java.lang.Boolean) value)
-                  .booleanValue());
+          target.setColourByLabel(
+                  ((java.lang.Boolean) value).booleanValue());
         } catch (java.lang.Exception ex)
         {
           throw new IllegalStateException(ex.toString());
@@ -518,6 +568,66 @@ public class ColourDescriptor extends
     desc.setValidator(fieldValidator);
     // -- initialize element descriptors
 
+    // -- _attributeNameList
+    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
+            java.lang.String.class, "_attributeNameList", "attributeName",
+            org.exolab.castor.xml.NodeType.Element);
+    desc.setImmutable(true);
+    handler = new org.exolab.castor.xml.XMLFieldHandler()
+    {
+      public java.lang.Object getValue(java.lang.Object object)
+              throws IllegalStateException
+      {
+        Colour target = (Colour) object;
+        return target.getAttributeName();
+      }
+
+      public void setValue(java.lang.Object object, java.lang.Object value)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          Colour target = (Colour) object;
+          target.addAttributeName((java.lang.String) value);
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      public void resetValue(Object object)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          Colour target = (Colour) object;
+          target.removeAllAttributeName();
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      public java.lang.Object newInstance(java.lang.Object parent)
+      {
+        return null;
+      }
+    };
+    desc.setHandler(handler);
+    desc.setMultivalued(true);
+    addFieldDescriptor(desc);
+
+    // -- validation code for: _attributeNameList
+    fieldValidator = new org.exolab.castor.xml.FieldValidator();
+    fieldValidator.setMinOccurs(0);
+    fieldValidator.setMaxOccurs(2);
+    { // -- local scope
+      org.exolab.castor.xml.validators.StringValidator typeValidator;
+      typeValidator = new org.exolab.castor.xml.validators.StringValidator();
+      fieldValidator.setValidator(typeValidator);
+      typeValidator.setWhiteSpace("preserve");
+    }
+    desc.setValidator(fieldValidator);
   }
 
   // -----------/
diff --git a/src/jalview/schemabinding/version2/descriptors/CompoundMatcherDescriptor.java b/src/jalview/schemabinding/version2/descriptors/CompoundMatcherDescriptor.java
new file mode 100644
index 0000000..2402d68
--- /dev/null
+++ b/src/jalview/schemabinding/version2/descriptors/CompoundMatcherDescriptor.java
@@ -0,0 +1,270 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2.descriptors;
+
+//---------------------------------/
+//- Imported classes and packages -/
+//---------------------------------/
+
+import jalview.schemabinding.version2.CompoundMatcher;
+
+/**
+ * Class CompoundMatcherDescriptor.
+ * 
+ * @version $Revision$ $Date$
+ */
+public class CompoundMatcherDescriptor
+        extends org.exolab.castor.xml.util.XMLClassDescriptorImpl
+{
+
+  // --------------------------/
+  // - Class/Member Variables -/
+  // --------------------------/
+
+  /**
+   * Field _elementDefinition.
+   */
+  private boolean _elementDefinition;
+
+  /**
+   * Field _nsPrefix.
+   */
+  private java.lang.String _nsPrefix;
+
+  /**
+   * Field _nsURI.
+   */
+  private java.lang.String _nsURI;
+
+  /**
+   * Field _xmlName.
+   */
+  private java.lang.String _xmlName;
+
+  // ----------------/
+  // - Constructors -/
+  // ----------------/
+
+  public CompoundMatcherDescriptor()
+  {
+    super();
+    _xmlName = "compoundMatcher";
+    _elementDefinition = true;
+
+    // -- set grouping compositor
+    setCompositorAsSequence();
+    org.exolab.castor.xml.util.XMLFieldDescriptorImpl desc = null;
+    org.exolab.castor.mapping.FieldHandler handler = null;
+    org.exolab.castor.xml.FieldValidator fieldValidator = null;
+    // -- initialize attribute descriptors
+
+    // -- _and
+    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
+            java.lang.Boolean.TYPE, "_and", "and",
+            org.exolab.castor.xml.NodeType.Attribute);
+    handler = new org.exolab.castor.xml.XMLFieldHandler()
+    {
+      public java.lang.Object getValue(java.lang.Object object)
+              throws IllegalStateException
+      {
+        CompoundMatcher target = (CompoundMatcher) object;
+        if (!target.hasAnd())
+        {
+          return null;
+        }
+        return (target.getAnd() ? java.lang.Boolean.TRUE
+                : java.lang.Boolean.FALSE);
+      }
+
+      public void setValue(java.lang.Object object, java.lang.Object value)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          CompoundMatcher target = (CompoundMatcher) object;
+          // ignore null values for non optional primitives
+          if (value == null)
+          {
+            return;
+          }
+
+          target.setAnd(((java.lang.Boolean) value).booleanValue());
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      public java.lang.Object newInstance(java.lang.Object parent)
+      {
+        return null;
+      }
+    };
+    desc.setHandler(handler);
+    desc.setRequired(true);
+    desc.setMultivalued(false);
+    addFieldDescriptor(desc);
+
+    // -- validation code for: _and
+    fieldValidator = new org.exolab.castor.xml.FieldValidator();
+    fieldValidator.setMinOccurs(1);
+    { // -- local scope
+      org.exolab.castor.xml.validators.BooleanValidator typeValidator;
+      typeValidator = new org.exolab.castor.xml.validators.BooleanValidator();
+      fieldValidator.setValidator(typeValidator);
+    }
+    desc.setValidator(fieldValidator);
+    // -- initialize element descriptors
+
+    // -- _matcherSetList
+    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
+            jalview.schemabinding.version2.MatcherSet.class,
+            "_matcherSetList", "matcherSet",
+            org.exolab.castor.xml.NodeType.Element);
+    handler = new org.exolab.castor.xml.XMLFieldHandler()
+    {
+      public java.lang.Object getValue(java.lang.Object object)
+              throws IllegalStateException
+      {
+        CompoundMatcher target = (CompoundMatcher) object;
+        return target.getMatcherSet();
+      }
+
+      public void setValue(java.lang.Object object, java.lang.Object value)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          CompoundMatcher target = (CompoundMatcher) object;
+          target.addMatcherSet(
+                  (jalview.schemabinding.version2.MatcherSet) value);
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      public void resetValue(Object object)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          CompoundMatcher target = (CompoundMatcher) object;
+          target.removeAllMatcherSet();
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      public java.lang.Object newInstance(java.lang.Object parent)
+      {
+        return new jalview.schemabinding.version2.MatcherSet();
+      }
+    };
+    desc.setHandler(handler);
+    desc.setRequired(true);
+    desc.setMultivalued(true);
+    addFieldDescriptor(desc);
+
+    // -- validation code for: _matcherSetList
+    fieldValidator = new org.exolab.castor.xml.FieldValidator();
+    fieldValidator.setMinOccurs(2);
+    fieldValidator.setMaxOccurs(2);
+    { // -- local scope
+    }
+    desc.setValidator(fieldValidator);
+  }
+
+  // -----------/
+  // - Methods -/
+  // -----------/
+
+  /**
+   * Method getAccessMode.
+   * 
+   * @return the access mode specified for this class.
+   */
+  public org.exolab.castor.mapping.AccessMode getAccessMode()
+  {
+    return null;
+  }
+
+  /**
+   * Method getIdentity.
+   * 
+   * @return the identity field, null if this class has no identity.
+   */
+  public org.exolab.castor.mapping.FieldDescriptor getIdentity()
+  {
+    return super.getIdentity();
+  }
+
+  /**
+   * Method getJavaClass.
+   * 
+   * @return the Java class represented by this descriptor.
+   */
+  public java.lang.Class getJavaClass()
+  {
+    return jalview.schemabinding.version2.CompoundMatcher.class;
+  }
+
+  /**
+   * Method getNameSpacePrefix.
+   * 
+   * @return the namespace prefix to use when marshaling as XML.
+   */
+  public java.lang.String getNameSpacePrefix()
+  {
+    return _nsPrefix;
+  }
+
+  /**
+   * Method getNameSpaceURI.
+   * 
+   * @return the namespace URI used when marshaling and unmarshaling as XML.
+   */
+  public java.lang.String getNameSpaceURI()
+  {
+    return _nsURI;
+  }
+
+  /**
+   * Method getValidator.
+   * 
+   * @return a specific validator for the class described by this
+   *         ClassDescriptor.
+   */
+  public org.exolab.castor.xml.TypeValidator getValidator()
+  {
+    return this;
+  }
+
+  /**
+   * Method getXMLName.
+   * 
+   * @return the XML Name for the Class being described.
+   */
+  public java.lang.String getXMLName()
+  {
+    return _xmlName;
+  }
+
+  /**
+   * Method isElementDefinition.
+   * 
+   * @return true if XML schema definition of this Class is that of a global
+   *         element or element with anonymous type definition.
+   */
+  public boolean isElementDefinition()
+  {
+    return _elementDefinition;
+  }
+
+}
diff --git a/src/jalview/schemabinding/version2/descriptors/FeatureMatcherDescriptor.java b/src/jalview/schemabinding/version2/descriptors/FeatureMatcherDescriptor.java
new file mode 100644
index 0000000..2df2f5b
--- /dev/null
+++ b/src/jalview/schemabinding/version2/descriptors/FeatureMatcherDescriptor.java
@@ -0,0 +1,356 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2.descriptors;
+
+//---------------------------------/
+//- Imported classes and packages -/
+//---------------------------------/
+
+import jalview.schemabinding.version2.FeatureMatcher;
+
+/**
+ * Class FeatureMatcherDescriptor.
+ * 
+ * @version $Revision$ $Date$
+ */
+public class FeatureMatcherDescriptor
+        extends org.exolab.castor.xml.util.XMLClassDescriptorImpl
+{
+
+  // --------------------------/
+  // - Class/Member Variables -/
+  // --------------------------/
+
+  /**
+   * Field _elementDefinition.
+   */
+  private boolean _elementDefinition;
+
+  /**
+   * Field _nsPrefix.
+   */
+  private java.lang.String _nsPrefix;
+
+  /**
+   * Field _nsURI.
+   */
+  private java.lang.String _nsURI;
+
+  /**
+   * Field _xmlName.
+   */
+  private java.lang.String _xmlName;
+
+  // ----------------/
+  // - Constructors -/
+  // ----------------/
+
+  public FeatureMatcherDescriptor()
+  {
+    super();
+    _nsURI = "www.jalview.org/colours";
+    _xmlName = "FeatureMatcher";
+    _elementDefinition = false;
+
+    // -- set grouping compositor
+    setCompositorAsSequence();
+    org.exolab.castor.xml.util.XMLFieldDescriptorImpl desc = null;
+    org.exolab.castor.mapping.FieldHandler handler = null;
+    org.exolab.castor.xml.FieldValidator fieldValidator = null;
+    // -- initialize attribute descriptors
+
+    // -- _by
+    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
+            jalview.schemabinding.version2.types.FeatureMatcherByType.class,
+            "_by", "by", org.exolab.castor.xml.NodeType.Attribute);
+    handler = new org.exolab.castor.xml.XMLFieldHandler()
+    {
+      public java.lang.Object getValue(java.lang.Object object)
+              throws IllegalStateException
+      {
+        FeatureMatcher target = (FeatureMatcher) object;
+        return target.getBy();
+      }
+
+      public void setValue(java.lang.Object object, java.lang.Object value)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          FeatureMatcher target = (FeatureMatcher) object;
+          target.setBy(
+                  (jalview.schemabinding.version2.types.FeatureMatcherByType) value);
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      public java.lang.Object newInstance(java.lang.Object parent)
+      {
+        return null;
+      }
+    };
+    handler = new org.exolab.castor.xml.handlers.EnumFieldHandler(
+            jalview.schemabinding.version2.types.FeatureMatcherByType.class,
+            handler);
+    desc.setImmutable(true);
+    desc.setHandler(handler);
+    desc.setMultivalued(false);
+    addFieldDescriptor(desc);
+
+    // -- validation code for: _by
+    fieldValidator = new org.exolab.castor.xml.FieldValidator();
+    { // -- local scope
+    }
+    desc.setValidator(fieldValidator);
+    // -- initialize element descriptors
+
+    // -- _attributeNameList
+    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
+            java.lang.String.class, "_attributeNameList", "attributeName",
+            org.exolab.castor.xml.NodeType.Element);
+    desc.setImmutable(true);
+    handler = new org.exolab.castor.xml.XMLFieldHandler()
+    {
+      public java.lang.Object getValue(java.lang.Object object)
+              throws IllegalStateException
+      {
+        FeatureMatcher target = (FeatureMatcher) object;
+        return target.getAttributeName();
+      }
+
+      public void setValue(java.lang.Object object, java.lang.Object value)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          FeatureMatcher target = (FeatureMatcher) object;
+          target.addAttributeName((java.lang.String) value);
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      public void resetValue(Object object)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          FeatureMatcher target = (FeatureMatcher) object;
+          target.removeAllAttributeName();
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      public java.lang.Object newInstance(java.lang.Object parent)
+      {
+        return null;
+      }
+    };
+    desc.setHandler(handler);
+    desc.setMultivalued(true);
+    addFieldDescriptor(desc);
+
+    // -- validation code for: _attributeNameList
+    fieldValidator = new org.exolab.castor.xml.FieldValidator();
+    fieldValidator.setMinOccurs(0);
+    fieldValidator.setMaxOccurs(2);
+    { // -- local scope
+      org.exolab.castor.xml.validators.StringValidator typeValidator;
+      typeValidator = new org.exolab.castor.xml.validators.StringValidator();
+      fieldValidator.setValidator(typeValidator);
+      typeValidator.setWhiteSpace("preserve");
+    }
+    desc.setValidator(fieldValidator);
+    // -- _condition
+    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
+            java.lang.String.class, "_condition", "condition",
+            org.exolab.castor.xml.NodeType.Element);
+    desc.setImmutable(true);
+    handler = new org.exolab.castor.xml.XMLFieldHandler()
+    {
+      public java.lang.Object getValue(java.lang.Object object)
+              throws IllegalStateException
+      {
+        FeatureMatcher target = (FeatureMatcher) object;
+        return target.getCondition();
+      }
+
+      public void setValue(java.lang.Object object, java.lang.Object value)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          FeatureMatcher target = (FeatureMatcher) object;
+          target.setCondition((java.lang.String) value);
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      public java.lang.Object newInstance(java.lang.Object parent)
+      {
+        return null;
+      }
+    };
+    desc.setHandler(handler);
+    desc.setRequired(true);
+    desc.setMultivalued(false);
+    addFieldDescriptor(desc);
+
+    // -- validation code for: _condition
+    fieldValidator = new org.exolab.castor.xml.FieldValidator();
+    fieldValidator.setMinOccurs(1);
+    { // -- local scope
+      org.exolab.castor.xml.validators.StringValidator typeValidator;
+      typeValidator = new org.exolab.castor.xml.validators.StringValidator();
+      fieldValidator.setValidator(typeValidator);
+      typeValidator.setWhiteSpace("preserve");
+    }
+    desc.setValidator(fieldValidator);
+    // -- _value
+    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
+            java.lang.String.class, "_value", "value",
+            org.exolab.castor.xml.NodeType.Element);
+    desc.setImmutable(true);
+    handler = new org.exolab.castor.xml.XMLFieldHandler()
+    {
+      public java.lang.Object getValue(java.lang.Object object)
+              throws IllegalStateException
+      {
+        FeatureMatcher target = (FeatureMatcher) object;
+        return target.getValue();
+      }
+
+      public void setValue(java.lang.Object object, java.lang.Object value)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          FeatureMatcher target = (FeatureMatcher) object;
+          target.setValue((java.lang.String) value);
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      public java.lang.Object newInstance(java.lang.Object parent)
+      {
+        return null;
+      }
+    };
+    desc.setHandler(handler);
+    desc.setRequired(true);
+    desc.setMultivalued(false);
+    addFieldDescriptor(desc);
+
+    // -- validation code for: _value
+    fieldValidator = new org.exolab.castor.xml.FieldValidator();
+    fieldValidator.setMinOccurs(1);
+    { // -- local scope
+      org.exolab.castor.xml.validators.StringValidator typeValidator;
+      typeValidator = new org.exolab.castor.xml.validators.StringValidator();
+      fieldValidator.setValidator(typeValidator);
+      typeValidator.setWhiteSpace("preserve");
+    }
+    desc.setValidator(fieldValidator);
+  }
+
+  // -----------/
+  // - Methods -/
+  // -----------/
+
+  /**
+   * Method getAccessMode.
+   * 
+   * @return the access mode specified for this class.
+   */
+  public org.exolab.castor.mapping.AccessMode getAccessMode()
+  {
+    return null;
+  }
+
+  /**
+   * Method getIdentity.
+   * 
+   * @return the identity field, null if this class has no identity.
+   */
+  public org.exolab.castor.mapping.FieldDescriptor getIdentity()
+  {
+    return super.getIdentity();
+  }
+
+  /**
+   * Method getJavaClass.
+   * 
+   * @return the Java class represented by this descriptor.
+   */
+  public java.lang.Class getJavaClass()
+  {
+    return jalview.schemabinding.version2.FeatureMatcher.class;
+  }
+
+  /**
+   * Method getNameSpacePrefix.
+   * 
+   * @return the namespace prefix to use when marshaling as XML.
+   */
+  public java.lang.String getNameSpacePrefix()
+  {
+    return _nsPrefix;
+  }
+
+  /**
+   * Method getNameSpaceURI.
+   * 
+   * @return the namespace URI used when marshaling and unmarshaling as XML.
+   */
+  public java.lang.String getNameSpaceURI()
+  {
+    return _nsURI;
+  }
+
+  /**
+   * Method getValidator.
+   * 
+   * @return a specific validator for the class described by this
+   *         ClassDescriptor.
+   */
+  public org.exolab.castor.xml.TypeValidator getValidator()
+  {
+    return this;
+  }
+
+  /**
+   * Method getXMLName.
+   * 
+   * @return the XML Name for the Class being described.
+   */
+  public java.lang.String getXMLName()
+  {
+    return _xmlName;
+  }
+
+  /**
+   * Method isElementDefinition.
+   * 
+   * @return true if XML schema definition of this Class is that of a global
+   *         element or element with anonymous type definition.
+   */
+  public boolean isElementDefinition()
+  {
+    return _elementDefinition;
+  }
+
+}
diff --git a/src/jalview/schemabinding/version2/descriptors/FeatureMatcherSetDescriptor.java b/src/jalview/schemabinding/version2/descriptors/FeatureMatcherSetDescriptor.java
new file mode 100644
index 0000000..b3d19bb
--- /dev/null
+++ b/src/jalview/schemabinding/version2/descriptors/FeatureMatcherSetDescriptor.java
@@ -0,0 +1,258 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2.descriptors;
+
+import jalview.schemabinding.version2.CompoundMatcher;
+
+//---------------------------------/
+//- Imported classes and packages -/
+//---------------------------------/
+
+import jalview.schemabinding.version2.FeatureMatcherSet;
+import jalview.schemabinding.version2.MatchCondition;
+
+/**
+ * Class FeatureMatcherSetDescriptor.
+ * 
+ * @version $Revision$ $Date$
+ */
+public class FeatureMatcherSetDescriptor
+        extends org.exolab.castor.xml.util.XMLClassDescriptorImpl
+{
+
+  // --------------------------/
+  // - Class/Member Variables -/
+  // --------------------------/
+
+  /**
+   * Field _elementDefinition.
+   */
+  private boolean _elementDefinition;
+
+  /**
+   * Field _nsPrefix.
+   */
+  private java.lang.String _nsPrefix;
+
+  /**
+   * Field _nsURI.
+   */
+  private java.lang.String _nsURI;
+
+  /**
+   * Field _xmlName.
+   */
+  private java.lang.String _xmlName;
+
+  // ----------------/
+  // - Constructors -/
+  // ----------------/
+
+  public FeatureMatcherSetDescriptor()
+  {
+    super();
+    _nsURI = "www.jalview.org/colours";
+    _xmlName = "FeatureMatcherSet";
+    _elementDefinition = false;
+
+    // -- set grouping compositor
+    setCompositorAsChoice();
+    org.exolab.castor.xml.util.XMLFieldDescriptorImpl desc = null;
+    org.exolab.castor.mapping.FieldHandler handler = null;
+    org.exolab.castor.xml.FieldValidator fieldValidator = null;
+    // -- initialize attribute descriptors
+
+    // -- initialize element descriptors
+
+    // -- _matchCondition
+    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
+            MatchCondition.class, "_matchCondition", "matchCondition",
+            org.exolab.castor.xml.NodeType.Element);
+    handler = new org.exolab.castor.xml.XMLFieldHandler()
+    {
+      @Override
+      public java.lang.Object getValue(java.lang.Object object)
+              throws IllegalStateException
+      {
+        FeatureMatcherSet target = (FeatureMatcherSet) object;
+        return target.getMatchCondition();
+      }
+
+      @Override
+      public void setValue(java.lang.Object object, java.lang.Object value)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          FeatureMatcherSet target = (FeatureMatcherSet) object;
+          target.setMatchCondition((MatchCondition) value);
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      @Override
+      public java.lang.Object newInstance(java.lang.Object parent)
+      {
+        return new MatchCondition();
+      }
+    };
+    desc.setHandler(handler);
+    desc.setRequired(true);
+    desc.setMultivalued(false);
+    addFieldDescriptor(desc);
+
+    // -- validation code for: _matchCondition
+    fieldValidator = new org.exolab.castor.xml.FieldValidator();
+    fieldValidator.setMinOccurs(1);
+    { // -- local scope
+    }
+    desc.setValidator(fieldValidator);
+    // -- _compoundMatcher
+    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
+            CompoundMatcher.class, "_compoundMatcher", "compoundMatcher",
+            org.exolab.castor.xml.NodeType.Element);
+    handler = new org.exolab.castor.xml.XMLFieldHandler()
+    {
+      @Override
+      public java.lang.Object getValue(java.lang.Object object)
+              throws IllegalStateException
+      {
+        FeatureMatcherSet target = (FeatureMatcherSet) object;
+        return target.getCompoundMatcher();
+      }
+
+      @Override
+      public void setValue(java.lang.Object object, java.lang.Object value)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          FeatureMatcherSet target = (FeatureMatcherSet) object;
+          target.setCompoundMatcher((CompoundMatcher) value);
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      @Override
+      public java.lang.Object newInstance(java.lang.Object parent)
+      {
+        return new CompoundMatcher();
+      }
+    };
+    desc.setHandler(handler);
+    desc.setRequired(true);
+    desc.setMultivalued(false);
+    addFieldDescriptor(desc);
+
+    // -- validation code for: _compoundMatcher
+    fieldValidator = new org.exolab.castor.xml.FieldValidator();
+    fieldValidator.setMinOccurs(1);
+    { // -- local scope
+    }
+    desc.setValidator(fieldValidator);
+  }
+
+  // -----------/
+  // - Methods -/
+  // -----------/
+
+  /**
+   * Method getAccessMode.
+   * 
+   * @return the access mode specified for this class.
+   */
+  @Override
+  public org.exolab.castor.mapping.AccessMode getAccessMode()
+  {
+    return null;
+  }
+
+  /**
+   * Method getIdentity.
+   * 
+   * @return the identity field, null if this class has no identity.
+   */
+  @Override
+  public org.exolab.castor.mapping.FieldDescriptor getIdentity()
+  {
+    return super.getIdentity();
+  }
+
+  /**
+   * Method getJavaClass.
+   * 
+   * @return the Java class represented by this descriptor.
+   */
+  @Override
+  public java.lang.Class getJavaClass()
+  {
+    return jalview.schemabinding.version2.FeatureMatcherSet.class;
+  }
+
+  /**
+   * Method getNameSpacePrefix.
+   * 
+   * @return the namespace prefix to use when marshaling as XML.
+   */
+  @Override
+  public java.lang.String getNameSpacePrefix()
+  {
+    return _nsPrefix;
+  }
+
+  /**
+   * Method getNameSpaceURI.
+   * 
+   * @return the namespace URI used when marshaling and unmarshaling as XML.
+   */
+  @Override
+  public java.lang.String getNameSpaceURI()
+  {
+    return _nsURI;
+  }
+
+  /**
+   * Method getValidator.
+   * 
+   * @return a specific validator for the class described by this
+   *         ClassDescriptor.
+   */
+  @Override
+  public org.exolab.castor.xml.TypeValidator getValidator()
+  {
+    return this;
+  }
+
+  /**
+   * Method getXMLName.
+   * 
+   * @return the XML Name for the Class being described.
+   */
+  @Override
+  public java.lang.String getXMLName()
+  {
+    return _xmlName;
+  }
+
+  /**
+   * Method isElementDefinition.
+   * 
+   * @return true if XML schema definition of this Class is that of a global
+   *         element or element with anonymous type definition.
+   */
+  @Override
+  public boolean isElementDefinition()
+  {
+    return _elementDefinition;
+  }
+
+}
diff --git a/src/jalview/schemabinding/version2/descriptors/FilterDescriptor.java b/src/jalview/schemabinding/version2/descriptors/FilterDescriptor.java
new file mode 100644
index 0000000..f58f9ae
--- /dev/null
+++ b/src/jalview/schemabinding/version2/descriptors/FilterDescriptor.java
@@ -0,0 +1,246 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2.descriptors;
+
+//---------------------------------/
+//- Imported classes and packages -/
+//---------------------------------/
+
+import jalview.schemabinding.version2.Filter;
+
+/**
+ * Class FilterDescriptor.
+ * 
+ * @version $Revision$ $Date$
+ */
+public class FilterDescriptor
+        extends org.exolab.castor.xml.util.XMLClassDescriptorImpl
+{
+
+  // --------------------------/
+  // - Class/Member Variables -/
+  // --------------------------/
+
+  /**
+   * Field _elementDefinition.
+   */
+  private boolean _elementDefinition;
+
+  /**
+   * Field _nsPrefix.
+   */
+  private java.lang.String _nsPrefix;
+
+  /**
+   * Field _nsURI.
+   */
+  private java.lang.String _nsURI;
+
+  /**
+   * Field _xmlName.
+   */
+  private java.lang.String _xmlName;
+
+  // ----------------/
+  // - Constructors -/
+  // ----------------/
+
+  public FilterDescriptor()
+  {
+    super();
+    _xmlName = "filter";
+    _elementDefinition = true;
+
+    // -- set grouping compositor
+    setCompositorAsSequence();
+    org.exolab.castor.xml.util.XMLFieldDescriptorImpl desc = null;
+    org.exolab.castor.mapping.FieldHandler handler = null;
+    org.exolab.castor.xml.FieldValidator fieldValidator = null;
+    // -- initialize attribute descriptors
+
+    // -- _featureType
+    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
+            java.lang.String.class, "_featureType", "featureType",
+            org.exolab.castor.xml.NodeType.Attribute);
+    desc.setImmutable(true);
+    handler = new org.exolab.castor.xml.XMLFieldHandler()
+    {
+      public java.lang.Object getValue(java.lang.Object object)
+              throws IllegalStateException
+      {
+        Filter target = (Filter) object;
+        return target.getFeatureType();
+      }
+
+      public void setValue(java.lang.Object object, java.lang.Object value)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          Filter target = (Filter) object;
+          target.setFeatureType((java.lang.String) value);
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      public java.lang.Object newInstance(java.lang.Object parent)
+      {
+        return null;
+      }
+    };
+    desc.setHandler(handler);
+    desc.setRequired(true);
+    desc.setMultivalued(false);
+    addFieldDescriptor(desc);
+
+    // -- validation code for: _featureType
+    fieldValidator = new org.exolab.castor.xml.FieldValidator();
+    fieldValidator.setMinOccurs(1);
+    { // -- local scope
+      org.exolab.castor.xml.validators.StringValidator typeValidator;
+      typeValidator = new org.exolab.castor.xml.validators.StringValidator();
+      fieldValidator.setValidator(typeValidator);
+      typeValidator.setWhiteSpace("preserve");
+    }
+    desc.setValidator(fieldValidator);
+    // -- initialize element descriptors
+
+    // -- _matcherSet
+    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
+            jalview.schemabinding.version2.MatcherSet.class, "_matcherSet",
+            "matcherSet", org.exolab.castor.xml.NodeType.Element);
+    handler = new org.exolab.castor.xml.XMLFieldHandler()
+    {
+      public java.lang.Object getValue(java.lang.Object object)
+              throws IllegalStateException
+      {
+        Filter target = (Filter) object;
+        return target.getMatcherSet();
+      }
+
+      public void setValue(java.lang.Object object, java.lang.Object value)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          Filter target = (Filter) object;
+          target.setMatcherSet(
+                  (jalview.schemabinding.version2.MatcherSet) value);
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      public java.lang.Object newInstance(java.lang.Object parent)
+      {
+        return new jalview.schemabinding.version2.MatcherSet();
+      }
+    };
+    desc.setHandler(handler);
+    desc.setRequired(true);
+    desc.setMultivalued(false);
+    addFieldDescriptor(desc);
+
+    // -- validation code for: _matcherSet
+    fieldValidator = new org.exolab.castor.xml.FieldValidator();
+    fieldValidator.setMinOccurs(1);
+    { // -- local scope
+    }
+    desc.setValidator(fieldValidator);
+  }
+
+  // -----------/
+  // - Methods -/
+  // -----------/
+
+  /**
+   * Method getAccessMode.
+   * 
+   * @return the access mode specified for this class.
+   */
+  public org.exolab.castor.mapping.AccessMode getAccessMode()
+  {
+    return null;
+  }
+
+  /**
+   * Method getIdentity.
+   * 
+   * @return the identity field, null if this class has no identity.
+   */
+  public org.exolab.castor.mapping.FieldDescriptor getIdentity()
+  {
+    return super.getIdentity();
+  }
+
+  /**
+   * Method getJavaClass.
+   * 
+   * @return the Java class represented by this descriptor.
+   */
+  public java.lang.Class getJavaClass()
+  {
+    return jalview.schemabinding.version2.Filter.class;
+  }
+
+  /**
+   * Method getNameSpacePrefix.
+   * 
+   * @return the namespace prefix to use when marshaling as XML.
+   */
+  public java.lang.String getNameSpacePrefix()
+  {
+    return _nsPrefix;
+  }
+
+  /**
+   * Method getNameSpaceURI.
+   * 
+   * @return the namespace URI used when marshaling and unmarshaling as XML.
+   */
+  public java.lang.String getNameSpaceURI()
+  {
+    return _nsURI;
+  }
+
+  /**
+   * Method getValidator.
+   * 
+   * @return a specific validator for the class described by this
+   *         ClassDescriptor.
+   */
+  public org.exolab.castor.xml.TypeValidator getValidator()
+  {
+    return this;
+  }
+
+  /**
+   * Method getXMLName.
+   * 
+   * @return the XML Name for the Class being described.
+   */
+  public java.lang.String getXMLName()
+  {
+    return _xmlName;
+  }
+
+  /**
+   * Method isElementDefinition.
+   * 
+   * @return true if XML schema definition of this Class is that of a global
+   *         element or element with anonymous type definition.
+   */
+  public boolean isElementDefinition()
+  {
+    return _elementDefinition;
+  }
+
+}
diff --git a/src/jalview/schemabinding/version2/descriptors/JalviewUserColoursDescriptor.java b/src/jalview/schemabinding/version2/descriptors/JalviewUserColoursDescriptor.java
index d65de13..459d645 100644
--- a/src/jalview/schemabinding/version2/descriptors/JalviewUserColoursDescriptor.java
+++ b/src/jalview/schemabinding/version2/descriptors/JalviewUserColoursDescriptor.java
@@ -7,11 +7,13 @@
 
 package jalview.schemabinding.version2.descriptors;
 
+import jalview.schemabinding.version2.Colour;
+import jalview.schemabinding.version2.Filter;
+
 //---------------------------------/
 //- Imported classes and packages -/
 //---------------------------------/
 
-import jalview.schemabinding.version2.Colour;
 import jalview.schemabinding.version2.JalviewUserColours;
 
 /**
@@ -19,8 +21,8 @@ import jalview.schemabinding.version2.JalviewUserColours;
  * 
  * @version $Revision$ $Date$
  */
-public class JalviewUserColoursDescriptor extends
-        org.exolab.castor.xml.util.XMLClassDescriptorImpl
+public class JalviewUserColoursDescriptor
+        extends org.exolab.castor.xml.util.XMLClassDescriptorImpl
 {
 
   // --------------------------/
@@ -192,8 +194,8 @@ public class JalviewUserColoursDescriptor extends
       }
 
       @Override
-      public void resetValue(Object object) throws IllegalStateException,
-              IllegalArgumentException
+      public void resetValue(Object object)
+              throws IllegalStateException, IllegalArgumentException
       {
         try
         {
@@ -221,6 +223,64 @@ public class JalviewUserColoursDescriptor extends
     { // -- local scope
     }
     desc.setValidator(fieldValidator);
+    // -- _filterList
+    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
+            Filter.class, "_filterList", "filter",
+            org.exolab.castor.xml.NodeType.Element);
+    handler = new org.exolab.castor.xml.XMLFieldHandler()
+    {
+      @Override
+      public java.lang.Object getValue(java.lang.Object object)
+              throws IllegalStateException
+      {
+        JalviewUserColours target = (JalviewUserColours) object;
+        return target.getFilter();
+      }
+
+      @Override
+      public void setValue(java.lang.Object object, java.lang.Object value)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          JalviewUserColours target = (JalviewUserColours) object;
+          target.addFilter((Filter) value);
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      @Override
+      public void resetValue(Object object)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          JalviewUserColours target = (JalviewUserColours) object;
+          target.removeAllFilter();
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      @Override
+      public java.lang.Object newInstance(java.lang.Object parent)
+      {
+        return new Filter();
+      }
+    };
+    desc.setHandler(handler);
+    desc.setMultivalued(true);
+    addFieldDescriptor(desc);
+
+    // -- validation code for: _filterList
+    fieldValidator = new org.exolab.castor.xml.FieldValidator();
+    fieldValidator.setMinOccurs(0);
+    { // -- local scope
+    }
+    desc.setValidator(fieldValidator);
   }
 
   // -----------/
diff --git a/src/jalview/schemabinding/version2/descriptors/MatchConditionDescriptor.java b/src/jalview/schemabinding/version2/descriptors/MatchConditionDescriptor.java
new file mode 100644
index 0000000..8373421
--- /dev/null
+++ b/src/jalview/schemabinding/version2/descriptors/MatchConditionDescriptor.java
@@ -0,0 +1,148 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2.descriptors;
+
+//---------------------------------/
+//- Imported classes and packages -/
+//---------------------------------/
+
+import jalview.schemabinding.version2.MatchCondition;
+
+/**
+ * Class MatchConditionDescriptor.
+ * 
+ * @version $Revision$ $Date$
+ */
+public class MatchConditionDescriptor extends
+        jalview.schemabinding.version2.descriptors.FeatureMatcherDescriptor
+{
+
+  // --------------------------/
+  // - Class/Member Variables -/
+  // --------------------------/
+
+  /**
+   * Field _elementDefinition.
+   */
+  private boolean _elementDefinition;
+
+  /**
+   * Field _nsPrefix.
+   */
+  private java.lang.String _nsPrefix;
+
+  /**
+   * Field _nsURI.
+   */
+  private java.lang.String _nsURI;
+
+  /**
+   * Field _xmlName.
+   */
+  private java.lang.String _xmlName;
+
+  // ----------------/
+  // - Constructors -/
+  // ----------------/
+
+  public MatchConditionDescriptor()
+  {
+    super();
+    setExtendsWithoutFlatten(
+            new jalview.schemabinding.version2.descriptors.FeatureMatcherDescriptor());
+    _xmlName = "matchCondition";
+    _elementDefinition = true;
+  }
+
+  // -----------/
+  // - Methods -/
+  // -----------/
+
+  /**
+   * Method getAccessMode.
+   * 
+   * @return the access mode specified for this class.
+   */
+  public org.exolab.castor.mapping.AccessMode getAccessMode()
+  {
+    return null;
+  }
+
+  /**
+   * Method getIdentity.
+   * 
+   * @return the identity field, null if this class has no identity.
+   */
+  public org.exolab.castor.mapping.FieldDescriptor getIdentity()
+  {
+    return super.getIdentity();
+  }
+
+  /**
+   * Method getJavaClass.
+   * 
+   * @return the Java class represented by this descriptor.
+   */
+  public java.lang.Class getJavaClass()
+  {
+    return jalview.schemabinding.version2.MatchCondition.class;
+  }
+
+  /**
+   * Method getNameSpacePrefix.
+   * 
+   * @return the namespace prefix to use when marshaling as XML.
+   */
+  public java.lang.String getNameSpacePrefix()
+  {
+    return _nsPrefix;
+  }
+
+  /**
+   * Method getNameSpaceURI.
+   * 
+   * @return the namespace URI used when marshaling and unmarshaling as XML.
+   */
+  public java.lang.String getNameSpaceURI()
+  {
+    return _nsURI;
+  }
+
+  /**
+   * Method getValidator.
+   * 
+   * @return a specific validator for the class described by this
+   *         ClassDescriptor.
+   */
+  public org.exolab.castor.xml.TypeValidator getValidator()
+  {
+    return this;
+  }
+
+  /**
+   * Method getXMLName.
+   * 
+   * @return the XML Name for the Class being described.
+   */
+  public java.lang.String getXMLName()
+  {
+    return _xmlName;
+  }
+
+  /**
+   * Method isElementDefinition.
+   * 
+   * @return true if XML schema definition of this Class is that of a global
+   *         element or element with anonymous type definition.
+   */
+  public boolean isElementDefinition()
+  {
+    return _elementDefinition;
+  }
+
+}
diff --git a/src/jalview/schemabinding/version2/descriptors/MatcherSetDescriptor.java b/src/jalview/schemabinding/version2/descriptors/MatcherSetDescriptor.java
new file mode 100644
index 0000000..2807f92
--- /dev/null
+++ b/src/jalview/schemabinding/version2/descriptors/MatcherSetDescriptor.java
@@ -0,0 +1,148 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2.descriptors;
+
+//---------------------------------/
+//- Imported classes and packages -/
+//---------------------------------/
+
+import jalview.schemabinding.version2.MatcherSet;
+
+/**
+ * Class MatcherSetDescriptor.
+ * 
+ * @version $Revision$ $Date$
+ */
+public class MatcherSetDescriptor extends
+        jalview.schemabinding.version2.descriptors.FeatureMatcherSetDescriptor
+{
+
+  // --------------------------/
+  // - Class/Member Variables -/
+  // --------------------------/
+
+  /**
+   * Field _elementDefinition.
+   */
+  private boolean _elementDefinition;
+
+  /**
+   * Field _nsPrefix.
+   */
+  private java.lang.String _nsPrefix;
+
+  /**
+   * Field _nsURI.
+   */
+  private java.lang.String _nsURI;
+
+  /**
+   * Field _xmlName.
+   */
+  private java.lang.String _xmlName;
+
+  // ----------------/
+  // - Constructors -/
+  // ----------------/
+
+  public MatcherSetDescriptor()
+  {
+    super();
+    setExtendsWithoutFlatten(
+            new jalview.schemabinding.version2.descriptors.FeatureMatcherSetDescriptor());
+    _xmlName = "matcherSet";
+    _elementDefinition = true;
+  }
+
+  // -----------/
+  // - Methods -/
+  // -----------/
+
+  /**
+   * Method getAccessMode.
+   * 
+   * @return the access mode specified for this class.
+   */
+  public org.exolab.castor.mapping.AccessMode getAccessMode()
+  {
+    return null;
+  }
+
+  /**
+   * Method getIdentity.
+   * 
+   * @return the identity field, null if this class has no identity.
+   */
+  public org.exolab.castor.mapping.FieldDescriptor getIdentity()
+  {
+    return super.getIdentity();
+  }
+
+  /**
+   * Method getJavaClass.
+   * 
+   * @return the Java class represented by this descriptor.
+   */
+  public java.lang.Class getJavaClass()
+  {
+    return jalview.schemabinding.version2.MatcherSet.class;
+  }
+
+  /**
+   * Method getNameSpacePrefix.
+   * 
+   * @return the namespace prefix to use when marshaling as XML.
+   */
+  public java.lang.String getNameSpacePrefix()
+  {
+    return _nsPrefix;
+  }
+
+  /**
+   * Method getNameSpaceURI.
+   * 
+   * @return the namespace URI used when marshaling and unmarshaling as XML.
+   */
+  public java.lang.String getNameSpaceURI()
+  {
+    return _nsURI;
+  }
+
+  /**
+   * Method getValidator.
+   * 
+   * @return a specific validator for the class described by this
+   *         ClassDescriptor.
+   */
+  public org.exolab.castor.xml.TypeValidator getValidator()
+  {
+    return this;
+  }
+
+  /**
+   * Method getXMLName.
+   * 
+   * @return the XML Name for the Class being described.
+   */
+  public java.lang.String getXMLName()
+  {
+    return _xmlName;
+  }
+
+  /**
+   * Method isElementDefinition.
+   * 
+   * @return true if XML schema definition of this Class is that of a global
+   *         element or element with anonymous type definition.
+   */
+  public boolean isElementDefinition()
+  {
+    return _elementDefinition;
+  }
+
+}
diff --git a/src/jalview/schemabinding/version2/descriptors/OtherDataDescriptor.java b/src/jalview/schemabinding/version2/descriptors/OtherDataDescriptor.java
index f582311..ab7a626 100644
--- a/src/jalview/schemabinding/version2/descriptors/OtherDataDescriptor.java
+++ b/src/jalview/schemabinding/version2/descriptors/OtherDataDescriptor.java
@@ -7,8 +7,8 @@
 
 package jalview.schemabinding.version2.descriptors;
 
-//---------------------------------/
-//- Imported classes and packages -/
+  //---------------------------------/
+ //- Imported classes and packages -/
 //---------------------------------/
 
 import jalview.schemabinding.version2.OtherData;
@@ -18,231 +18,255 @@ import jalview.schemabinding.version2.OtherData;
  * 
  * @version $Revision$ $Date$
  */
-public class OtherDataDescriptor extends
-        org.exolab.castor.xml.util.XMLClassDescriptorImpl
-{
-
-  // --------------------------/
-  // - Class/Member Variables -/
-  // --------------------------/
-
-  /**
-   * Field _elementDefinition.
-   */
-  private boolean _elementDefinition;
-
-  /**
-   * Field _nsPrefix.
-   */
-  private java.lang.String _nsPrefix;
-
-  /**
-   * Field _nsURI.
-   */
-  private java.lang.String _nsURI;
-
-  /**
-   * Field _xmlName.
-   */
-  private java.lang.String _xmlName;
-
-  // ----------------/
-  // - Constructors -/
-  // ----------------/
-
-  public OtherDataDescriptor()
-  {
-    super();
-    _nsURI = "www.jalview.org";
-    _xmlName = "otherData";
-    _elementDefinition = true;
-    org.exolab.castor.xml.util.XMLFieldDescriptorImpl desc = null;
-    org.exolab.castor.mapping.FieldHandler handler = null;
-    org.exolab.castor.xml.FieldValidator fieldValidator = null;
-    // -- initialize attribute descriptors
-
-    // -- _key
-    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
-            java.lang.String.class, "_key", "key",
-            org.exolab.castor.xml.NodeType.Attribute);
-    desc.setImmutable(true);
-    handler = new org.exolab.castor.xml.XMLFieldHandler()
-    {
-      public java.lang.Object getValue(java.lang.Object object)
-              throws IllegalStateException
-      {
-        OtherData target = (OtherData) object;
-        return target.getKey();
-      }
-
-      public void setValue(java.lang.Object object, java.lang.Object value)
-              throws IllegalStateException, IllegalArgumentException
-      {
-        try
-        {
-          OtherData target = (OtherData) object;
-          target.setKey((java.lang.String) value);
-        } catch (java.lang.Exception ex)
-        {
-          throw new IllegalStateException(ex.toString());
+public class OtherDataDescriptor extends org.exolab.castor.xml.util.XMLClassDescriptorImpl {
+
+
+      //--------------------------/
+     //- Class/Member Variables -/
+    //--------------------------/
+
+    /**
+     * Field _elementDefinition.
+     */
+    private boolean _elementDefinition;
+
+    /**
+     * Field _nsPrefix.
+     */
+    private java.lang.String _nsPrefix;
+
+    /**
+     * Field _nsURI.
+     */
+    private java.lang.String _nsURI;
+
+    /**
+     * Field _xmlName.
+     */
+    private java.lang.String _xmlName;
+
+
+      //----------------/
+     //- Constructors -/
+    //----------------/
+
+    public OtherDataDescriptor() {
+        super();
+        _nsURI = "www.jalview.org";
+        _xmlName = "otherData";
+        _elementDefinition = true;
+        org.exolab.castor.xml.util.XMLFieldDescriptorImpl  desc           = null;
+        org.exolab.castor.mapping.FieldHandler             handler        = null;
+        org.exolab.castor.xml.FieldValidator               fieldValidator = null;
+        //-- initialize attribute descriptors
+        
+        //-- _key
+        desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(java.lang.String.class, "_key", "key", org.exolab.castor.xml.NodeType.Attribute);
+        desc.setImmutable(true);
+        handler = new org.exolab.castor.xml.XMLFieldHandler() {
+            public java.lang.Object getValue( java.lang.Object object ) 
+                throws IllegalStateException
+            {
+                OtherData target = (OtherData) object;
+                return target.getKey();
+            }
+            public void setValue( java.lang.Object object, java.lang.Object value) 
+                throws IllegalStateException, IllegalArgumentException
+            {
+                try {
+                    OtherData target = (OtherData) object;
+                    target.setKey( (java.lang.String) value);
+                } catch (java.lang.Exception ex) {
+                    throw new IllegalStateException(ex.toString());
+                }
+            }
+            public java.lang.Object newInstance(java.lang.Object parent) {
+                return null;
+            }
+        };
+        desc.setHandler(handler);
+        desc.setRequired(true);
+        desc.setMultivalued(false);
+        addFieldDescriptor(desc);
+        
+        //-- validation code for: _key
+        fieldValidator = new org.exolab.castor.xml.FieldValidator();
+        fieldValidator.setMinOccurs(1);
+        { //-- local scope
+            org.exolab.castor.xml.validators.StringValidator typeValidator;
+            typeValidator = new org.exolab.castor.xml.validators.StringValidator();
+            fieldValidator.setValidator(typeValidator);
+            typeValidator.setWhiteSpace("preserve");
+        }
+        desc.setValidator(fieldValidator);
+        //-- _key2
+        desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(java.lang.String.class, "_key2", "key2", org.exolab.castor.xml.NodeType.Attribute);
+        desc.setImmutable(true);
+        handler = new org.exolab.castor.xml.XMLFieldHandler() {
+            public java.lang.Object getValue( java.lang.Object object ) 
+                throws IllegalStateException
+            {
+                OtherData target = (OtherData) object;
+                return target.getKey2();
+            }
+            public void setValue( java.lang.Object object, java.lang.Object value) 
+                throws IllegalStateException, IllegalArgumentException
+            {
+                try {
+                    OtherData target = (OtherData) object;
+                    target.setKey2( (java.lang.String) value);
+                } catch (java.lang.Exception ex) {
+                    throw new IllegalStateException(ex.toString());
+                }
+            }
+            public java.lang.Object newInstance(java.lang.Object parent) {
+                return null;
+            }
+        };
+        desc.setHandler(handler);
+        desc.setMultivalued(false);
+        addFieldDescriptor(desc);
+        
+        //-- validation code for: _key2
+        fieldValidator = new org.exolab.castor.xml.FieldValidator();
+        { //-- local scope
+            org.exolab.castor.xml.validators.StringValidator typeValidator;
+            typeValidator = new org.exolab.castor.xml.validators.StringValidator();
+            fieldValidator.setValidator(typeValidator);
+            typeValidator.setWhiteSpace("preserve");
+        }
+        desc.setValidator(fieldValidator);
+        //-- _value
+        desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(java.lang.String.class, "_value", "value", org.exolab.castor.xml.NodeType.Attribute);
+        desc.setImmutable(true);
+        handler = new org.exolab.castor.xml.XMLFieldHandler() {
+            public java.lang.Object getValue( java.lang.Object object ) 
+                throws IllegalStateException
+            {
+                OtherData target = (OtherData) object;
+                return target.getValue();
+            }
+            public void setValue( java.lang.Object object, java.lang.Object value) 
+                throws IllegalStateException, IllegalArgumentException
+            {
+                try {
+                    OtherData target = (OtherData) object;
+                    target.setValue( (java.lang.String) value);
+                } catch (java.lang.Exception ex) {
+                    throw new IllegalStateException(ex.toString());
+                }
+            }
+            public java.lang.Object newInstance(java.lang.Object parent) {
+                return null;
+            }
+        };
+        desc.setHandler(handler);
+        desc.setRequired(true);
+        desc.setMultivalued(false);
+        addFieldDescriptor(desc);
+        
+        //-- validation code for: _value
+        fieldValidator = new org.exolab.castor.xml.FieldValidator();
+        fieldValidator.setMinOccurs(1);
+        { //-- local scope
+            org.exolab.castor.xml.validators.StringValidator typeValidator;
+            typeValidator = new org.exolab.castor.xml.validators.StringValidator();
+            fieldValidator.setValidator(typeValidator);
+            typeValidator.setWhiteSpace("preserve");
         }
-      }
+        desc.setValidator(fieldValidator);
+        //-- initialize element descriptors
+        
+    }
+
+
+      //-----------/
+     //- Methods -/
+    //-----------/
 
-      public java.lang.Object newInstance(java.lang.Object parent)
-      {
+    /**
+     * Method getAccessMode.
+     * 
+     * @return the access mode specified for this class.
+     */
+    public org.exolab.castor.mapping.AccessMode getAccessMode(
+    ) {
         return null;
-      }
-    };
-    desc.setHandler(handler);
-    desc.setRequired(true);
-    desc.setMultivalued(false);
-    addFieldDescriptor(desc);
-
-    // -- validation code for: _key
-    fieldValidator = new org.exolab.castor.xml.FieldValidator();
-    fieldValidator.setMinOccurs(1);
-    { // -- local scope
-      org.exolab.castor.xml.validators.StringValidator typeValidator;
-      typeValidator = new org.exolab.castor.xml.validators.StringValidator();
-      fieldValidator.setValidator(typeValidator);
-      typeValidator.setWhiteSpace("preserve");
     }
-    desc.setValidator(fieldValidator);
-    // -- _value
-    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
-            java.lang.String.class, "_value", "value",
-            org.exolab.castor.xml.NodeType.Attribute);
-    desc.setImmutable(true);
-    handler = new org.exolab.castor.xml.XMLFieldHandler()
-    {
-      public java.lang.Object getValue(java.lang.Object object)
-              throws IllegalStateException
-      {
-        OtherData target = (OtherData) object;
-        return target.getValue();
-      }
-
-      public void setValue(java.lang.Object object, java.lang.Object value)
-              throws IllegalStateException, IllegalArgumentException
-      {
-        try
-        {
-          OtherData target = (OtherData) object;
-          target.setValue((java.lang.String) value);
-        } catch (java.lang.Exception ex)
-        {
-          throw new IllegalStateException(ex.toString());
-        }
-      }
 
-      public java.lang.Object newInstance(java.lang.Object parent)
-      {
-        return null;
-      }
-    };
-    desc.setHandler(handler);
-    desc.setRequired(true);
-    desc.setMultivalued(false);
-    addFieldDescriptor(desc);
-
-    // -- validation code for: _value
-    fieldValidator = new org.exolab.castor.xml.FieldValidator();
-    fieldValidator.setMinOccurs(1);
-    { // -- local scope
-      org.exolab.castor.xml.validators.StringValidator typeValidator;
-      typeValidator = new org.exolab.castor.xml.validators.StringValidator();
-      fieldValidator.setValidator(typeValidator);
-      typeValidator.setWhiteSpace("preserve");
+    /**
+     * Method getIdentity.
+     * 
+     * @return the identity field, null if this class has no
+     * identity.
+     */
+    public org.exolab.castor.mapping.FieldDescriptor getIdentity(
+    ) {
+        return super.getIdentity();
+    }
+
+    /**
+     * Method getJavaClass.
+     * 
+     * @return the Java class represented by this descriptor.
+     */
+    public java.lang.Class getJavaClass(
+    ) {
+        return jalview.schemabinding.version2.OtherData.class;
+    }
+
+    /**
+     * Method getNameSpacePrefix.
+     * 
+     * @return the namespace prefix to use when marshaling as XML.
+     */
+    public java.lang.String getNameSpacePrefix(
+    ) {
+        return _nsPrefix;
+    }
+
+    /**
+     * Method getNameSpaceURI.
+     * 
+     * @return the namespace URI used when marshaling and
+     * unmarshaling as XML.
+     */
+    public java.lang.String getNameSpaceURI(
+    ) {
+        return _nsURI;
+    }
+
+    /**
+     * Method getValidator.
+     * 
+     * @return a specific validator for the class described by this
+     * ClassDescriptor.
+     */
+    public org.exolab.castor.xml.TypeValidator getValidator(
+    ) {
+        return this;
+    }
+
+    /**
+     * Method getXMLName.
+     * 
+     * @return the XML Name for the Class being described.
+     */
+    public java.lang.String getXMLName(
+    ) {
+        return _xmlName;
+    }
+
+    /**
+     * Method isElementDefinition.
+     * 
+     * @return true if XML schema definition of this Class is that
+     * of a global
+     * element or element with anonymous type definition.
+     */
+    public boolean isElementDefinition(
+    ) {
+        return _elementDefinition;
     }
-    desc.setValidator(fieldValidator);
-    // -- initialize element descriptors
-
-  }
-
-  // -----------/
-  // - Methods -/
-  // -----------/
-
-  /**
-   * Method getAccessMode.
-   * 
-   * @return the access mode specified for this class.
-   */
-  public org.exolab.castor.mapping.AccessMode getAccessMode()
-  {
-    return null;
-  }
-
-  /**
-   * Method getIdentity.
-   * 
-   * @return the identity field, null if this class has no identity.
-   */
-  public org.exolab.castor.mapping.FieldDescriptor getIdentity()
-  {
-    return super.getIdentity();
-  }
-
-  /**
-   * Method getJavaClass.
-   * 
-   * @return the Java class represented by this descriptor.
-   */
-  public java.lang.Class getJavaClass()
-  {
-    return jalview.schemabinding.version2.OtherData.class;
-  }
-
-  /**
-   * Method getNameSpacePrefix.
-   * 
-   * @return the namespace prefix to use when marshaling as XML.
-   */
-  public java.lang.String getNameSpacePrefix()
-  {
-    return _nsPrefix;
-  }
-
-  /**
-   * Method getNameSpaceURI.
-   * 
-   * @return the namespace URI used when marshaling and unmarshaling as XML.
-   */
-  public java.lang.String getNameSpaceURI()
-  {
-    return _nsURI;
-  }
-
-  /**
-   * Method getValidator.
-   * 
-   * @return a specific validator for the class described by this
-   *         ClassDescriptor.
-   */
-  public org.exolab.castor.xml.TypeValidator getValidator()
-  {
-    return this;
-  }
-
-  /**
-   * Method getXMLName.
-   * 
-   * @return the XML Name for the Class being described.
-   */
-  public java.lang.String getXMLName()
-  {
-    return _xmlName;
-  }
-
-  /**
-   * Method isElementDefinition.
-   * 
-   * @return true if XML schema definition of this Class is that of a global
-   *         element or element with anonymous type definition.
-   */
-  public boolean isElementDefinition()
-  {
-    return _elementDefinition;
-  }
 
 }
diff --git a/src/jalview/schemabinding/version2/descriptors/SettingDescriptor.java b/src/jalview/schemabinding/version2/descriptors/SettingDescriptor.java
index 4703f46..c816e43 100644
--- a/src/jalview/schemabinding/version2/descriptors/SettingDescriptor.java
+++ b/src/jalview/schemabinding/version2/descriptors/SettingDescriptor.java
@@ -18,8 +18,8 @@ import jalview.schemabinding.version2.Setting;
  * 
  * @version $Revision$ $Date$
  */
-public class SettingDescriptor extends
-        org.exolab.castor.xml.util.XMLClassDescriptorImpl
+public class SettingDescriptor
+        extends org.exolab.castor.xml.util.XMLClassDescriptorImpl
 {
 
   // --------------------------/
@@ -56,6 +56,9 @@ public class SettingDescriptor extends
     _nsURI = "www.jalview.org";
     _xmlName = "setting";
     _elementDefinition = true;
+
+    // -- set grouping compositor
+    setCompositorAsSequence();
     org.exolab.castor.xml.util.XMLFieldDescriptorImpl desc = null;
     org.exolab.castor.mapping.FieldHandler handler = null;
     org.exolab.castor.xml.FieldValidator fieldValidator = null;
@@ -331,6 +334,52 @@ public class SettingDescriptor extends
       typeValidator.setMaxInclusive(2147483647);
     }
     desc.setValidator(fieldValidator);
+    // -- _noValueColour
+    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
+            jalview.schemabinding.version2.types.NoValueColour.class,
+            "_noValueColour", "noValueColour",
+            org.exolab.castor.xml.NodeType.Attribute);
+    handler = new org.exolab.castor.xml.XMLFieldHandler()
+    {
+      public java.lang.Object getValue(java.lang.Object object)
+              throws IllegalStateException
+      {
+        Setting target = (Setting) object;
+        return target.getNoValueColour();
+      }
+
+      public void setValue(java.lang.Object object, java.lang.Object value)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          Setting target = (Setting) object;
+          target.setNoValueColour(
+                  (jalview.schemabinding.version2.types.NoValueColour) value);
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      public java.lang.Object newInstance(java.lang.Object parent)
+      {
+        return null;
+      }
+    };
+    handler = new org.exolab.castor.xml.handlers.EnumFieldHandler(
+            jalview.schemabinding.version2.types.NoValueColour.class,
+            handler);
+    desc.setImmutable(true);
+    desc.setHandler(handler);
+    desc.setMultivalued(false);
+    addFieldDescriptor(desc);
+
+    // -- validation code for: _noValueColour
+    fieldValidator = new org.exolab.castor.xml.FieldValidator();
+    { // -- local scope
+    }
+    desc.setValidator(fieldValidator);
     // -- _threshold
     desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
             java.lang.Float.TYPE, "_threshold", "threshold",
@@ -581,8 +630,8 @@ public class SettingDescriptor extends
             target.deleteColourByLabel();
             return;
           }
-          target.setColourByLabel(((java.lang.Boolean) value)
-                  .booleanValue());
+          target.setColourByLabel(
+                  ((java.lang.Boolean) value).booleanValue());
         } catch (java.lang.Exception ex)
         {
           throw new IllegalStateException(ex.toString());
@@ -662,6 +711,109 @@ public class SettingDescriptor extends
     desc.setValidator(fieldValidator);
     // -- initialize element descriptors
 
+    // -- _attributeNameList
+    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
+            java.lang.String.class, "_attributeNameList", "attributeName",
+            org.exolab.castor.xml.NodeType.Element);
+    desc.setImmutable(true);
+    handler = new org.exolab.castor.xml.XMLFieldHandler()
+    {
+      public java.lang.Object getValue(java.lang.Object object)
+              throws IllegalStateException
+      {
+        Setting target = (Setting) object;
+        return target.getAttributeName();
+      }
+
+      public void setValue(java.lang.Object object, java.lang.Object value)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          Setting target = (Setting) object;
+          target.addAttributeName((java.lang.String) value);
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      public void resetValue(Object object)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          Setting target = (Setting) object;
+          target.removeAllAttributeName();
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      public java.lang.Object newInstance(java.lang.Object parent)
+      {
+        return null;
+      }
+    };
+    desc.setHandler(handler);
+    desc.setNameSpaceURI("www.jalview.org");
+    desc.setMultivalued(true);
+    addFieldDescriptor(desc);
+
+    // -- validation code for: _attributeNameList
+    fieldValidator = new org.exolab.castor.xml.FieldValidator();
+    fieldValidator.setMinOccurs(0);
+    fieldValidator.setMaxOccurs(2);
+    { // -- local scope
+      org.exolab.castor.xml.validators.StringValidator typeValidator;
+      typeValidator = new org.exolab.castor.xml.validators.StringValidator();
+      fieldValidator.setValidator(typeValidator);
+      typeValidator.setWhiteSpace("preserve");
+    }
+    desc.setValidator(fieldValidator);
+    // -- _matcherSet
+    desc = new org.exolab.castor.xml.util.XMLFieldDescriptorImpl(
+            jalview.schemabinding.version2.MatcherSet.class, "_matcherSet",
+            "matcherSet", org.exolab.castor.xml.NodeType.Element);
+    handler = new org.exolab.castor.xml.XMLFieldHandler()
+    {
+      public java.lang.Object getValue(java.lang.Object object)
+              throws IllegalStateException
+      {
+        Setting target = (Setting) object;
+        return target.getMatcherSet();
+      }
+
+      public void setValue(java.lang.Object object, java.lang.Object value)
+              throws IllegalStateException, IllegalArgumentException
+      {
+        try
+        {
+          Setting target = (Setting) object;
+          target.setMatcherSet(
+                  (jalview.schemabinding.version2.MatcherSet) value);
+        } catch (java.lang.Exception ex)
+        {
+          throw new IllegalStateException(ex.toString());
+        }
+      }
+
+      public java.lang.Object newInstance(java.lang.Object parent)
+      {
+        return new jalview.schemabinding.version2.MatcherSet();
+      }
+    };
+    desc.setHandler(handler);
+    desc.setNameSpaceURI("www.jalview.org");
+    desc.setMultivalued(false);
+    addFieldDescriptor(desc);
+
+    // -- validation code for: _matcherSet
+    fieldValidator = new org.exolab.castor.xml.FieldValidator();
+    { // -- local scope
+    }
+    desc.setValidator(fieldValidator);
   }
 
   // -----------/
diff --git a/src/jalview/schemabinding/version2/types/.castor.cdr b/src/jalview/schemabinding/version2/types/.castor.cdr
new file mode 100644
index 0000000..d9874b6
--- /dev/null
+++ b/src/jalview/schemabinding/version2/types/.castor.cdr
@@ -0,0 +1,5 @@
+#Thu Dec 14 15:28:22 GMT 2017
+jalview.schemabinding.version2.types.ColourNoValueColourType=jalview.schemabinding.version2.types.descriptors.ColourNoValueColourTypeDescriptor
+jalview.schemabinding.version2.types.FeatureMatcherByType=jalview.schemabinding.version2.types.descriptors.FeatureMatcherByTypeDescriptor
+jalview.schemabinding.version2.types.NoValueColour=jalview.schemabinding.version2.types.descriptors.NoValueColourDescriptor
+jalview.schemabinding.version2.types.ColourThreshTypeType=jalview.schemabinding.version2.types.descriptors.ColourThreshTypeTypeDescriptor
diff --git a/src/jalview/schemabinding/version2/types/ColourThreshTypeType.java b/src/jalview/schemabinding/version2/types/ColourThreshTypeType.java
new file mode 100644
index 0000000..0330411
--- /dev/null
+++ b/src/jalview/schemabinding/version2/types/ColourThreshTypeType.java
@@ -0,0 +1,168 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2.types;
+
+  //---------------------------------/
+ //- Imported classes and packages -/
+//---------------------------------/
+
+import java.util.Hashtable;
+
+/**
+ * Class ColourThreshTypeType.
+ * 
+ * @version $Revision$ $Date$
+ */
+public class ColourThreshTypeType implements java.io.Serializable {
+
+
+      //--------------------------/
+     //- Class/Member Variables -/
+    //--------------------------/
+
+    /**
+     * The NONE type
+     */
+    public static final int NONE_TYPE = 0;
+
+    /**
+     * The instance of the NONE type
+     */
+    public static final ColourThreshTypeType NONE = new ColourThreshTypeType(NONE_TYPE, "NONE");
+
+    /**
+     * The ABOVE type
+     */
+    public static final int ABOVE_TYPE = 1;
+
+    /**
+     * The instance of the ABOVE type
+     */
+    public static final ColourThreshTypeType ABOVE = new ColourThreshTypeType(ABOVE_TYPE, "ABOVE");
+
+    /**
+     * The BELOW type
+     */
+    public static final int BELOW_TYPE = 2;
+
+    /**
+     * The instance of the BELOW type
+     */
+    public static final ColourThreshTypeType BELOW = new ColourThreshTypeType(BELOW_TYPE, "BELOW");
+
+    /**
+     * Field _memberTable.
+     */
+    private static java.util.Hashtable _memberTable = init();
+
+    /**
+     * Field type.
+     */
+    private int type = -1;
+
+    /**
+     * Field stringValue.
+     */
+    private java.lang.String stringValue = null;
+
+
+      //----------------/
+     //- Constructors -/
+    //----------------/
+
+    private ColourThreshTypeType(final int type, final java.lang.String value) {
+        super();
+        this.type = type;
+        this.stringValue = value;
+    }
+
+
+      //-----------/
+     //- Methods -/
+    //-----------/
+
+    /**
+     * Method enumerate.Returns an enumeration of all possible
+     * instances of ColourThreshTypeType
+     * 
+     * @return an Enumeration over all possible instances of
+     * ColourThreshTypeType
+     */
+    public static java.util.Enumeration enumerate(
+    ) {
+        return _memberTable.elements();
+    }
+
+    /**
+     * Method getType.Returns the type of this ColourThreshTypeType
+     * 
+     * @return the type of this ColourThreshTypeType
+     */
+    public int getType(
+    ) {
+        return this.type;
+    }
+
+    /**
+     * Method init.
+     * 
+     * @return the initialized Hashtable for the member table
+     */
+    private static java.util.Hashtable init(
+    ) {
+        Hashtable members = new Hashtable();
+        members.put("NONE", NONE);
+        members.put("ABOVE", ABOVE);
+        members.put("BELOW", BELOW);
+        return members;
+    }
+
+    /**
+     * Method readResolve. will be called during deserialization to
+     * replace the deserialized object with the correct constant
+     * instance.
+     * 
+     * @return this deserialized object
+     */
+    private java.lang.Object readResolve(
+    ) {
+        return valueOf(this.stringValue);
+    }
+
+    /**
+     * Method toString.Returns the String representation of this
+     * ColourThreshTypeType
+     * 
+     * @return the String representation of this ColourThreshTypeTyp
+     */
+    public java.lang.String toString(
+    ) {
+        return this.stringValue;
+    }
+
+    /**
+     * Method valueOf.Returns a new ColourThreshTypeType based on
+     * the given String value.
+     * 
+     * @param string
+     * @return the ColourThreshTypeType value of parameter 'string'
+     */
+    public static jalview.schemabinding.version2.types.ColourThreshTypeType valueOf(
+            final java.lang.String string) {
+        java.lang.Object obj = null;
+        if (string != null) {
+            obj = _memberTable.get(string);
+        }
+        if (obj == null) {
+            String err = "" + string + " is not a valid ColourThreshTypeType";
+            throw new IllegalArgumentException(err);
+        }
+        return (ColourThreshTypeType) obj;
+    }
+
+}
diff --git a/src/jalview/schemabinding/version2/types/FeatureMatcherByType.java b/src/jalview/schemabinding/version2/types/FeatureMatcherByType.java
new file mode 100644
index 0000000..6e97332
--- /dev/null
+++ b/src/jalview/schemabinding/version2/types/FeatureMatcherByType.java
@@ -0,0 +1,168 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2.types;
+
+  //---------------------------------/
+ //- Imported classes and packages -/
+//---------------------------------/
+
+import java.util.Hashtable;
+
+/**
+ * Class FeatureMatcherByType.
+ * 
+ * @version $Revision$ $Date$
+ */
+public class FeatureMatcherByType implements java.io.Serializable {
+
+
+      //--------------------------/
+     //- Class/Member Variables -/
+    //--------------------------/
+
+    /**
+     * The byLabel type
+     */
+    public static final int BYLABEL_TYPE = 0;
+
+    /**
+     * The instance of the byLabel type
+     */
+    public static final FeatureMatcherByType BYLABEL = new FeatureMatcherByType(BYLABEL_TYPE, "byLabel");
+
+    /**
+     * The byScore type
+     */
+    public static final int BYSCORE_TYPE = 1;
+
+    /**
+     * The instance of the byScore type
+     */
+    public static final FeatureMatcherByType BYSCORE = new FeatureMatcherByType(BYSCORE_TYPE, "byScore");
+
+    /**
+     * The byAttribute type
+     */
+    public static final int BYATTRIBUTE_TYPE = 2;
+
+    /**
+     * The instance of the byAttribute type
+     */
+    public static final FeatureMatcherByType BYATTRIBUTE = new FeatureMatcherByType(BYATTRIBUTE_TYPE, "byAttribute");
+
+    /**
+     * Field _memberTable.
+     */
+    private static java.util.Hashtable _memberTable = init();
+
+    /**
+     * Field type.
+     */
+    private int type = -1;
+
+    /**
+     * Field stringValue.
+     */
+    private java.lang.String stringValue = null;
+
+
+      //----------------/
+     //- Constructors -/
+    //----------------/
+
+    private FeatureMatcherByType(final int type, final java.lang.String value) {
+        super();
+        this.type = type;
+        this.stringValue = value;
+    }
+
+
+      //-----------/
+     //- Methods -/
+    //-----------/
+
+    /**
+     * Method enumerate.Returns an enumeration of all possible
+     * instances of FeatureMatcherByType
+     * 
+     * @return an Enumeration over all possible instances of
+     * FeatureMatcherByType
+     */
+    public static java.util.Enumeration enumerate(
+    ) {
+        return _memberTable.elements();
+    }
+
+    /**
+     * Method getType.Returns the type of this FeatureMatcherByType
+     * 
+     * @return the type of this FeatureMatcherByType
+     */
+    public int getType(
+    ) {
+        return this.type;
+    }
+
+    /**
+     * Method init.
+     * 
+     * @return the initialized Hashtable for the member table
+     */
+    private static java.util.Hashtable init(
+    ) {
+        Hashtable members = new Hashtable();
+        members.put("byLabel", BYLABEL);
+        members.put("byScore", BYSCORE);
+        members.put("byAttribute", BYATTRIBUTE);
+        return members;
+    }
+
+    /**
+     * Method readResolve. will be called during deserialization to
+     * replace the deserialized object with the correct constant
+     * instance.
+     * 
+     * @return this deserialized object
+     */
+    private java.lang.Object readResolve(
+    ) {
+        return valueOf(this.stringValue);
+    }
+
+    /**
+     * Method toString.Returns the String representation of this
+     * FeatureMatcherByType
+     * 
+     * @return the String representation of this FeatureMatcherByTyp
+     */
+    public java.lang.String toString(
+    ) {
+        return this.stringValue;
+    }
+
+    /**
+     * Method valueOf.Returns a new FeatureMatcherByType based on
+     * the given String value.
+     * 
+     * @param string
+     * @return the FeatureMatcherByType value of parameter 'string'
+     */
+    public static jalview.schemabinding.version2.types.FeatureMatcherByType valueOf(
+            final java.lang.String string) {
+        java.lang.Object obj = null;
+        if (string != null) {
+            obj = _memberTable.get(string);
+        }
+        if (obj == null) {
+            String err = "" + string + " is not a valid FeatureMatcherByType";
+            throw new IllegalArgumentException(err);
+        }
+        return (FeatureMatcherByType) obj;
+    }
+
+}
diff --git a/src/jalview/schemabinding/version2/types/NoValueColour.java b/src/jalview/schemabinding/version2/types/NoValueColour.java
new file mode 100644
index 0000000..bbef3d7
--- /dev/null
+++ b/src/jalview/schemabinding/version2/types/NoValueColour.java
@@ -0,0 +1,169 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2.types;
+
+//---------------------------------/
+//- Imported classes and packages -/
+//---------------------------------/
+
+import java.util.Hashtable;
+
+/**
+ * Graduated feature colour if no score (or attribute) value
+ * 
+ * @version $Revision$ $Date$
+ */
+public class NoValueColour implements java.io.Serializable
+{
+
+  // --------------------------/
+  // - Class/Member Variables -/
+  // --------------------------/
+
+  /**
+   * The None type
+   */
+  public static final int NONE_TYPE = 0;
+
+  /**
+   * The instance of the None type
+   */
+  public static final NoValueColour NONE = new NoValueColour(NONE_TYPE,
+          "None");
+
+  /**
+   * The Min type
+   */
+  public static final int MIN_TYPE = 1;
+
+  /**
+   * The instance of the Min type
+   */
+  public static final NoValueColour MIN = new NoValueColour(MIN_TYPE,
+          "Min");
+
+  /**
+   * The Max type
+   */
+  public static final int MAX_TYPE = 2;
+
+  /**
+   * The instance of the Max type
+   */
+  public static final NoValueColour MAX = new NoValueColour(MAX_TYPE,
+          "Max");
+
+  /**
+   * Field _memberTable.
+   */
+  private static java.util.Hashtable _memberTable = init();
+
+  /**
+   * Field type.
+   */
+  private int type = -1;
+
+  /**
+   * Field stringValue.
+   */
+  private java.lang.String stringValue = null;
+
+  // ----------------/
+  // - Constructors -/
+  // ----------------/
+
+  private NoValueColour(final int type, final java.lang.String value)
+  {
+    super();
+    this.type = type;
+    this.stringValue = value;
+  }
+
+  // -----------/
+  // - Methods -/
+  // -----------/
+
+  /**
+   * Method enumerate.Returns an enumeration of all possible instances of
+   * NoValueColour
+   * 
+   * @return an Enumeration over all possible instances of NoValueColour
+   */
+  public static java.util.Enumeration enumerate()
+  {
+    return _memberTable.elements();
+  }
+
+  /**
+   * Method getType.Returns the type of this NoValueColour
+   * 
+   * @return the type of this NoValueColour
+   */
+  public int getType()
+  {
+    return this.type;
+  }
+
+  /**
+   * Method init.
+   * 
+   * @return the initialized Hashtable for the member table
+   */
+  private static java.util.Hashtable init()
+  {
+    Hashtable members = new Hashtable();
+    members.put("None", NONE);
+    members.put("Min", MIN);
+    members.put("Max", MAX);
+    return members;
+  }
+
+  /**
+   * Method readResolve. will be called during deserialization to replace the
+   * deserialized object with the correct constant instance.
+   * 
+   * @return this deserialized object
+   */
+  private java.lang.Object readResolve()
+  {
+    return valueOf(this.stringValue);
+  }
+
+  /**
+   * Method toString.Returns the String representation of this NoValueColour
+   * 
+   * @return the String representation of this NoValueColour
+   */
+  public java.lang.String toString()
+  {
+    return this.stringValue;
+  }
+
+  /**
+   * Method valueOf.Returns a new NoValueColour based on the given String value.
+   * 
+   * @param string
+   * @return the NoValueColour value of parameter 'string'
+   */
+  public static jalview.schemabinding.version2.types.NoValueColour valueOf(
+          final java.lang.String string)
+  {
+    java.lang.Object obj = null;
+    if (string != null)
+    {
+      obj = _memberTable.get(string);
+    }
+    if (obj == null)
+    {
+      String err = "" + string + " is not a valid NoValueColour";
+      throw new IllegalArgumentException(err);
+    }
+    return (NoValueColour) obj;
+  }
+
+}
diff --git a/src/jalview/schemabinding/version2/types/descriptors/ColourThreshTypeTypeDescriptor.java b/src/jalview/schemabinding/version2/types/descriptors/ColourThreshTypeTypeDescriptor.java
new file mode 100644
index 0000000..f978363
--- /dev/null
+++ b/src/jalview/schemabinding/version2/types/descriptors/ColourThreshTypeTypeDescriptor.java
@@ -0,0 +1,150 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2.types.descriptors;
+
+  //---------------------------------/
+ //- Imported classes and packages -/
+//---------------------------------/
+
+import jalview.schemabinding.version2.types.ColourThreshTypeType;
+
+/**
+ * Class ColourThreshTypeTypeDescriptor.
+ * 
+ * @version $Revision$ $Date$
+ */
+public class ColourThreshTypeTypeDescriptor extends org.exolab.castor.xml.util.XMLClassDescriptorImpl {
+
+
+      //--------------------------/
+     //- Class/Member Variables -/
+    //--------------------------/
+
+    /**
+     * Field _elementDefinition.
+     */
+    private boolean _elementDefinition;
+
+    /**
+     * Field _nsPrefix.
+     */
+    private java.lang.String _nsPrefix;
+
+    /**
+     * Field _nsURI.
+     */
+    private java.lang.String _nsURI;
+
+    /**
+     * Field _xmlName.
+     */
+    private java.lang.String _xmlName;
+
+
+      //----------------/
+     //- Constructors -/
+    //----------------/
+
+    public ColourThreshTypeTypeDescriptor() {
+        super();
+        _nsURI = "www.jalview.org/colours";
+        _xmlName = "ColourThreshTypeType";
+        _elementDefinition = false;
+    }
+
+
+      //-----------/
+     //- Methods -/
+    //-----------/
+
+    /**
+     * Method getAccessMode.
+     * 
+     * @return the access mode specified for this class.
+     */
+    public org.exolab.castor.mapping.AccessMode getAccessMode(
+    ) {
+        return null;
+    }
+
+    /**
+     * Method getIdentity.
+     * 
+     * @return the identity field, null if this class has no
+     * identity.
+     */
+    public org.exolab.castor.mapping.FieldDescriptor getIdentity(
+    ) {
+        return super.getIdentity();
+    }
+
+    /**
+     * Method getJavaClass.
+     * 
+     * @return the Java class represented by this descriptor.
+     */
+    public java.lang.Class getJavaClass(
+    ) {
+        return jalview.schemabinding.version2.types.ColourThreshTypeType.class;
+    }
+
+    /**
+     * Method getNameSpacePrefix.
+     * 
+     * @return the namespace prefix to use when marshaling as XML.
+     */
+    public java.lang.String getNameSpacePrefix(
+    ) {
+        return _nsPrefix;
+    }
+
+    /**
+     * Method getNameSpaceURI.
+     * 
+     * @return the namespace URI used when marshaling and
+     * unmarshaling as XML.
+     */
+    public java.lang.String getNameSpaceURI(
+    ) {
+        return _nsURI;
+    }
+
+    /**
+     * Method getValidator.
+     * 
+     * @return a specific validator for the class described by this
+     * ClassDescriptor.
+     */
+    public org.exolab.castor.xml.TypeValidator getValidator(
+    ) {
+        return this;
+    }
+
+    /**
+     * Method getXMLName.
+     * 
+     * @return the XML Name for the Class being described.
+     */
+    public java.lang.String getXMLName(
+    ) {
+        return _xmlName;
+    }
+
+    /**
+     * Method isElementDefinition.
+     * 
+     * @return true if XML schema definition of this Class is that
+     * of a global
+     * element or element with anonymous type definition.
+     */
+    public boolean isElementDefinition(
+    ) {
+        return _elementDefinition;
+    }
+
+}
diff --git a/src/jalview/schemabinding/version2/types/descriptors/FeatureMatcherByTypeDescriptor.java b/src/jalview/schemabinding/version2/types/descriptors/FeatureMatcherByTypeDescriptor.java
new file mode 100644
index 0000000..e392e76
--- /dev/null
+++ b/src/jalview/schemabinding/version2/types/descriptors/FeatureMatcherByTypeDescriptor.java
@@ -0,0 +1,150 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2.types.descriptors;
+
+  //---------------------------------/
+ //- Imported classes and packages -/
+//---------------------------------/
+
+import jalview.schemabinding.version2.types.FeatureMatcherByType;
+
+/**
+ * Class FeatureMatcherByTypeDescriptor.
+ * 
+ * @version $Revision$ $Date$
+ */
+public class FeatureMatcherByTypeDescriptor extends org.exolab.castor.xml.util.XMLClassDescriptorImpl {
+
+
+      //--------------------------/
+     //- Class/Member Variables -/
+    //--------------------------/
+
+    /**
+     * Field _elementDefinition.
+     */
+    private boolean _elementDefinition;
+
+    /**
+     * Field _nsPrefix.
+     */
+    private java.lang.String _nsPrefix;
+
+    /**
+     * Field _nsURI.
+     */
+    private java.lang.String _nsURI;
+
+    /**
+     * Field _xmlName.
+     */
+    private java.lang.String _xmlName;
+
+
+      //----------------/
+     //- Constructors -/
+    //----------------/
+
+    public FeatureMatcherByTypeDescriptor() {
+        super();
+        _nsURI = "www.jalview.org/colours";
+        _xmlName = "FeatureMatcherByType";
+        _elementDefinition = false;
+    }
+
+
+      //-----------/
+     //- Methods -/
+    //-----------/
+
+    /**
+     * Method getAccessMode.
+     * 
+     * @return the access mode specified for this class.
+     */
+    public org.exolab.castor.mapping.AccessMode getAccessMode(
+    ) {
+        return null;
+    }
+
+    /**
+     * Method getIdentity.
+     * 
+     * @return the identity field, null if this class has no
+     * identity.
+     */
+    public org.exolab.castor.mapping.FieldDescriptor getIdentity(
+    ) {
+        return super.getIdentity();
+    }
+
+    /**
+     * Method getJavaClass.
+     * 
+     * @return the Java class represented by this descriptor.
+     */
+    public java.lang.Class getJavaClass(
+    ) {
+        return jalview.schemabinding.version2.types.FeatureMatcherByType.class;
+    }
+
+    /**
+     * Method getNameSpacePrefix.
+     * 
+     * @return the namespace prefix to use when marshaling as XML.
+     */
+    public java.lang.String getNameSpacePrefix(
+    ) {
+        return _nsPrefix;
+    }
+
+    /**
+     * Method getNameSpaceURI.
+     * 
+     * @return the namespace URI used when marshaling and
+     * unmarshaling as XML.
+     */
+    public java.lang.String getNameSpaceURI(
+    ) {
+        return _nsURI;
+    }
+
+    /**
+     * Method getValidator.
+     * 
+     * @return a specific validator for the class described by this
+     * ClassDescriptor.
+     */
+    public org.exolab.castor.xml.TypeValidator getValidator(
+    ) {
+        return this;
+    }
+
+    /**
+     * Method getXMLName.
+     * 
+     * @return the XML Name for the Class being described.
+     */
+    public java.lang.String getXMLName(
+    ) {
+        return _xmlName;
+    }
+
+    /**
+     * Method isElementDefinition.
+     * 
+     * @return true if XML schema definition of this Class is that
+     * of a global
+     * element or element with anonymous type definition.
+     */
+    public boolean isElementDefinition(
+    ) {
+        return _elementDefinition;
+    }
+
+}
diff --git a/src/jalview/schemabinding/version2/types/descriptors/NoValueColourDescriptor.java b/src/jalview/schemabinding/version2/types/descriptors/NoValueColourDescriptor.java
new file mode 100644
index 0000000..14c58ed
--- /dev/null
+++ b/src/jalview/schemabinding/version2/types/descriptors/NoValueColourDescriptor.java
@@ -0,0 +1,147 @@
+/*
+ * This class was automatically generated with 
+ * Castor 1.1, using an XML
+ * Schema.
+ * $Id$
+ */
+
+package jalview.schemabinding.version2.types.descriptors;
+
+//---------------------------------/
+//- Imported classes and packages -/
+//---------------------------------/
+
+import jalview.schemabinding.version2.types.NoValueColour;
+
+/**
+ * Class NoValueColourDescriptor.
+ * 
+ * @version $Revision$ $Date$
+ */
+public class NoValueColourDescriptor
+        extends org.exolab.castor.xml.util.XMLClassDescriptorImpl
+{
+
+  // --------------------------/
+  // - Class/Member Variables -/
+  // --------------------------/
+
+  /**
+   * Field _elementDefinition.
+   */
+  private boolean _elementDefinition;
+
+  /**
+   * Field _nsPrefix.
+   */
+  private java.lang.String _nsPrefix;
+
+  /**
+   * Field _nsURI.
+   */
+  private java.lang.String _nsURI;
+
+  /**
+   * Field _xmlName.
+   */
+  private java.lang.String _xmlName;
+
+  // ----------------/
+  // - Constructors -/
+  // ----------------/
+
+  public NoValueColourDescriptor()
+  {
+    super();
+    _nsURI = "www.jalview.org/colours";
+    _xmlName = "NoValueColour";
+    _elementDefinition = false;
+  }
+
+  // -----------/
+  // - Methods -/
+  // -----------/
+
+  /**
+   * Method getAccessMode.
+   * 
+   * @return the access mode specified for this class.
+   */
+  public org.exolab.castor.mapping.AccessMode getAccessMode()
+  {
+    return null;
+  }
+
+  /**
+   * Method getIdentity.
+   * 
+   * @return the identity field, null if this class has no identity.
+   */
+  public org.exolab.castor.mapping.FieldDescriptor getIdentity()
+  {
+    return super.getIdentity();
+  }
+
+  /**
+   * Method getJavaClass.
+   * 
+   * @return the Java class represented by this descriptor.
+   */
+  public java.lang.Class getJavaClass()
+  {
+    return jalview.schemabinding.version2.types.NoValueColour.class;
+  }
+
+  /**
+   * Method getNameSpacePrefix.
+   * 
+   * @return the namespace prefix to use when marshaling as XML.
+   */
+  public java.lang.String getNameSpacePrefix()
+  {
+    return _nsPrefix;
+  }
+
+  /**
+   * Method getNameSpaceURI.
+   * 
+   * @return the namespace URI used when marshaling and unmarshaling as XML.
+   */
+  public java.lang.String getNameSpaceURI()
+  {
+    return _nsURI;
+  }
+
+  /**
+   * Method getValidator.
+   * 
+   * @return a specific validator for the class described by this
+   *         ClassDescriptor.
+   */
+  public org.exolab.castor.xml.TypeValidator getValidator()
+  {
+    return this;
+  }
+
+  /**
+   * Method getXMLName.
+   * 
+   * @return the XML Name for the Class being described.
+   */
+  public java.lang.String getXMLName()
+  {
+    return _xmlName;
+  }
+
+  /**
+   * Method isElementDefinition.
+   * 
+   * @return true if XML schema definition of this Class is that of a global
+   *         element or element with anonymous type definition.
+   */
+  public boolean isElementDefinition()
+  {
+    return _elementDefinition;
+  }
+
+}
diff --git a/src/jalview/schemes/FeatureColour.java b/src/jalview/schemes/FeatureColour.java
index 54d1c6c..7d14662 100644
--- a/src/jalview/schemes/FeatureColour.java
+++ b/src/jalview/schemes/FeatureColour.java
@@ -22,6 +22,7 @@ package jalview.schemes;
 
 import jalview.api.FeatureColourI;
 import jalview.datamodel.SequenceFeature;
+import jalview.datamodel.features.FeatureMatcher;
 import jalview.util.ColorUtils;
 import jalview.util.Format;
 
@@ -29,10 +30,49 @@ import java.awt.Color;
 import java.util.StringTokenizer;
 
 /**
- * A class that wraps either a simple colour or a graduated colour
+ * A class that represents a colour scheme for a feature type. Options supported
+ * are currently
+ * 

+ * a simple colour e.g. Red
+ * colour by label - a colour is generated from the feature description
+ * graduated colour by feature score
+ * 
+ * minimum and maximum score range must be provided
+ * minimum and maximum value colours should be specified
+ * a colour for 'no value' may optionally be provided
+ * colours for intermediate scores are interpolated RGB values
+ * there is an optional threshold above/below which to colour values
+ * the range may be the full value range, or may be limited by the threshold
+ * value
+ * 
+ * colour by (text) value of a named attribute
 graduated colour by
+ * (numeric) value of a named attribute
 
  */
 public class FeatureColour implements FeatureColourI
 {
+  private static final String ABSOLUTE = "abso";
+
+  private static final String ABOVE = "above";
+
+  private static final String BELOW = "below";
+
+  /*
+   * constants used to read or write a Jalview Features file
+   */
+  private static final String LABEL = "label";
+
+  private static final String SCORE = "score";
+
+  private static final String ATTRIBUTE = "attribute";
+
+  private static final String NO_VALUE_MIN = "noValueMin";
+
+  private static final String NO_VALUE_MAX = "noValueMax";
+
+  private static final String NO_VALUE_NONE = "noValueNone";
+
+  static final Color DEFAULT_NO_COLOUR = null;
+
   private static final String BAR = "|";
 
   final private Color colour;
@@ -41,10 +81,30 @@ public class FeatureColour implements FeatureColourI
 
   final private Color maxColour;
 
+  /*
+   * colour to use for colour by attribute when the 
+   * attribute value is absent
+   */
+  final private Color noColour;
+
+  /*
+   * if true, then colour has a gradient based on a numerical 
+   * range (either feature score, or an attribute value)
+   */
   private boolean graduatedColour;
 
+  /*
+   * if true, colour values are generated from a text string,
+   * either feature description, or an attribute value
+   */
   private boolean colourByLabel;
 
+  /*
+   * if not null, the value of [attribute, [sub-attribute] ...]
+   *  is used for colourByLabel or graduatedColour
+   */
+  private String[] attributeName;
+
   private float threshold;
 
   private float base;
@@ -55,8 +115,6 @@ public class FeatureColour implements FeatureColourI
 
   private boolean aboveThreshold;
 
-  private boolean thresholdIsMinOrMax;
-
   private boolean isHighToLow;
 
   private boolean autoScaled;
@@ -75,16 +133,29 @@ public class FeatureColour implements FeatureColourI
 
   /**
    * Parses a Jalview features file format colour descriptor
-   * [label|][mincolour|maxcolour
-   * |[absolute|]minvalue|maxvalue|thresholdtype|thresholdvalue] Examples:
+   * 
+   * 
+   * [label|score|[attribute|attributeName]|][mincolour|maxcolour|
+   * [absolute|]minvalue|maxvalue|[noValueOption|]thresholdtype|thresholdvalue]
+   * 

+   * 'Score' is optional (default) for a graduated colour. An attribute with
+   * sub-attribute should be written as (for example) CSQ:Consequence.
+   * noValueOption is one of noValueMin, noValueMax, noValueNone
+   * with default noValueMin.
+   * 

+   * Examples:
    * 

    * red
    * a28bbb
    * 25,125,213
    * label
+   * attribute|CSQ:PolyPhen
    * label|||0.0|0.0|above|12.5
    * label|||0.0|0.0|below|12.5
    * red|green|12.0|26.0|none
+   * score|red|green|12.0|26.0|none
+   * attribute|AF|red|green|12.0|26.0|none
+   * attribute|AF|red|green|noValueNone|12.0|26.0|none
    * a28bbb|3eb555|12.0|26.0|above|12.5
    * a28bbb|3eb555|abso|12.0|26.0|below|12.5
    * 
@@ -94,34 +165,71 @@ public class FeatureColour implements FeatureColourI
    * @throws IllegalArgumentException
    *           if not parseable
    */
-  public static FeatureColour parseJalviewFeatureColour(String descriptor)
+  public static FeatureColourI parseJalviewFeatureColour(String descriptor)
   {
-    StringTokenizer gcol = new StringTokenizer(descriptor, "|", true);
+    StringTokenizer gcol = new StringTokenizer(descriptor, BAR, true);
     float min = Float.MIN_VALUE;
     float max = Float.MAX_VALUE;
-    boolean labelColour = false;
+    boolean byLabel = false;
+    boolean byAttribute = false;
+    String attName = null;
+    String mincol = null;
+    String maxcol = null;
 
-    String mincol = gcol.nextToken();
-    if (mincol == "|")
+    /*
+     * first token should be 'label', or 'score', or an
+     * attribute name, or simple colour, or minimum colour
+     */
+    String nextToken = gcol.nextToken();
+    if (nextToken == BAR)
     {
       throw new IllegalArgumentException(
               "Expected either 'label' or a colour specification in the line: "
                       + descriptor);
     }
-    String maxcol = null;
-    if (mincol.toLowerCase().indexOf("label") == 0)
+    if (nextToken.toLowerCase().startsWith(LABEL))
+    {
+      byLabel = true;
+      // get the token after the next delimiter:
+      mincol = (gcol.hasMoreTokens() ? gcol.nextToken() : null);
+      mincol = (gcol.hasMoreTokens() ? gcol.nextToken() : null);
+    }
+    else if (nextToken.toLowerCase().startsWith(SCORE))
+    {
+      mincol = (gcol.hasMoreTokens() ? gcol.nextToken() : null);
+      mincol = (gcol.hasMoreTokens() ? gcol.nextToken() : null);
+    }
+    else if (nextToken.toLowerCase().startsWith(ATTRIBUTE))
     {
-      labelColour = true;
+      byAttribute = true;
+      attName = (gcol.hasMoreTokens() ? gcol.nextToken() : null);
+      attName = (gcol.hasMoreTokens() ? gcol.nextToken() : null);
       mincol = (gcol.hasMoreTokens() ? gcol.nextToken() : null);
-      // skip '|'
       mincol = (gcol.hasMoreTokens() ? gcol.nextToken() : null);
     }
+    else
+    {
+      mincol = nextToken;
+    }
 
-    if (!labelColour && !gcol.hasMoreTokens())
+    /*
+     * if only one token, it can validly be label, attributeName,
+     * or a plain colour value
+     */
+    if (!gcol.hasMoreTokens())
     {
-      /*
-       * only a simple colour specification - parse it
-       */
+      if (byLabel || byAttribute)
+      {
+        FeatureColourI fc = new FeatureColour();
+        fc.setColourByLabel(true);
+        if (byAttribute)
+        {
+          fc.setAttributeName(
+                  FeatureMatcher.fromAttributeDisplayName(attName));
+        }
+        return fc;
+      }
+
       Color colour = ColorUtils.parseColourString(descriptor);
       if (colour == null)
       {
@@ -132,34 +240,64 @@ public class FeatureColour implements FeatureColourI
     }
 
     /*
+     * continue parsing for min/max/no colour (if graduated)
+     * and for threshold (colour by text or graduated)
+     */
+
+    /*
      * autoScaled == true: colours range over actual score range
      * autoScaled == false ('abso'): colours range over min/max range
      */
     boolean autoScaled = true;
     String tok = null, minval, maxval;
+    String noValueColour = NO_VALUE_MIN;
+
     if (mincol != null)
     {
       // at least four more tokens
-      if (mincol.equals("|"))
+      if (mincol.equals(BAR))
       {
-        mincol = "";
+        mincol = null;
       }
       else
       {
         gcol.nextToken(); // skip next '|'
       }
       maxcol = gcol.nextToken();
-      if (maxcol.equals("|"))
+      if (maxcol.equals(BAR))
       {
-        maxcol = "";
+        maxcol = null;
       }
       else
       {
         gcol.nextToken(); // skip next '|'
       }
       tok = gcol.nextToken();
+
+      /*
+       * check for specifier for colour for no attribute value
+       * (new in 2.11, defaults to minColour if not specified)
+       */
+      if (tok.equalsIgnoreCase(NO_VALUE_MIN))
+      {
+        tok = gcol.nextToken();
+        tok = gcol.nextToken();
+      }
+      else if (tok.equalsIgnoreCase(NO_VALUE_MAX))
+      {
+        noValueColour = NO_VALUE_MAX;
+        tok = gcol.nextToken();
+        tok = gcol.nextToken();
+      }
+      else if (tok.equalsIgnoreCase(NO_VALUE_NONE))
+      {
+        noValueColour = NO_VALUE_NONE;
+        tok = gcol.nextToken();
+        tok = gcol.nextToken();
+      }
+
       gcol.nextToken(); // skip next '|'
-      if (tok.toLowerCase().startsWith("abso"))
+      if (tok.toLowerCase().startsWith(ABSOLUTE))
       {
         minval = gcol.nextToken();
         gcol.nextToken(); // skip next '|'
@@ -201,34 +339,45 @@ public class FeatureColour implements FeatureColourI
     }
     else
     {
-      // add in some dummy min/max colours for the label-only
-      // colourscheme.
-      mincol = "FFFFFF";
-      maxcol = "000000";
+      /*
+       * dummy min/max colours for colour by text
+       * (label or attribute value)
+       */
+      mincol = "white";
+      maxcol = "black";
+      byLabel = true;
     }
 
     /*
-     * construct the FeatureColour
+     * construct the FeatureColour!
      */
     FeatureColour featureColour;
     try
     {
       Color minColour = ColorUtils.parseColourString(mincol);
       Color maxColour = ColorUtils.parseColourString(maxcol);
-      featureColour = new FeatureColour(minColour, maxColour, min, max);
-      featureColour.setColourByLabel(labelColour);
+      Color noColour = noValueColour.equals(NO_VALUE_MAX) ? maxColour
+              : (noValueColour.equals(NO_VALUE_NONE) ? null : minColour);
+      featureColour = new FeatureColour(minColour, maxColour, noColour, min,
+              max);
+      featureColour.setColourByLabel(minColour == null);
       featureColour.setAutoScaled(autoScaled);
+      if (byAttribute)
+      {
+        featureColour.setAttributeName(
+                FeatureMatcher.fromAttributeDisplayName(attName));
+      }
       // add in any additional parameters
       String ttype = null, tval = null;
       if (gcol.hasMoreTokens())
       {
         // threshold type and possibly a threshold value
         ttype = gcol.nextToken();
-        if (ttype.toLowerCase().startsWith("below"))
+        if (ttype.toLowerCase().startsWith(BELOW))
         {
           featureColour.setBelowThreshold(true);
         }
-        else if (ttype.toLowerCase().startsWith("above"))
+        else if (ttype.toLowerCase().startsWith(ABOVE))
         {
           featureColour.setAboveThreshold(true);
         }
@@ -260,7 +409,7 @@ public class FeatureColour implements FeatureColourI
                 "Ignoring additional tokens in parameters in graduated colour specification\n");
         while (gcol.hasMoreTokens())
         {
-          System.err.println("|" + gcol.nextToken());
+          System.err.println(BAR + gcol.nextToken());
         }
         System.err.println("\n");
       }
@@ -288,6 +437,7 @@ public class FeatureColour implements FeatureColourI
   {
     minColour = Color.WHITE;
     maxColour = Color.BLACK;
+    noColour = DEFAULT_NO_COLOUR;
     minRed = 0f;
     minGreen = 0f;
     minBlue = 0f;
@@ -298,7 +448,8 @@ public class FeatureColour implements FeatureColourI
   }
 
   /**
-   * Constructor given a colour range and a score range
+   * Constructor given a colour range and a score range, defaulting 'no value
+   * colour' to be the same as minimum colour
    * 
    * @param low
    * @param high
@@ -307,36 +458,7 @@ public class FeatureColour implements FeatureColourI
    */
   public FeatureColour(Color low, Color high, float min, float max)
   {
-    if (low == null)
-    {
-      low = Color.white;
-    }
-    if (high == null)
-    {
-      high = Color.black;
-    }
-    graduatedColour = true;
-    colour = null;
-    minColour = low;
-    maxColour = high;
-    threshold = Float.NaN;
-    isHighToLow = min >= max;
-    minRed = low.getRed() / 255f;
-    minGreen = low.getGreen() / 255f;
-    minBlue = low.getBlue() / 255f;
-    deltaRed = (high.getRed() / 255f) - minRed;
-    deltaGreen = (high.getGreen() / 255f) - minGreen;
-    deltaBlue = (high.getBlue() / 255f) - minBlue;
-    if (isHighToLow)
-    {
-      base = max;
-      range = min - max;
-    }
-    else
-    {
-      base = min;
-      range = max - min;
-    }
+    this(low, high, low, min, max);
   }
 
   /**
@@ -350,6 +472,7 @@ public class FeatureColour implements FeatureColourI
     colour = fc.colour;
     minColour = fc.minColour;
     maxColour = fc.maxColour;
+    noColour = fc.noColour;
     minRed = fc.minRed;
     minGreen = fc.minGreen;
     minBlue = fc.minBlue;
@@ -359,6 +482,7 @@ public class FeatureColour implements FeatureColourI
     base = fc.base;
     range = fc.range;
     isHighToLow = fc.isHighToLow;
+    attributeName = fc.attributeName;
     setAboveThreshold(fc.isAboveThreshold());
     setBelowThreshold(fc.isBelowThreshold());
     setThreshold(fc.getThreshold());
@@ -376,10 +500,54 @@ public class FeatureColour implements FeatureColourI
   public FeatureColour(FeatureColour fc, float min, float max)
   {
     this(fc);
-    graduatedColour = true;
     updateBounds(min, max);
   }
 
+  /**
+   * Constructor for a graduated colour
+   * 
+   * @param low
+   * @param high
+   * @param noValueColour
+   * @param min
+   * @param max
+   */
+  public FeatureColour(Color low, Color high, Color noValueColour,
+          float min, float max)
+  {
+    if (low == null)
+    {
+      low = Color.white;
+    }
+    if (high == null)
+    {
+      high = Color.black;
+    }
+    graduatedColour = true;
+    colour = null;
+    minColour = low;
+    maxColour = high;
+    noColour = noValueColour;
+    threshold = Float.NaN;
+    isHighToLow = min >= max;
+    minRed = low.getRed() / 255f;
+    minGreen = low.getGreen() / 255f;
+    minBlue = low.getBlue() / 255f;
+    deltaRed = (high.getRed() / 255f) - minRed;
+    deltaGreen = (high.getGreen() / 255f) - minGreen;
+    deltaBlue = (high.getBlue() / 255f) - minBlue;
+    if (isHighToLow)
+    {
+      base = max;
+      range = min - max;
+    }
+    else
+    {
+      base = min;
+      range = max - min;
+    }
+  }
+
   @Override
   public boolean isGraduatedColour()
   {
@@ -418,6 +586,12 @@ public class FeatureColour implements FeatureColourI
   }
 
   @Override
+  public Color getNoColour()
+  {
+    return noColour;
+  }
+
+  @Override
   public boolean isColourByLabel()
   {
     return colourByLabel;
@@ -470,18 +644,6 @@ public class FeatureColour implements FeatureColourI
   }
 
   @Override
-  public boolean isThresholdMinMax()
-  {
-    return thresholdIsMinOrMax;
-  }
-
-  @Override
-  public void setThresholdMinMax(boolean b)
-  {
-    thresholdIsMinOrMax = b;
-  }
-
-  @Override
   public float getThreshold()
   {
     return threshold;
@@ -506,10 +668,7 @@ public class FeatureColour implements FeatureColourI
   }
 
   /**
-   * Updates the base and range appropriately for the given minmax range
-   * 
-   * @param min
-   * @param max
+   * {@inheritDoc}
    */
   @Override
   public void updateBounds(float min, float max)
@@ -542,7 +701,10 @@ public class FeatureColour implements FeatureColourI
   {
     if (isColourByLabel())
     {
-      return ColorUtils.createColourFromName(feature.getDescription());
+      String label = attributeName == null ? feature.getDescription()
+              : feature.getValueAsString(attributeName);
+      return label == null ? noColour : ColorUtils
+              .createColourFromName(label);
     }
 
     if (!isGraduatedColour())
@@ -552,17 +714,31 @@ public class FeatureColour implements FeatureColourI
 
     /*
      * graduated colour case, optionally with threshold
-     * Float.NaN is assigned minimum visible score colour
+     * may be based on feature score on an attribute value
+     * Float.NaN, or no value, is assigned the 'no value' colour
      */
     float scr = feature.getScore();
+    if (attributeName != null)
+    {
+      try
+      {
+        String attVal = feature.getValueAsString(attributeName);
+        scr = Float.valueOf(attVal);
+      } catch (Throwable e)
+      {
+        scr = Float.NaN;
+      }
+    }
     if (Float.isNaN(scr))
     {
-      return getMinColour();
+      return noColour;
     }
+
     if (isAboveThreshold() && scr <= threshold)
     {
       return null;
     }
+
     if (isBelowThreshold() && scr >= threshold)
     {
       return null;
@@ -635,21 +811,43 @@ public class FeatureColour implements FeatureColourI
     else
     {
       StringBuilder sb = new StringBuilder(32);
-      if (isColourByLabel())
+      if (isColourByAttribute())
       {
-        sb.append("label");
-        if (hasThreshold())
-        {
-          sb.append(BAR).append(BAR).append(BAR);
-        }
+        sb.append(ATTRIBUTE).append(BAR);
+        sb.append(
+                FeatureMatcher.toAttributeDisplayName(getAttributeName()));
+      }
+      else if (isColourByLabel())
+      {
+        sb.append(LABEL);
+      }
+      else
+      {
+        sb.append(SCORE);
       }
       if (isGraduatedColour())
       {
-        sb.append(Format.getHexString(getMinColour())).append(BAR);
+        sb.append(BAR).append(Format.getHexString(getMinColour()))
+                .append(BAR);
         sb.append(Format.getHexString(getMaxColour())).append(BAR);
+        String noValue = minColour.equals(noColour) ? NO_VALUE_MIN
+                : (maxColour.equals(noColour) ? NO_VALUE_MAX
+                        : NO_VALUE_NONE);
+        sb.append(noValue).append(BAR);
         if (!isAutoScaled())
         {
-          sb.append("abso").append(BAR);
+          sb.append(ABSOLUTE).append(BAR);
+        }
+      }
+      else
+      {
+        /*
+         * colour by text with score threshold: empty fields for
+         * minColour and maxColour (not used)
+         */
+        if (hasThreshold())
+        {
+          sb.append(BAR).append(BAR).append(BAR);
         }
       }
       if (hasThreshold() || isGraduatedColour())
@@ -658,11 +856,11 @@ public class FeatureColour implements FeatureColourI
         sb.append(getMax()).append(BAR);
         if (isBelowThreshold())
         {
-          sb.append("below").append(BAR).append(getThreshold());
+          sb.append(BELOW).append(BAR).append(getThreshold());
         }
         else if (isAboveThreshold())
         {
-          sb.append("above").append(BAR).append(getThreshold());
+          sb.append(ABOVE).append(BAR).append(getThreshold());
         }
         else
         {
@@ -674,4 +872,22 @@ public class FeatureColour implements FeatureColourI
     return String.format("%s\t%s", featureType, colourString);
   }
 
+  @Override
+  public boolean isColourByAttribute()
+  {
+    return attributeName != null;
+  }
+
+  @Override
+  public String[] getAttributeName()
+  {
+    return attributeName;
+  }
+
+  @Override
+  public void setAttributeName(String... name)
+  {
+    attributeName = name;
+  }
+
 }
diff --git a/src/jalview/schemes/ResidueProperties.java b/src/jalview/schemes/ResidueProperties.java
index 55df1d1..a4e6480 100755
--- a/src/jalview/schemes/ResidueProperties.java
+++ b/src/jalview/schemes/ResidueProperties.java
@@ -39,14 +39,14 @@ public class ResidueProperties
 
   public static final int[] purinepyrimidineIndex;
 
-  public static final Map aa3Hash = new HashMap();
+  public static final Map aa3Hash = new HashMap<>();
 
-  public static final Map aa2Triplet = new HashMap();
+  public static final Map aa2Triplet = new HashMap<>();
 
-  public static final Map nucleotideName = new HashMap();
+  public static final Map nucleotideName = new HashMap<>();
 
   // lookup from modified amino acid (e.g. MSE) to canonical form (e.g. MET)
-  public static final Map modifications = new HashMap();
+  public static final Map modifications = new HashMap<>();
 
   static
   {
@@ -496,25 +496,27 @@ public class ResidueProperties
    * Color.white, // R Color.white, // Y Color.white, // N Color.white, // Gap
    */
 
-  public static List STOP = Arrays.asList("TGA", "TAA", "TAG");
+  public static String STOP = "STOP";
+
+  public static List STOP_CODONS = Arrays.asList("TGA", "TAA", "TAG");
 
   public static String START = "ATG";
 
   /**
    * Nucleotide Ambiguity Codes
    */
-  public static final Map ambiguityCodes = new Hashtable();
+  public static final Map ambiguityCodes = new Hashtable<>();
 
   /**
    * Codon triplets with additional symbols for unambiguous codons that include
    * ambiguity codes
    */
-  public static final Hashtable codonHash2 = new Hashtable();
+  public static final Hashtable codonHash2 = new Hashtable<>();
 
   /**
    * all ambiguity codes for a given base
    */
-  public final static Hashtable> _ambiguityCodes = new Hashtable>();
+  public final static Hashtable> _ambiguityCodes = new Hashtable<>();
 
   static
   {
@@ -638,7 +640,7 @@ public class ResidueProperties
         List codesfor = _ambiguityCodes.get(r);
         if (codesfor == null)
         {
-          _ambiguityCodes.put(r, codesfor = new ArrayList());
+          _ambiguityCodes.put(r, codesfor = new ArrayList<>());
         }
         if (!codesfor.contains(acode.getKey()))
         {
@@ -755,27 +757,27 @@ public class ResidueProperties
   }
 
   // Stores residue codes/names and colours and other things
-  public static Map> propHash = new Hashtable>();
+  public static Map> propHash = new Hashtable<>();
 
-  public static Map hydrophobic = new Hashtable();
+  public static Map hydrophobic = new Hashtable<>();
 
-  public static Map polar = new Hashtable();
+  public static Map polar = new Hashtable<>();
 
-  public static Map small = new Hashtable();
+  public static Map small = new Hashtable<>();
 
-  public static Map positive = new Hashtable();
+  public static Map positive = new Hashtable<>();
 
-  public static Map negative = new Hashtable();
+  public static Map negative = new Hashtable<>();
 
-  public static Map charged = new Hashtable();
+  public static Map charged = new Hashtable<>();
 
-  public static Map aromatic = new Hashtable();
+  public static Map aromatic = new Hashtable<>();
 
-  public static Map aliphatic = new Hashtable();
+  public static Map aliphatic = new Hashtable<>();
 
-  public static Map tiny = new Hashtable();
+  public static Map tiny = new Hashtable<>();
 
-  public static Map proline = new Hashtable();
+  public static Map proline = new Hashtable<>();
 
   static
   {
@@ -1149,7 +1151,7 @@ public class ResidueProperties
     String cdn = codonHash2.get(lccodon.toUpperCase());
     if ("*".equals(cdn))
     {
-      return "STOP";
+      return STOP;
     }
     return cdn;
   }
@@ -1157,7 +1159,7 @@ public class ResidueProperties
   public static Hashtable toDssp3State;
   static
   {
-    toDssp3State = new Hashtable();
+    toDssp3State = new Hashtable<>();
     toDssp3State.put("H", "H");
     toDssp3State.put("E", "E");
     toDssp3State.put("C", " ");
@@ -2525,7 +2527,7 @@ public class ResidueProperties
   // / cut here
   public static void main(String[] args)
   {
-    Hashtable> aaProps = new Hashtable>();
+    Hashtable> aaProps = new Hashtable<>();
     System.out.println("my %aa = {");
     // invert property hashes
     for (String pname : propHash.keySet())
@@ -2536,7 +2538,7 @@ public class ResidueProperties
         Vector aprops = aaProps.get(rname);
         if (aprops == null)
         {
-          aprops = new Vector();
+          aprops = new Vector<>();
           aaProps.put(rname, aprops);
         }
         Integer hasprop = phash.get(rname);
@@ -2578,7 +2580,7 @@ public class ResidueProperties
   public static List getResidues(boolean forNucleotide,
           boolean includeAmbiguous)
   {
-    List result = new ArrayList();
+    List result = new ArrayList<>();
     if (forNucleotide)
     {
       for (String nuc : nucleotideName.keySet())
diff --git a/src/jalview/util/ColorUtils.java b/src/jalview/util/ColorUtils.java
index d4be322..60129fb 100644
--- a/src/jalview/util/ColorUtils.java
+++ b/src/jalview/util/ColorUtils.java
@@ -25,10 +25,17 @@
 package jalview.util;
 
 import java.awt.Color;
+import java.util.HashMap;
+import java.util.Map;
 import java.util.Random;
 
 public class ColorUtils
 {
+  private static final int MAX_CACHE_SIZE = 1729;
+  /*
+   * a cache for colours generated from text strings
+   */
+  static Map myColours = new HashMap<>();
 
   /**
    * Generates a random color, will mix with input color. Code taken from
@@ -260,6 +267,10 @@ public class ColorUtils
     {
       return Color.white;
     }
+    if (myColours.containsKey(name))
+    {
+      return myColours.get(name);
+    }
     int lsize = name.length();
     int start = 0;
     int end = lsize / 3;
@@ -291,6 +302,11 @@ public class ColorUtils
 
     Color color = new Color(r, g, b);
 
+    if (myColours.size() < MAX_CACHE_SIZE)
+    {
+      myColours.put(name, color);
+    }
+
     return color;
   }
 
diff --git a/src/jalview/util/MapList.java b/src/jalview/util/MapList.java
index 4658724..c944345 100644
--- a/src/jalview/util/MapList.java
+++ b/src/jalview/util/MapList.java
@@ -77,8 +77,8 @@ public class MapList
    */
   public MapList()
   {
-    fromShifts = new ArrayList();
-    toShifts = new ArrayList();
+    fromShifts = new ArrayList<>();
+    toShifts = new ArrayList<>();
   }
 
   /**
@@ -347,7 +347,7 @@ public class MapList
     }
 
     boolean changed = false;
-    List merged = new ArrayList();
+    List merged = new ArrayList<>();
     int[] lastRange = ranges.get(0);
     int lastDirection = lastRange[1] >= lastRange[0] ? 1 : -1;
     lastRange = new int[] { lastRange[0], lastRange[1] };
@@ -803,7 +803,7 @@ public class MapList
     {
       return null;
     }
-    List ranges = new ArrayList();
+    List ranges = new ArrayList<>();
     if (fs <= fe)
     {
       intv = fs;
@@ -1094,8 +1094,33 @@ public class MapList
    */
   public boolean isFromForwardStrand()
   {
+    return isForwardStrand(getFromRanges());
+  }
+
+  /**
+   * Returns true if mapping is to forward strand, false if to reverse strand.
+   * Result is just based on the first 'to' range that is not a single position.
+   * Default is true unless proven to be false. Behaviour is not well defined if
+   * the mapping has a mixture of forward and reverse ranges.
+   * 
+   * @return
+   */
+  public boolean isToForwardStrand()
+  {
+    return isForwardStrand(getToRanges());
+  }
+
+  /**
+   * A helper method that returns true unless at least one range has start > end.
+   * Behaviour is undefined for a mixture of forward and reverse ranges.
+   * 
+   * @param ranges
+   * @return
+   */
+  private boolean isForwardStrand(List ranges)
+  {
     boolean forwardStrand = true;
-    for (int[] range : getFromRanges())
+    for (int[] range : ranges)
     {
       if (range[1] > range[0])
       {
@@ -1120,4 +1145,63 @@ public class MapList
             || (fromRatio == 3 && toRatio == 1);
   }
 
+  /**
+   * Returns a map which is the composite of this one and the input map. That
+   * is, the output map has the fromRanges of this map, and its toRanges are the
+   * toRanges of this map as transformed by the input map.
+   * 
+   * Returns null if the mappings cannot be traversed (not all toRanges of this
+   * map correspond to fromRanges of the input), or if this.toRatio does not
+   * match map.fromRatio.
+   * 
+   * 
+   * Example 1:
+   *    this:   from [1-100] to [501-600]
+   *    input:  from [10-40] to [60-90]
+   *    output: from [10-40] to [560-590]
+   * Example 2 ('reverse strand exons'):
+   *    this:   from [1-100] to [2000-1951], [1000-951] // transcript to loci
+   *    input:  from [1-50]  to [41-90] // CDS to transcript
+   *    output: from [10-40] to [1960-1951], [1000-971] // CDS to gene loci
+   * 
+   * 
+   * @param map
+   * @return
+   */
+  public MapList traverse(MapList map)
+  {
+    if (map == null)
+    {
+      return null;
+    }
+
+    /*
+     * compound the ratios by this rule:
+     * A:B with M:N gives A*M:B*N
+     * reduced by greatest common divisor
+     * so 1:3 with 3:3 is 3:9 or 1:3
+     * 1:3 with 3:1 is 3:3 or 1:1
+     * 1:3 with 1:3 is 1:9
+     * 2:5 with 3:7 is 6:35
+     */
+    int outFromRatio = getFromRatio() * map.getFromRatio();
+    int outToRatio = getToRatio() * map.getToRatio();
+    int gcd = MathUtils.gcd(outFromRatio, outToRatio);
+    outFromRatio /= gcd;
+    outToRatio /= gcd;
+
+    List toRanges = new ArrayList<>();
+    for (int[] range : getToRanges())
+    {
+      int[] transferred = map.locateInTo(range[0], range[1]);
+      if (transferred == null)
+      {
+        return null;
+      }
+      toRanges.add(transferred);
+    }
+
+    return new MapList(getFromRanges(), toRanges, outFromRatio, outToRatio);
+  }
+
 }
diff --git a/src/jalview/util/MappingUtils.java b/src/jalview/util/MappingUtils.java
index 9c5c109..f5dd883 100644
--- a/src/jalview/util/MappingUtils.java
+++ b/src/jalview/util/MappingUtils.java
@@ -941,6 +941,34 @@ public final class MappingUtils
   }
 
   /**
+   * Answers true if range's start-end positions include those of queryRange,
+   * where either range might be in reverse direction, else false
+   * 
+   * @param range
+   *          a start-end range
+   * @param queryRange
+   *          a candidate subrange of range (start2-end2)
+   * @return
+   */
+  public static boolean rangeContains(int[] range, int[] queryRange)
+  {
+    if (range == null || queryRange == null || range.length != 2
+            || queryRange.length != 2)
+    {
+      /*
+       * invalid arguments
+       */
+      return false;
+    }
+
+    int min = Math.min(range[0], range[1]);
+    int max = Math.max(range[0], range[1]);
+  
+    return (min <= queryRange[0] && max >= queryRange[0]
+            && min <= queryRange[1] && max >= queryRange[1]);
+  }
+
+  /**
    * Removes the specified number of positions from the given ranges. Provided
    * to allow a stop codon to be stripped from a CDS sequence so that it matches
    * the peptide translation length.
diff --git a/src/jalview/util/MathUtils.java b/src/jalview/util/MathUtils.java
new file mode 100644
index 0000000..72d46a2
--- /dev/null
+++ b/src/jalview/util/MathUtils.java
@@ -0,0 +1,22 @@
+package jalview.util;
+
+public class MathUtils
+{
+
+  /**
+   * Returns the greatest common divisor of two integers
+   * 
+   * @param a
+   * @param b
+   * @return
+   */
+  public static int gcd(int a, int b)
+  {
+    if (b == 0)
+    {
+      return Math.abs(a);
+    }
+    return gcd(b, a % b);
+  }
+
+}
diff --git a/src/jalview/util/StringUtils.java b/src/jalview/util/StringUtils.java
index b3456aa..2e8ace8 100644
--- a/src/jalview/util/StringUtils.java
+++ b/src/jalview/util/StringUtils.java
@@ -403,4 +403,45 @@ public class StringUtils
     }
     return s.substring(0, 1).toUpperCase() + s.substring(1).toLowerCase();
   }
+
+  /**
+   * A helper method that strips off any leading or trailing html and body tags.
+   * If no html tag is found, then also html-encodes angle bracket characters.
+   * 
+   * @param text
+   * @return
+   */
+  public static String stripHtmlTags(String text)
+  {
+    if (text == null)
+    {
+      return null;
+    }
+    String tmp2up = text.toUpperCase();
+    int startTag = tmp2up.indexOf("");
+    if (startTag > -1)
+    {
+      text = text.substring(startTag + 6);
+      tmp2up = tmp2up.substring(startTag + 6);
+    }
+    // is omission of "" intentional here??
+    int endTag = tmp2up.indexOf("");
+    if (endTag > -1)
+    {
+      text = text.substring(0, endTag);
+      tmp2up = tmp2up.substring(0, endTag);
+    }
+    endTag = tmp2up.indexOf("");
+    if (endTag > -1)
+    {
+      text = text.substring(0, endTag);
+    }
+  
+    if (startTag == -1 && (text.contains("<") || text.contains(">")))
+    {
+      text = text.replaceAll("<", "<");
+      text = text.replaceAll(">", ">");
+    }
+    return text;
+  }
 }
diff --git a/src/jalview/util/matcher/Condition.java b/src/jalview/util/matcher/Condition.java
new file mode 100644
index 0000000..8816a7f
--- /dev/null
+++ b/src/jalview/util/matcher/Condition.java
@@ -0,0 +1,102 @@
+package jalview.util.matcher;
+
+import jalview.util.MessageManager;
+
+/**
+ * An enumeration for binary conditions that a user might choose from when
+ * setting filter or match conditions for values
+ */
+public enum Condition
+{
+  Contains(false, true, "Contains"),
+  NotContains(false, true, "NotContains"), Matches(false, true, "Matches"),
+  NotMatches(false, true, "NotMatches"), Present(false, false, "Present"),
+  NotPresent(false, false, "NotPresent"), EQ(true, true, "EQ"),
+  NE(true, true, "NE"), LT(true, true, "LT"), LE(true, true, "LE"),
+  GT(true, true, "GT"), GE(true, true, "GE");
+
+  private boolean numeric;
+
+  private boolean needsAPattern;
+
+  /*
+   * value used to save a Condition to the 
+   * Jalview project file or restore it from project; 
+   * it should not be changed even if enum names change in future
+   */
+  private String stableName;
+
+  /**
+   * Answers the enum value whose 'stable name' matches the argument (not case
+   * sensitive), or null if no match
+   * 
+   * @param stableName
+   * @return
+   */
+  public static Condition fromString(String stableName)
+  {
+    for (Condition c : values())
+    {
+      if (c.stableName.equalsIgnoreCase(stableName))
+      {
+        return c;
+      }
+    }
+    return null;
+  }
+
+  /**
+   * Constructor
+   * 
+   * @param isNumeric
+   * @param needsPattern
+   * @param stablename
+   */
+  Condition(boolean isNumeric, boolean needsPattern, String stablename)
+  {
+    numeric = isNumeric;
+    needsAPattern = needsPattern;
+    stableName = stablename;
+  }
+
+  /**
+   * Answers true if the condition does a numerical comparison, else false
+   * (string comparison)
+   * 
+   * @return
+   */
+  public boolean isNumeric()
+  {
+    return numeric;
+  }
+
+  /**
+   * Answers true if the condition requires a pattern to compare against, else
+   * false
+   * 
+   * @return
+   */
+  public boolean needsAPattern()
+  {
+    return needsAPattern;
+  }
+
+  public String getStableName()
+  {
+    return stableName;
+  }
+
+  /**
+   * Answers a display name for the match condition, suitable for showing in
+   * drop-down menus. The value may be internationalized using the resource key
+   * "label.matchCondition_" with the enum name appended.
+   * 
+   * @return
+   */
+  @Override
+  public String toString()
+  {
+    return MessageManager.getStringOrReturn("label.matchCondition_",
+            name());
+  }
+}
diff --git a/src/jalview/util/matcher/Matcher.java b/src/jalview/util/matcher/Matcher.java
new file mode 100644
index 0000000..0792509
--- /dev/null
+++ b/src/jalview/util/matcher/Matcher.java
@@ -0,0 +1,251 @@
+package jalview.util.matcher;
+
+import java.util.Objects;
+import java.util.regex.Pattern;
+
+/**
+ * A bean to describe one attribute-based filter
+ */
+public class Matcher implements MatcherI
+{
+  /*
+   * the comparison condition
+   */
+  Condition condition;
+
+  /*
+   * the string pattern as entered, or the regex, to compare to
+   * also holds the string form of float value if a numeric condition
+   */
+  String pattern;
+
+  /*
+   * the pattern in upper case, for non-case-sensitive matching
+   */
+  String uppercasePattern;
+
+  /*
+   * the compiled regex if using a pattern match condition
+   * (reserved for possible future enhancement)
+   */
+  Pattern regexPattern;
+
+  /*
+   * the value to compare to for a numerical condition
+   */
+  float value;
+
+  /**
+   * Constructor
+   * 
+   * @param cond
+   * @param compareTo
+   * @return
+   * @throws NumberFormatException
+   *           if a numerical condition is specified with a non-numeric
+   *           comparison value
+   * @throws NullPointerException
+   *           if a null condition or comparison string is specified
+   */
+  public Matcher(Condition cond, String compareTo)
+  {
+    Objects.requireNonNull(cond);
+    condition = cond;
+    if (cond.isNumeric())
+    {
+      value = Float.valueOf(compareTo);
+      pattern = String.valueOf(value);
+      uppercasePattern = pattern;
+    }
+    else
+    {
+      pattern = compareTo;
+      if (pattern != null)
+      {
+        uppercasePattern = pattern.toUpperCase();
+      }
+    }
+
+    // if we add regex conditions (e.g. matchesPattern), then
+    // pattern should hold the raw regex, and
+    // regexPattern = Pattern.compile(compareTo);
+  }
+
+  /**
+   * Constructor for a numerical match condition. Note that if a string
+   * comparison condition is specified, this will be converted to a comparison
+   * with the float value as string
+   * 
+   * @param cond
+   * @param compareTo
+   */
+  public Matcher(Condition cond, float compareTo)
+  {
+    this(cond, String.valueOf(compareTo));
+  }
+
+  /**
+   * {@inheritDoc}
+   */
+  @SuppressWarnings("incomplete-switch")
+  @Override
+  public boolean matches(String val)
+  {
+    if (condition.isNumeric())
+    {
+      try
+      {
+        /*
+         * treat a null value (no such attribute) as
+         * failing any numerical filter condition
+         */
+        return val == null ? false : matches(Float.valueOf(val));
+      } catch (NumberFormatException e)
+      {
+        return false;
+      }
+    }
+    
+    /*
+     * a null value matches a negative condition, fails a positive test
+     */
+    if (val == null)
+    {
+      return condition == Condition.NotContains
+              || condition == Condition.NotMatches 
+              || condition == Condition.NotPresent;
+    }
+    
+    String upper = val.toUpperCase().trim();
+    boolean matched = false;
+    switch(condition) {
+    case Matches:
+      matched = upper.equals(uppercasePattern);
+      break;
+    case NotMatches:
+      matched = !upper.equals(uppercasePattern);
+      break;
+    case Contains:
+      matched = upper.indexOf(uppercasePattern) > -1;
+      break;
+    case NotContains:
+      matched = upper.indexOf(uppercasePattern) == -1;
+      break;
+    case Present:
+      matched = true;
+      break;
+    default:
+      break;
+    }
+    return matched;
+  }
+
+  /**
+   * Applies a numerical comparison match condition
+   * 
+   * @param f
+   * @return
+   */
+  @SuppressWarnings("incomplete-switch")
+  boolean matches(float f)
+  {
+    if (!condition.isNumeric())
+    {
+      return matches(String.valueOf(f));
+    }
+    
+    boolean matched = false;
+    switch (condition) {
+    case LT:
+      matched = f < value;
+      break;
+    case LE:
+      matched = f <= value;
+      break;
+    case EQ:
+      matched = f == value;
+      break;
+    case NE:
+      matched = f != value;
+      break;
+    case GT:
+      matched = f > value;
+      break;
+    case GE:
+      matched = f >= value;
+      break;
+    default:
+      break;
+    }
+
+    return matched;
+  }
+
+  /**
+   * A simple hash function that guarantees that when two objects are equal,
+   * they have the same hashcode
+   */
+  @Override
+  public int hashCode()
+  {
+    return pattern.hashCode() + condition.hashCode() + (int) value;
+  }
+
+  /**
+   * equals is overridden so that we can safely remove Matcher objects from
+   * collections (e.g. delete an attribute match condition for a feature colour)
+   */
+  @Override
+  public boolean equals(Object obj)
+  {
+    if (obj == null || !(obj instanceof Matcher))
+    {
+      return false;
+    }
+    Matcher m = (Matcher) obj;
+    if (condition != m.condition || value != m.value)
+    {
+      return false;
+    }
+    if (pattern == null)
+    {
+      return m.pattern == null;
+    }
+    return uppercasePattern.equals(m.uppercasePattern);
+  }
+
+  @Override
+  public Condition getCondition()
+  {
+    return condition;
+  }
+
+  @Override
+  public String getPattern()
+  {
+    return pattern;
+  }
+
+  @Override
+  public float getFloatValue()
+  {
+    return value;
+  }
+
+  @Override
+  public String toString()
+  {
+    StringBuilder sb = new StringBuilder();
+    sb.append(condition.toString()).append(" ");
+    if (condition.isNumeric())
+    {
+      sb.append(pattern);
+    }
+    else
+    {
+      sb.append("'").append(pattern).append("'");
+    }
+
+    return sb.toString();
+  }
+}
diff --git a/src/jalview/util/matcher/MatcherI.java b/src/jalview/util/matcher/MatcherI.java
new file mode 100644
index 0000000..ca6d44c
--- /dev/null
+++ b/src/jalview/util/matcher/MatcherI.java
@@ -0,0 +1,18 @@
+package jalview.util.matcher;
+
+public interface MatcherI
+{
+  /**
+   * Answers true if the given value is matched, else false
+   * 
+   * @param s
+   * @return
+   */
+  boolean matches(String s);
+
+  Condition getCondition();
+
+  String getPattern();
+
+  float getFloatValue();
+}
diff --git a/src/jalview/viewmodel/seqfeatures/FeatureRendererModel.java b/src/jalview/viewmodel/seqfeatures/FeatureRendererModel.java
index 2f30e94..e4d9d88 100644
--- a/src/jalview/viewmodel/seqfeatures/FeatureRendererModel.java
+++ b/src/jalview/viewmodel/seqfeatures/FeatureRendererModel.java
@@ -26,6 +26,7 @@ import jalview.api.FeaturesDisplayedI;
 import jalview.datamodel.AlignmentI;
 import jalview.datamodel.SequenceFeature;
 import jalview.datamodel.SequenceI;
+import jalview.datamodel.features.FeatureMatcherSetI;
 import jalview.datamodel.features.SequenceFeatures;
 import jalview.renderer.seqfeatures.FeatureRenderer;
 import jalview.schemes.FeatureColour;
@@ -48,15 +49,48 @@ import java.util.concurrent.ConcurrentHashMap;
 public abstract class FeatureRendererModel
         implements jalview.api.FeatureRenderer
 {
+  /*
+   * a data bean to hold one row of feature settings from the gui
+   */
+  public static class FeatureSettingsBean
+  {
+    public final String featureType;
 
-  /**
+    public final FeatureColourI featureColour;
+
+    public final FeatureMatcherSetI filter;
+
+    public final Boolean show;
+
+    public FeatureSettingsBean(String type, FeatureColourI colour,
+            FeatureMatcherSetI theFilter, Boolean isShown)
+    {
+      featureType = type;
+      featureColour = colour;
+      filter = theFilter;
+      show = isShown;
+    }
+  }
+
+  /*
    * global transparency for feature
    */
   protected float transparency = 1.0f;
 
-  protected Map featureColours = new ConcurrentHashMap();
+  /*
+   * colour scheme for each feature type
+   */
+  protected Map featureColours = new ConcurrentHashMap<>();
 
-  protected Map featureGroups = new ConcurrentHashMap();
+  /*
+   * visibility flag for each feature group
+   */
+  protected Map featureGroups = new ConcurrentHashMap<>();
+
+  /*
+   * filters for each feature type
+   */
+  protected Map featureFilters = new HashMap<>();
 
   protected String[] renderOrder;
 
@@ -100,6 +134,7 @@ public abstract class FeatureRendererModel
     this.renderOrder = frs.renderOrder;
     this.featureGroups = frs.featureGroups;
     this.featureColours = frs.featureColours;
+    this.featureFilters = frs.featureFilters;
     this.transparency = frs.transparency;
     this.featureOrder = frs.featureOrder;
     if (av != null && av != fr.getViewport())
@@ -156,7 +191,7 @@ public abstract class FeatureRendererModel
     {
       av.setFeaturesDisplayed(fdi = new FeaturesDisplayed());
     }
-    List nft = new ArrayList();
+    List nft = new ArrayList<>();
     for (String featureType : featureTypes)
     {
       if (!fdi.isRegistered(featureType))
@@ -192,7 +227,7 @@ public abstract class FeatureRendererModel
     renderOrder = neworder;
   }
 
-  protected Map minmax = new Hashtable();
+  protected Map minmax = new Hashtable<>();
 
   public Map getMinMax()
   {
@@ -271,7 +306,7 @@ public abstract class FeatureRendererModel
      * include features at the position provided their feature type is 
      * displayed, and feature group is null or marked for display
      */
-    List result = new ArrayList();
+    List result = new ArrayList<>();
     if (!av.areFeaturesDisplayed() || getFeaturesDisplayed() == null)
     {
       return result;
@@ -284,9 +319,13 @@ public abstract class FeatureRendererModel
     List features = sequence.findFeatures(column, column,
             visibleTypes);
 
+    /*
+     * include features unless their feature group is not displayed, or
+     * they are hidden (have no colour) based on a filter or colour threshold
+     */
     for (SequenceFeature sf : features)
     {
-      if (!featureGroupNotShown(sf))
+      if (!featureGroupNotShown(sf) && getColour(sf) != null)
       {
         result.add(sf);
       }
@@ -320,7 +359,7 @@ public abstract class FeatureRendererModel
     }
     FeaturesDisplayedI featuresDisplayed = av.getFeaturesDisplayed();
 
-    Set oldfeatures = new HashSet();
+    Set oldfeatures = new HashSet<>();
     if (renderOrder != null)
     {
       for (int i = 0; i < renderOrder.length; i++)
@@ -333,7 +372,7 @@ public abstract class FeatureRendererModel
     }
 
     AlignmentI alignment = av.getAlignment();
-    List allfeatures = new ArrayList();
+    List allfeatures = new ArrayList<>();
 
     for (int i = 0; i < alignment.getHeight(); i++)
     {
@@ -413,7 +452,7 @@ public abstract class FeatureRendererModel
      */
     if (minmax == null)
     {
-      minmax = new Hashtable();
+      minmax = new Hashtable<>();
     }
     synchronized (minmax)
     {
@@ -450,7 +489,7 @@ public abstract class FeatureRendererModel
    */
   private void updateRenderOrder(List allFeatures)
   {
-    List allfeatures = new ArrayList(allFeatures);
+    List allfeatures = new ArrayList<>(allFeatures);
     String[] oldRender = renderOrder;
     renderOrder = new String[allfeatures.size()];
     boolean initOrders = (featureOrder == null);
@@ -477,7 +516,8 @@ public abstract class FeatureRendererModel
               if (mmrange != null)
               {
                 FeatureColourI fc = featureColours.get(oldRender[j]);
-                if (fc != null && !fc.isSimpleColour() && fc.isAutoScaled())
+                if (fc != null && !fc.isSimpleColour() && fc.isAutoScaled()
+                        && !fc.isColourByAttribute())
                 {
                   fc.updateBounds(mmrange[0][0], mmrange[0][1]);
                 }
@@ -507,7 +547,8 @@ public abstract class FeatureRendererModel
         if (mmrange != null)
         {
           FeatureColourI fc = featureColours.get(newf[i]);
-          if (fc != null && !fc.isSimpleColour() && fc.isAutoScaled())
+          if (fc != null && !fc.isSimpleColour() && fc.isAutoScaled()
+                  && !fc.isColourByAttribute())
           {
             fc.updateBounds(mmrange[0][0], mmrange[0][1]);
           }
@@ -557,20 +598,11 @@ public abstract class FeatureRendererModel
     return fc;
   }
 
-  /**
-   * Returns the configured colour for a particular feature instance. This
-   * includes calculation of 'colour by label', or of a graduated score colour,
-   * if applicable. It does not take into account feature visibility or colour
-   * transparency. Returns null for a score feature whose score value lies
-   * outside any colour threshold.
-   * 
-   * @param feature
-   * @return
-   */
+  @Override
   public Color getColour(SequenceFeature feature)
   {
     FeatureColourI fc = getFeatureStyle(feature.getType());
-    return fc.getColor(feature);
+    return getColor(feature, fc);
   }
 
   /**
@@ -582,7 +614,8 @@ public abstract class FeatureRendererModel
    */
   protected boolean showFeatureOfType(String type)
   {
-    return type == null ? false : av.getFeaturesDisplayed().isVisible(type);
+    return type == null ? false : (av.getFeaturesDisplayed() == null ? true
+            : av.getFeaturesDisplayed().isVisible(type));
   }
 
   @Override
@@ -617,7 +650,7 @@ public abstract class FeatureRendererModel
   {
     if (featureOrder == null)
     {
-      featureOrder = new Hashtable();
+      featureOrder = new Hashtable<>();
     }
     featureOrder.put(type, new Float(position));
     return position;
@@ -651,32 +684,33 @@ public abstract class FeatureRendererModel
    * Replace current ordering with new ordering
    * 
    * @param data
-   *          { String(Type), Colour(Type), Boolean(Displayed) }
+   *          an array of { Type, Colour, Filter, Boolean }
    * @return true if any visible features have been reordered, else false
    */
-  public boolean setFeaturePriority(Object[][] data)
+  public boolean setFeaturePriority(FeatureSettingsBean[] data)
   {
     return setFeaturePriority(data, true);
   }
 
   /**
-   * Sets the priority order for features, with the highest priority (displayed
-   * on top) at the start of the data array
+   * Sets the priority order for features, with the highest priority (displayed on
+   * top) at the start of the data array
    * 
    * @param data
-   *          { String(Type), Colour(Type), Boolean(Displayed) }
+   *          an array of { Type, Colour, Filter, Boolean }
    * @param visibleNew
    *          when true current featureDisplay list will be cleared
-   * @return true if any visible features have been reordered or recoloured,
-   *         else false (i.e. no need to repaint)
+   * @return true if any visible features have been reordered or recoloured, else
+   *         false (i.e. no need to repaint)
    */
-  public boolean setFeaturePriority(Object[][] data, boolean visibleNew)
+  public boolean setFeaturePriority(FeatureSettingsBean[] data,
+          boolean visibleNew)
   {
     /*
      * note visible feature ordering and colours before update
      */
     List visibleFeatures = getDisplayedFeatureTypes();
-    Map visibleColours = new HashMap(
+    Map visibleColours = new HashMap<>(
             getFeatureColours());
 
     FeaturesDisplayedI av_featuresdisplayed = null;
@@ -709,9 +743,9 @@ public abstract class FeatureRendererModel
     {
       for (int i = 0; i < data.length; i++)
       {
-        String type = data[i][0].toString();
-        setColour(type, (FeatureColourI) data[i][1]);
-        if (((Boolean) data[i][2]).booleanValue())
+        String type = data[i].featureType;
+        setColour(type, data[i].featureColour);
+        if (data[i].show)
         {
           av_featuresdisplayed.setVisible(type);
         }
@@ -836,7 +870,7 @@ public abstract class FeatureRendererModel
   {
     if (featureGroups != null)
     {
-      List gp = new ArrayList();
+      List gp = new ArrayList<>();
 
       for (String grp : featureGroups.keySet())
       {
@@ -882,7 +916,7 @@ public abstract class FeatureRendererModel
   @Override
   public Map getDisplayedFeatureCols()
   {
-    Map fcols = new Hashtable();
+    Map fcols = new Hashtable<>();
     if (getViewport().getFeaturesDisplayed() == null)
     {
       return fcols;
@@ -910,7 +944,7 @@ public abstract class FeatureRendererModel
   public List getDisplayedFeatureTypes()
   {
     List typ = getRenderOrder();
-    List displayed = new ArrayList();
+    List displayed = new ArrayList<>();
     FeaturesDisplayedI feature_disp = av.getFeaturesDisplayed();
     if (feature_disp != null)
     {
@@ -931,7 +965,7 @@ public abstract class FeatureRendererModel
   @Override
   public List getDisplayedFeatureGroups()
   {
-    List _gps = new ArrayList();
+    List _gps = new ArrayList<>();
     for (String gp : getFeatureGroups())
     {
       if (checkGroupVisibility(gp, false))
@@ -966,7 +1000,7 @@ public abstract class FeatureRendererModel
   public List findFeaturesAtResidue(SequenceI sequence,
           int resNo)
   {
-    List result = new ArrayList();
+    List result = new ArrayList<>();
     if (!av.areFeaturesDisplayed() || getFeaturesDisplayed() == null)
     {
       return result;
@@ -986,7 +1020,7 @@ public abstract class FeatureRendererModel
   
     for (SequenceFeature sf : features)
     {
-      if (!featureGroupNotShown(sf))
+      if (!featureGroupNotShown(sf) && getColour(sf) != null)
       {
         result.add(sf);
       }
@@ -995,35 +1029,26 @@ public abstract class FeatureRendererModel
   }
 
   /**
-   * Removes from the list of features any that have a feature group that is not
-   * displayed, or duplicate the location of a feature of the same type (unless
-   * a graduated colour scheme or colour by label is applied). Should be used
-   * only for features of the same feature colour (which normally implies the
-   * same feature type).
+   * Removes from the list of features any that duplicate the location of a
+   * feature of the same type. Should be used only for features of the same,
+   * simple, feature colour (which normally implies the same feature type). Does
+   * not check visibility settings for feature type or feature group.
    * 
    * @param features
-   * @param fc
    */
-  public void filterFeaturesForDisplay(List features,
-          FeatureColourI fc)
+  public void filterFeaturesForDisplay(List features)
   {
     if (features.isEmpty())
     {
       return;
     }
     SequenceFeatures.sortFeatures(features, true);
-    boolean simpleColour = fc == null || fc.isSimpleColour();
     SequenceFeature lastFeature = null;
 
     Iterator it = features.iterator();
     while (it.hasNext())
     {
       SequenceFeature sf = it.next();
-      if (featureGroupNotShown(sf))
-      {
-        it.remove();
-        continue;
-      }
 
       /*
        * a feature is redundant for rendering purposes if it has the
@@ -1031,18 +1056,90 @@ public abstract class FeatureRendererModel
        * (checking type and isContactFeature as a fail-safe here, although
        * currently they are guaranteed to match in this context)
        */
-      if (simpleColour)
+      if (lastFeature != null && sf.getBegin() == lastFeature.getBegin()
+              && sf.getEnd() == lastFeature.getEnd()
+              && sf.isContactFeature() == lastFeature.isContactFeature()
+              && sf.getType().equals(lastFeature.getType()))
       {
-        if (lastFeature != null && sf.getBegin() == lastFeature.getBegin()
-                && sf.getEnd() == lastFeature.getEnd()
-                && sf.isContactFeature() == lastFeature.isContactFeature()
-                && sf.getType().equals(lastFeature.getType()))
-        {
-          it.remove();
-        }
+        it.remove();
       }
       lastFeature = sf;
     }
   }
 
+  @Override
+  public Map getFeatureFilters()
+  {
+    return featureFilters;
+  }
+
+  @Override
+  public void setFeatureFilters(Map filters)
+  {
+    featureFilters = filters;
+  }
+
+  @Override
+  public FeatureMatcherSetI getFeatureFilter(String featureType)
+  {
+    return featureFilters.get(featureType);
+  }
+
+  @Override
+  public void setFeatureFilter(String featureType, FeatureMatcherSetI filter)
+  {
+    if (filter == null || filter.isEmpty())
+    {
+      featureFilters.remove(featureType);
+    }
+    else
+    {
+      featureFilters.put(featureType, filter);
+    }
+  }
+
+  /**
+   * Answers the colour for the feature, or null if the feature is excluded by
+   * feature group visibility, by filters, or by colour threshold settings. This
+   * method does not take feature visibility into account.
+   * 
+   * @param sf
+   * @param fc
+   * @return
+   */
+  public Color getColor(SequenceFeature sf, FeatureColourI fc)
+  {
+    /*
+     * is the feature group displayed?
+     */
+    if (featureGroupNotShown(sf))
+    {
+      return null;
+    }
+
+    /*
+     * does the feature pass filters?
+     */
+    if (!featureMatchesFilters(sf))
+    {
+      return null;
+    }
+  
+    return fc.getColor(sf);
+  }
+
+  /**
+   * Answers true if there no are filters defined for the feature type, or this
+   * feature matches the filters. Answers false if the feature fails to match
+   * filters.
+   * 
+   * @param sf
+   * @return
+   */
+  protected boolean featureMatchesFilters(SequenceFeature sf)
+  {
+    FeatureMatcherSetI filter = featureFilters.get(sf.getType());
+    return filter == null ? true : filter.matches(sf);
+  }
+
 }
diff --git a/src/jalview/viewmodel/seqfeatures/FeatureRendererSettings.java b/src/jalview/viewmodel/seqfeatures/FeatureRendererSettings.java
index dc2ae11..f594453 100644
--- a/src/jalview/viewmodel/seqfeatures/FeatureRendererSettings.java
+++ b/src/jalview/viewmodel/seqfeatures/FeatureRendererSettings.java
@@ -21,9 +21,11 @@
 package jalview.viewmodel.seqfeatures;
 
 import jalview.api.FeatureColourI;
+import jalview.datamodel.features.FeatureMatcherSetI;
 import jalview.schemes.FeatureColour;
 
 import java.util.Arrays;
+import java.util.HashMap;
 import java.util.Iterator;
 import java.util.Map;
 import java.util.concurrent.ConcurrentHashMap;
@@ -42,6 +44,11 @@ public class FeatureRendererSettings implements Cloneable
    */
   Map featureColours;
 
+  /*
+   * map of {featureType, filters}
+   */
+  Map featureFilters;
+
   float transparency;
 
   Map featureOrder;
@@ -72,7 +79,9 @@ public class FeatureRendererSettings implements Cloneable
     renderOrder = null;
     featureGroups = new ConcurrentHashMap();
     featureColours = new ConcurrentHashMap();
+    featureFilters = new HashMap<>();
     featureOrder = new ConcurrentHashMap();
+
     if (fr.renderOrder != null)
     {
       this.renderOrder = new String[fr.renderOrder.length];
@@ -100,6 +109,12 @@ public class FeatureRendererSettings implements Cloneable
         featureColours.put(next, new FeatureColour((FeatureColour) val));
       }
     }
+
+    if (fr.featureFilters != null)
+    {
+      this.featureFilters.putAll(fr.featureFilters);
+    }
+
     this.transparency = fr.transparency;
     if (fr.featureOrder != null)
     {
diff --git a/test/jalview/analysis/AlignmentUtilsTests.java b/test/jalview/analysis/AlignmentUtilsTests.java
index 06b51e6..be6ba60 100644
--- a/test/jalview/analysis/AlignmentUtilsTests.java
+++ b/test/jalview/analysis/AlignmentUtilsTests.java
@@ -34,6 +34,7 @@ import jalview.datamodel.AlignmentAnnotation;
 import jalview.datamodel.AlignmentI;
 import jalview.datamodel.Annotation;
 import jalview.datamodel.DBRefEntry;
+import jalview.datamodel.GeneLociI;
 import jalview.datamodel.Mapping;
 import jalview.datamodel.SearchResultMatchI;
 import jalview.datamodel.SearchResultsI;
@@ -63,6 +64,8 @@ import org.testng.annotations.Test;
 
 public class AlignmentUtilsTests
 {
+  private static Sequence ts = new Sequence("short",
+          "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklm");
 
   @BeforeClass(alwaysRun = true)
   public void setUpJvOptionPane()
@@ -71,9 +74,6 @@ public class AlignmentUtilsTests
     JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
   }
 
-  public static Sequence ts = new Sequence("short",
-          "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklm");
-
   @Test(groups = { "Functional" })
   public void testExpandContext()
   {
@@ -263,14 +263,14 @@ public class AlignmentUtilsTests
   @Test(groups = { "Functional" })
   public void testMapProteinAlignmentToCdna_noXrefs() throws IOException
   {
-    List protseqs = new ArrayList();
+    List protseqs = new ArrayList<>();
     protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
     protseqs.add(new Sequence("UNIPROT|V12346", "EIQ"));
     protseqs.add(new Sequence("UNIPROT|V12347", "SAR"));
     AlignmentI protein = new Alignment(protseqs.toArray(new SequenceI[3]));
     protein.setDataset(null);
 
-    List dnaseqs = new ArrayList();
+    List dnaseqs = new ArrayList<>();
     dnaseqs.add(new Sequence("EMBL|A11111", "TCAGCACGC")); // = SAR
     dnaseqs.add(new Sequence("EMBL|A22222", "GAGATACAA")); // = EIQ
     dnaseqs.add(new Sequence("EMBL|A33333", "GAAATCCAG")); // = EIQ
@@ -507,7 +507,7 @@ public class AlignmentUtilsTests
     acf.addMap(dna1.getDatasetSequence(), prot1.getDatasetSequence(), map);
     acf.addMap(dna2.getDatasetSequence(), prot2.getDatasetSequence(), map);
     acf.addMap(dna3.getDatasetSequence(), prot3.getDatasetSequence(), map);
-    ArrayList acfs = new ArrayList();
+    ArrayList acfs = new ArrayList<>();
     acfs.add(acf);
     protein.setCodonFrames(acfs);
 
@@ -605,14 +605,14 @@ public class AlignmentUtilsTests
   public void testMapProteinAlignmentToCdna_withStartAndStopCodons()
           throws IOException
   {
-    List protseqs = new ArrayList();
+    List protseqs = new ArrayList<>();
     protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
     protseqs.add(new Sequence("UNIPROT|V12346", "EIQ"));
     protseqs.add(new Sequence("UNIPROT|V12347", "SAR"));
     AlignmentI protein = new Alignment(protseqs.toArray(new SequenceI[3]));
     protein.setDataset(null);
 
-    List dnaseqs = new ArrayList();
+    List dnaseqs = new ArrayList<>();
     // start + SAR:
     dnaseqs.add(new Sequence("EMBL|A11111", "ATGTCAGCACGC"));
     // = EIQ + stop
@@ -697,14 +697,14 @@ public class AlignmentUtilsTests
   @Test(groups = { "Functional" })
   public void testMapProteinAlignmentToCdna_withXrefs() throws IOException
   {
-    List protseqs = new ArrayList();
+    List protseqs = new ArrayList<>();
     protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
     protseqs.add(new Sequence("UNIPROT|V12346", "EIQ"));
     protseqs.add(new Sequence("UNIPROT|V12347", "SAR"));
     AlignmentI protein = new Alignment(protseqs.toArray(new SequenceI[3]));
     protein.setDataset(null);
 
-    List dnaseqs = new ArrayList();
+    List dnaseqs = new ArrayList<>();
     dnaseqs.add(new Sequence("EMBL|A11111", "TCAGCACGC")); // = SAR
     dnaseqs.add(new Sequence("EMBL|A22222", "ATGGAGATACAA")); // = start + EIQ
     dnaseqs.add(new Sequence("EMBL|A33333", "GAAATCCAG")); // = EIQ
@@ -774,14 +774,14 @@ public class AlignmentUtilsTests
   public void testMapProteinAlignmentToCdna_prioritiseXrefs()
           throws IOException
   {
-    List protseqs = new ArrayList();
+    List protseqs = new ArrayList<>();
     protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
     protseqs.add(new Sequence("UNIPROT|V12346", "EIQ"));
     AlignmentI protein = new Alignment(
             protseqs.toArray(new SequenceI[protseqs.size()]));
     protein.setDataset(null);
 
-    List dnaseqs = new ArrayList();
+    List dnaseqs = new ArrayList<>();
     dnaseqs.add(new Sequence("EMBL|A11111", "GAAATCCAG")); // = EIQ
     dnaseqs.add(new Sequence("EMBL|A22222", "GAAATTCAG")); // = EIQ
     AlignmentI cdna = new Alignment(dnaseqs.toArray(new SequenceI[dnaseqs
@@ -848,8 +848,8 @@ public class AlignmentUtilsTests
     al.addAnnotation(ann4); // Temp for seq1
     al.addAnnotation(ann5); // Temp for seq2
     al.addAnnotation(ann6); // Temp for no sequence
-    List types = new ArrayList();
-    List scope = new ArrayList();
+    List types = new ArrayList<>();
+    List scope = new ArrayList<>();
 
     /*
      * Set all sequence related Structure to hidden (ann1, ann2)
@@ -1044,14 +1044,18 @@ public class AlignmentUtilsTests
     dna.addCodonFrame(acf);
 
     /*
-     * In this case, mappings originally came from matching Uniprot accessions - so need an xref on dna involving those regions. These are normally constructed from CDS annotation
+     * In this case, mappings originally came from matching Uniprot accessions 
+     * - so need an xref on dna involving those regions. 
+     * These are normally constructed from CDS annotation
      */
     DBRefEntry dna1xref = new DBRefEntry("UNIPROT", "ENSEMBL", "pep1",
             new Mapping(mapfordna1));
-    dna1.getDatasetSequence().addDBRef(dna1xref);
+    dna1.addDBRef(dna1xref);
+    assertEquals(2, dna1.getDBRefs().length); // to self and to pep1
     DBRefEntry dna2xref = new DBRefEntry("UNIPROT", "ENSEMBL", "pep2",
             new Mapping(mapfordna2));
-    dna2.getDatasetSequence().addDBRef(dna2xref);
+    dna2.addDBRef(dna2xref);
+    assertEquals(2, dna2.getDBRefs().length); // to self and to pep2
 
     /*
      * execute method under test:
@@ -1106,6 +1110,38 @@ public class AlignmentUtilsTests
     assertEquals(cdsMapping.getInverse(), dbref.getMap().getMap());
 
     /*
+     * verify cDNA has added a dbref with mapping to CDS
+     */
+    assertEquals(3, dna1.getDBRefs().length);
+    DBRefEntry dbRefEntry = dna1.getDBRefs()[2];
+    assertSame(cds1Dss, dbRefEntry.getMap().getTo());
+    MapList dnaToCdsMapping = new MapList(new int[] { 4, 6, 10, 12 },
+            new int[] { 1, 6 }, 1, 1);
+    assertEquals(dnaToCdsMapping, dbRefEntry.getMap().getMap());
+    assertEquals(3, dna2.getDBRefs().length);
+    dbRefEntry = dna2.getDBRefs()[2];
+    assertSame(cds2Dss, dbRefEntry.getMap().getTo());
+    dnaToCdsMapping = new MapList(new int[] { 1, 3, 7, 9, 13, 15 },
+            new int[] { 1, 9 }, 1, 1);
+    assertEquals(dnaToCdsMapping, dbRefEntry.getMap().getMap());
+
+    /*
+     * verify CDS has added a dbref with mapping to cDNA
+     */
+    assertEquals(2, cds1Dss.getDBRefs().length);
+    dbRefEntry = cds1Dss.getDBRefs()[1];
+    assertSame(dna1.getDatasetSequence(), dbRefEntry.getMap().getTo());
+    MapList cdsToDnaMapping = new MapList(new int[] { 1, 6 }, new int[] {
+        4, 6, 10, 12 }, 1, 1);
+    assertEquals(cdsToDnaMapping, dbRefEntry.getMap().getMap());
+    assertEquals(2, cds2Dss.getDBRefs().length);
+    dbRefEntry = cds2Dss.getDBRefs()[1];
+    assertSame(dna2.getDatasetSequence(), dbRefEntry.getMap().getTo());
+    cdsToDnaMapping = new MapList(new int[] { 1, 9 }, new int[] { 1, 3, 7,
+        9, 13, 15 }, 1, 1);
+    assertEquals(cdsToDnaMapping, dbRefEntry.getMap().getMap());
+
+    /*
      * Verify mappings from CDS to peptide, cDNA to CDS, and cDNA to peptide
      * the mappings are on the shared alignment dataset
      * 6 mappings, 2*(DNA->CDS), 2*(DNA->Pep), 2*(CDS->Pep) 
@@ -1747,7 +1783,7 @@ public class AlignmentUtilsTests
     map = new MapList(new int[] { 9, 11 }, new int[] { 2, 2 }, 3, 1);
     acf.addMap(dna3.getDatasetSequence(), prot3.getDatasetSequence(), map);
 
-    ArrayList acfs = new ArrayList();
+    ArrayList acfs = new ArrayList<>();
     acfs.add(acf);
     protein.setCodonFrames(acfs);
 
@@ -1896,6 +1932,7 @@ public class AlignmentUtilsTests
     sf6.setValue("alleles", "g, a"); // should force to upper-case
     sf6.setValue("ID", "sequence_variant:rs758803216");
     dna.addSequenceFeature(sf6);
+
     SequenceFeature sf7 = new SequenceFeature("sequence_variant", "", 15,
             15, 0f, null);
     sf7.setValue("alleles", "A, T");
@@ -1985,6 +2022,7 @@ public class AlignmentUtilsTests
      * variants:
      *           GAA -> E             source: Ensembl
      *           CAA -> Q             source: dbSNP
+     *           TAA -> STOP          source: dnSNP
      *           AAG synonymous       source: COSMIC
      *           AAT -> N             source: Ensembl
      *           ...TTC synonymous    source: dbSNP
@@ -2000,39 +2038,50 @@ public class AlignmentUtilsTests
     String ensembl = "Ensembl";
     String dbSnp = "dbSNP";
     String cosmic = "COSMIC";
+
     SequenceFeature sf1 = new SequenceFeature("sequence_variant", "", 1, 1,
             0f, ensembl);
-    sf1.setValue("alleles", "A,G"); // GAA -> E
+    sf1.setValue("alleles", "A,G"); // AAA -> GAA -> K/E
     sf1.setValue("ID", "var1.125A>G");
+
     SequenceFeature sf2 = new SequenceFeature("sequence_variant", "", 1, 1,
             0f, dbSnp);
-    sf2.setValue("alleles", "A,C"); // CAA -> Q
+    sf2.setValue("alleles", "A,C"); // AAA -> CAA -> K/Q
     sf2.setValue("ID", "var2");
     sf2.setValue("clinical_significance", "Dodgy");
-    SequenceFeature sf3 = new SequenceFeature("sequence_variant", "", 3, 3,
-            0f, cosmic);
-    sf3.setValue("alleles", "A,G"); // synonymous
+
+    SequenceFeature sf3 = new SequenceFeature("sequence_variant", "", 1, 1,
+            0f, dbSnp);
+    sf3.setValue("alleles", "A,T"); // AAA -> TAA -> stop codon
     sf3.setValue("ID", "var3");
-    sf3.setValue("clinical_significance", "None");
+    sf3.setValue("clinical_significance", "Bad");
+
     SequenceFeature sf4 = new SequenceFeature("sequence_variant", "", 3, 3,
+            0f, cosmic);
+    sf4.setValue("alleles", "A,G"); // AAA -> AAG synonymous
+    sf4.setValue("ID", "var4");
+    sf4.setValue("clinical_significance", "None");
+
+    SequenceFeature sf5 = new SequenceFeature("sequence_variant", "", 3, 3,
             0f, ensembl);
-    sf4.setValue("alleles", "A,T"); // AAT -> N
-    sf4.setValue("ID", "sequence_variant:var4"); // prefix gets stripped off
-    sf4.setValue("clinical_significance", "Benign");
-    SequenceFeature sf5 = new SequenceFeature("sequence_variant", "", 6, 6,
+    sf5.setValue("alleles", "A,T"); // AAA -> AAT -> K/N
+    sf5.setValue("ID", "sequence_variant:var5"); // prefix gets stripped off
+    sf5.setValue("clinical_significance", "Benign");
+
+    SequenceFeature sf6 = new SequenceFeature("sequence_variant", "", 6, 6,
             0f, dbSnp);
-    sf5.setValue("alleles", "T,C"); // synonymous
-    sf5.setValue("ID", "var5");
-    sf5.setValue("clinical_significance", "Bad");
-    SequenceFeature sf6 = new SequenceFeature("sequence_variant", "", 8, 8,
-            0f, cosmic);
-    sf6.setValue("alleles", "C,A,G"); // CAC,CGC -> H,R
+    sf6.setValue("alleles", "T,C"); // TTT -> TTC synonymous
     sf6.setValue("ID", "var6");
-    sf6.setValue("clinical_significance", "Good");
 
-    List codon1Variants = new ArrayList();
-    List codon2Variants = new ArrayList();
-    List codon3Variants = new ArrayList();
+    SequenceFeature sf7 = new SequenceFeature("sequence_variant", "", 8, 8,
+            0f, cosmic);
+    sf7.setValue("alleles", "C,A,G"); // CCC -> CAC,CGC -> P/H/R
+    sf7.setValue("ID", "var7");
+    sf7.setValue("clinical_significance", "Good");
+
+    List codon1Variants = new ArrayList<>();
+    List codon2Variants = new ArrayList<>();
+    List codon3Variants = new ArrayList<>();
     List codonVariants[] = new ArrayList[3];
     codonVariants[0] = codon1Variants;
     codonVariants[1] = codon2Variants;
@@ -2043,10 +2092,11 @@ public class AlignmentUtilsTests
      */
     codon1Variants.add(new DnaVariant("A", sf1));
     codon1Variants.add(new DnaVariant("A", sf2));
+    codon1Variants.add(new DnaVariant("A", sf3));
     codon2Variants.add(new DnaVariant("A"));
-    codon2Variants.add(new DnaVariant("A"));
-    codon3Variants.add(new DnaVariant("A", sf3));
+    // codon2Variants.add(new DnaVariant("A"));
     codon3Variants.add(new DnaVariant("A", sf4));
+    codon3Variants.add(new DnaVariant("A", sf5));
     AlignmentUtils.computePeptideVariants(peptide, 1, codonVariants);
 
     /*
@@ -2057,7 +2107,7 @@ public class AlignmentUtilsTests
     codon3Variants.clear();
     codon1Variants.add(new DnaVariant("T"));
     codon2Variants.add(new DnaVariant("T"));
-    codon3Variants.add(new DnaVariant("T", sf5));
+    codon3Variants.add(new DnaVariant("T", sf6));
     AlignmentUtils.computePeptideVariants(peptide, 2, codonVariants);
 
     /*
@@ -2067,7 +2117,7 @@ public class AlignmentUtilsTests
     codon2Variants.clear();
     codon3Variants.clear();
     codon1Variants.add(new DnaVariant("C"));
-    codon2Variants.add(new DnaVariant("C", sf6));
+    codon2Variants.add(new DnaVariant("C", sf7));
     codon3Variants.add(new DnaVariant("C"));
     AlignmentUtils.computePeptideVariants(peptide, 3, codonVariants);
 
@@ -2075,35 +2125,43 @@ public class AlignmentUtilsTests
      * verify added sequence features for
      * var1 K -> E Ensembl
      * var2 K -> Q dbSNP
-     * var4 K -> N Ensembl
-     * var6 P -> H COSMIC
-     * var6 P -> R COSMIC
+     * var3 K -> stop
+     * var4 synonymous
+     * var5 K -> N Ensembl
+     * var6 synonymous
+     * var7 P -> H COSMIC
+     * var8 P -> R COSMIC
      */
     List sfs = peptide.getSequenceFeatures();
     SequenceFeatures.sortFeatures(sfs, true);
-    assertEquals(5, sfs.size());
+    assertEquals(8, sfs.size());
 
     /*
      * features are sorted by start position ascending, but in no
      * particular order where start positions match; asserts here
      * simply match the data returned (the order is not important)
      */
+    // AAA -> AAT -> K/N
     SequenceFeature sf = sfs.get(0);
     assertEquals(1, sf.getBegin());
     assertEquals(1, sf.getEnd());
+    assertEquals("nonsynonymous_variant", sf.getType());
     assertEquals("p.Lys1Asn", sf.getDescription());
-    assertEquals("var4", sf.getValue("ID"));
+    assertEquals("var5", sf.getValue("ID"));
     assertEquals("Benign", sf.getValue("clinical_significance"));
-    assertEquals("ID=var4;clinical_significance=Benign", sf.getAttributes());
+    assertEquals("ID=var5;clinical_significance=Benign",
+            sf.getAttributes());
     assertEquals(1, sf.links.size());
     assertEquals(
-            "p.Lys1Asn var4|http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=var4",
+            "p.Lys1Asn var5|http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=var5",
             sf.links.get(0));
     assertEquals(ensembl, sf.getFeatureGroup());
 
+    // AAA -> CAA -> K/Q
     sf = sfs.get(1);
     assertEquals(1, sf.getBegin());
     assertEquals(1, sf.getEnd());
+    assertEquals("nonsynonymous_variant", sf.getType());
     assertEquals("p.Lys1Gln", sf.getDescription());
     assertEquals("var2", sf.getValue("ID"));
     assertEquals("Dodgy", sf.getValue("clinical_significance"));
@@ -2114,9 +2172,11 @@ public class AlignmentUtilsTests
             sf.links.get(0));
     assertEquals(dbSnp, sf.getFeatureGroup());
 
+    // AAA -> GAA -> K/E
     sf = sfs.get(2);
     assertEquals(1, sf.getBegin());
     assertEquals(1, sf.getEnd());
+    assertEquals("nonsynonymous_variant", sf.getType());
     assertEquals("p.Lys1Glu", sf.getDescription());
     assertEquals("var1.125A>G", sf.getValue("ID"));
     assertNull(sf.getValue("clinical_significance"));
@@ -2128,30 +2188,79 @@ public class AlignmentUtilsTests
             sf.links.get(0));
     assertEquals(ensembl, sf.getFeatureGroup());
 
+    // AAA -> TAA -> stop codon
     sf = sfs.get(3);
+    assertEquals(1, sf.getBegin());
+    assertEquals(1, sf.getEnd());
+    assertEquals("stop_gained", sf.getType());
+    assertEquals("TAA", sf.getDescription());
+    assertEquals("var3", sf.getValue("ID"));
+    assertEquals("Bad", sf.getValue("clinical_significance"));
+    assertEquals("ID=var3;clinical_significance=Bad", sf.getAttributes());
+    assertEquals(1, sf.links.size());
+    assertEquals(
+            "TAA var3|http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=var3",
+            sf.links.get(0));
+    assertEquals(dbSnp, sf.getFeatureGroup());
+
+    // AAA -> AAG synonymous
+    sf = sfs.get(4);
+    assertEquals(1, sf.getBegin());
+    assertEquals(1, sf.getEnd());
+    assertEquals("synonymous_variant", sf.getType());
+    assertEquals("AAG", sf.getDescription());
+    assertEquals("var4", sf.getValue("ID"));
+    assertEquals("None", sf.getValue("clinical_significance"));
+    assertEquals("ID=var4;clinical_significance=None", sf.getAttributes());
+    assertEquals(1, sf.links.size());
+    assertEquals(
+            "AAG var4|http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=var4",
+            sf.links.get(0));
+    assertEquals(cosmic, sf.getFeatureGroup());
+
+    // TTT -> TTC synonymous
+    sf = sfs.get(5);
+    assertEquals(2, sf.getBegin());
+    assertEquals(2, sf.getEnd());
+    assertEquals("synonymous_variant", sf.getType());
+    assertEquals("TTC", sf.getDescription());
+    assertEquals("var6", sf.getValue("ID"));
+    assertNull(sf.getValue("clinical_significance"));
+    assertEquals("ID=var6", sf.getAttributes());
+    assertEquals(1, sf.links.size());
+    assertEquals(
+            "TTC var6|http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=var6",
+            sf.links.get(0));
+    assertEquals(dbSnp, sf.getFeatureGroup());
+
+    // var7 generates two distinct protein variant features (two alleles)
+    // CCC -> CGC -> P/R
+    sf = sfs.get(6);
     assertEquals(3, sf.getBegin());
     assertEquals(3, sf.getEnd());
+    assertEquals("nonsynonymous_variant", sf.getType());
     assertEquals("p.Pro3Arg", sf.getDescription());
-    assertEquals("var6", sf.getValue("ID"));
+    assertEquals("var7", sf.getValue("ID"));
     assertEquals("Good", sf.getValue("clinical_significance"));
-    assertEquals("ID=var6;clinical_significance=Good", sf.getAttributes());
+    assertEquals("ID=var7;clinical_significance=Good", sf.getAttributes());
     assertEquals(1, sf.links.size());
     assertEquals(
-            "p.Pro3Arg var6|http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=var6",
+            "p.Pro3Arg var7|http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=var7",
             sf.links.get(0));
     assertEquals(cosmic, sf.getFeatureGroup());
 
-    // var5 generates two distinct protein variant features
-    sf = sfs.get(4);
+    // CCC -> CAC -> P/H
+    sf = sfs.get(7);
     assertEquals(3, sf.getBegin());
     assertEquals(3, sf.getEnd());
+    assertEquals("nonsynonymous_variant", sf.getType());
     assertEquals("p.Pro3His", sf.getDescription());
-    assertEquals("var6", sf.getValue("ID"));
+    assertEquals("var7", sf.getValue("ID"));
     assertEquals("Good", sf.getValue("clinical_significance"));
-    assertEquals("ID=var6;clinical_significance=Good", sf.getAttributes());
+    assertEquals("ID=var7;clinical_significance=Good", sf.getAttributes());
     assertEquals(1, sf.links.size());
     assertEquals(
-            "p.Pro3His var6|http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=var6",
+            "p.Pro3His var7|http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=var7",
             sf.links.get(0));
     assertEquals(cosmic, sf.getFeatureGroup());
   }
@@ -2272,7 +2381,7 @@ public class AlignmentUtilsTests
     seq1.createDatasetSequence();
     Mapping mapping = new Mapping(seq1, new MapList(
             new int[] { 3, 6, 9, 10 }, new int[] { 1, 6 }, 1, 1));
-    Map> map = new TreeMap>();
+    Map> map = new TreeMap<>();
     AlignmentUtils.addMappedPositions(seq1, from, mapping, map);
 
     /*
@@ -2304,7 +2413,7 @@ public class AlignmentUtilsTests
     seq1.createDatasetSequence();
     Mapping mapping = new Mapping(seq1, new MapList(
             new int[] { 3, 6, 9, 10 }, new int[] { 1, 6 }, 1, 1));
-    Map> map = new TreeMap>();
+    Map> map = new TreeMap<>();
     AlignmentUtils.addMappedPositions(seq1, from, mapping, map);
 
     /*
@@ -2533,6 +2642,70 @@ public class AlignmentUtilsTests
     assertEquals(s_as3, uas3.getSequenceAsString());
   }
 
+  @Test(groups = { "Functional" })
+  public void testTransferGeneLoci()
+  {
+    SequenceI from = new Sequence("transcript",
+            "aaacccgggTTTAAACCCGGGtttaaacccgggttt");
+    SequenceI to = new Sequence("CDS", "TTTAAACCCGGG");
+    MapList map = new MapList(new int[] { 1, 12 }, new int[] { 10, 21 }, 1,
+            1);
+
+    /*
+     * first with nothing to transfer
+     */
+    AlignmentUtils.transferGeneLoci(from, map, to);
+    assertNull(to.getGeneLoci());
+
+    /*
+     * next with gene loci set on 'from' sequence
+     */
+    int[] exons = new int[] { 100, 105, 155, 164, 210, 229 };
+    MapList geneMap = new MapList(new int[] { 1, 36 }, exons, 1, 1);
+    from.setGeneLoci("human", "GRCh38", "7", geneMap);
+    AlignmentUtils.transferGeneLoci(from, map, to);
+
+    GeneLociI toLoci = to.getGeneLoci();
+    assertNotNull(toLoci);
+    // DBRefEntry constructor upper-cases 'source'
+    assertEquals("HUMAN", toLoci.getSpeciesId());
+    assertEquals("GRCh38", toLoci.getAssemblyId());
+    assertEquals("7", toLoci.getChromosomeId());
+
+    /*
+     * transcript 'exons' are 1-6, 7-16, 17-36
+     * CDS 1:12 is transcript 10-21
+     * transcript 'CDS' is 10-16, 17-21
+     * which is 'gene' 158-164, 210-214
+     */
+    MapList toMap = toLoci.getMap();
+    assertEquals(1, toMap.getFromRanges().size());
+    assertEquals(2, toMap.getFromRanges().get(0).length);
+    assertEquals(1, toMap.getFromRanges().get(0)[0]);
+    assertEquals(12, toMap.getFromRanges().get(0)[1]);
+    assertEquals(1, toMap.getToRanges().size());
+    assertEquals(4, toMap.getToRanges().get(0).length);
+    assertEquals(158, toMap.getToRanges().get(0)[0]);
+    assertEquals(164, toMap.getToRanges().get(0)[1]);
+    assertEquals(210, toMap.getToRanges().get(0)[2]);
+    assertEquals(214, toMap.getToRanges().get(0)[3]);
+    // or summarised as (but toString might change in future):
+    assertEquals("[ [1, 12] ] 1:1 to [ [158, 164, 210, 214] ]",
+            toMap.toString());
+
+    /*
+     * an existing value is not overridden 
+     */
+    geneMap = new MapList(new int[] { 1, 36 }, new int[] { 36, 1 }, 1, 1);
+    from.setGeneLoci("inhuman", "GRCh37", "6", geneMap);
+    AlignmentUtils.transferGeneLoci(from, map, to);
+    assertEquals("GRCh38", toLoci.getAssemblyId());
+    assertEquals("7", toLoci.getChromosomeId());
+    toMap = toLoci.getMap();
+    assertEquals("[ [1, 12] ] 1:1 to [ [158, 164, 210, 214] ]",
+            toMap.toString());
+  }
+
   /**
    * Tests for the method that maps nucleotide to protein based on CDS features
    */
@@ -2599,5 +2772,4 @@ public class AlignmentUtilsTests
     assertEquals("[[3, 3], [8, 12]]",
             Arrays.deepToString(ml.getFromRanges().toArray()));
   }
-
 }
diff --git a/test/jalview/controller/AlignViewControllerTest.java b/test/jalview/controller/AlignViewControllerTest.java
index 2e89b0e..efee93b 100644
--- a/test/jalview/controller/AlignViewControllerTest.java
+++ b/test/jalview/controller/AlignViewControllerTest.java
@@ -25,6 +25,8 @@ import static org.testng.AssertJUnit.assertTrue;
 
 import jalview.analysis.Finder;
 import jalview.api.AlignViewControllerI;
+import jalview.api.FeatureColourI;
+import jalview.datamodel.Alignment;
 import jalview.datamodel.SearchResults;
 import jalview.datamodel.SearchResultsI;
 import jalview.datamodel.Sequence;
@@ -35,7 +37,9 @@ import jalview.gui.AlignFrame;
 import jalview.gui.JvOptionPane;
 import jalview.io.DataSourceType;
 import jalview.io.FileLoader;
+import jalview.schemes.FeatureColour;
 
+import java.awt.Color;
 import java.util.Arrays;
 import java.util.BitSet;
 
@@ -67,13 +71,14 @@ public class AlignViewControllerTest
             null));
     seq1.addSequenceFeature(new SequenceFeature("Helix", "desc", 1, 15, 0f,
             null));
-    seq2.addSequenceFeature(new SequenceFeature("Metal", "desc", 4, 10, 0f,
+    seq2.addSequenceFeature(new SequenceFeature("Metal", "desc", 4, 10,
+            10f,
             null));
     seq3.addSequenceFeature(new SequenceFeature("Metal", "desc", 11, 15,
-            0f, null));
+            10f, null));
     // disulfide bond is a 'contact feature' - only select its 'start' and 'end'
-    seq3.addSequenceFeature(new SequenceFeature("disulfide bond", "desc", 8, 12,
-            0f, null));
+    seq3.addSequenceFeature(new SequenceFeature("disulfide bond", "desc",
+            8, 12, 0f, null));
 
     /*
      * select the first five columns --> Metal in seq1 cols 4-5
@@ -86,9 +91,18 @@ public class AlignViewControllerTest
     sg.addSequence(seq3, false);
     sg.addSequence(seq4, false);
 
+    /*
+     * set features visible on a viewport as only visible features are selected
+     */
+    AlignFrame af = new AlignFrame(new Alignment(new SequenceI[] { seq1,
+        seq2, seq3, seq4 }), 100, 100);
+    af.getFeatureRenderer().findAllFeatures(true);
+
+    AlignViewController avc = new AlignViewController(af, af.getViewport(),
+            af.alignPanel);
+
     BitSet bs = new BitSet();
-    int seqCount = AlignViewController.findColumnsWithFeature("Metal", sg,
-            bs);
+    int seqCount = avc.findColumnsWithFeature("Metal", sg, bs);
     assertEquals(1, seqCount);
     assertEquals(2, bs.cardinality());
     assertTrue(bs.get(3)); // base 0
@@ -99,7 +113,7 @@ public class AlignViewControllerTest
      */
     sg.setEndRes(6);
     bs.clear();
-    seqCount = AlignViewController.findColumnsWithFeature("Metal", sg, bs);
+    seqCount = avc.findColumnsWithFeature("Metal", sg, bs);
     assertEquals(2, seqCount);
     assertEquals(4, bs.cardinality());
     assertTrue(bs.get(3));
@@ -113,7 +127,7 @@ public class AlignViewControllerTest
     sg.setStartRes(13);
     sg.setEndRes(13);
     bs.clear();
-    seqCount = AlignViewController.findColumnsWithFeature("Metal", sg, bs);
+    seqCount = avc.findColumnsWithFeature("Metal", sg, bs);
     assertEquals(1, seqCount);
     assertEquals(1, bs.cardinality());
     assertTrue(bs.get(13));
@@ -124,18 +138,35 @@ public class AlignViewControllerTest
     sg.setStartRes(17);
     sg.setEndRes(19);
     bs.clear();
-    seqCount = AlignViewController.findColumnsWithFeature("Metal", sg, bs);
+    seqCount = avc.findColumnsWithFeature("Metal", sg, bs);
     assertEquals(0, seqCount);
     assertEquals(0, bs.cardinality());
 
     /*
+     * threshold Metal to hide where score < 5
+     * seq1 feature in columns 4-6 is hidden
+     * seq2 feature in columns 6-7 is shown
+     */
+    FeatureColourI fc = new FeatureColour(Color.red, Color.blue, 0f, 10f);
+    fc.setAboveThreshold(true);
+    fc.setThreshold(5f);
+    af.getFeatureRenderer().setColour("Metal", fc);
+    sg.setStartRes(0);
+    sg.setEndRes(6);
+    bs.clear();
+    seqCount = avc.findColumnsWithFeature("Metal", sg, bs);
+    assertEquals(1, seqCount);
+    assertEquals(2, bs.cardinality());
+    assertTrue(bs.get(5));
+    assertTrue(bs.get(6));
+
+    /*
      * columns 11-13 should not match disulfide bond at 8/12
      */
     sg.setStartRes(10);
     sg.setEndRes(12);
     bs.clear();
-    seqCount = AlignViewController.findColumnsWithFeature("disulfide bond",
-            sg, bs);
+    seqCount = avc.findColumnsWithFeature("disulfide bond", sg, bs);
     assertEquals(0, seqCount);
     assertEquals(0, bs.cardinality());
 
@@ -145,8 +176,7 @@ public class AlignViewControllerTest
     sg.setStartRes(5);
     sg.setEndRes(17);
     bs.clear();
-    seqCount = AlignViewController.findColumnsWithFeature("disulfide bond",
-            sg, bs);
+    seqCount = avc.findColumnsWithFeature("disulfide bond", sg, bs);
     assertEquals(1, seqCount);
     assertEquals(2, bs.cardinality());
     assertTrue(bs.get(8));
@@ -158,7 +188,7 @@ public class AlignViewControllerTest
     sg.setStartRes(0);
     sg.setEndRes(19);
     bs.clear();
-    seqCount = AlignViewController.findColumnsWithFeature("Pfam", sg, bs);
+    seqCount = avc.findColumnsWithFeature("Pfam", sg, bs);
     assertEquals(0, seqCount);
     assertEquals(0, bs.cardinality());
   }
diff --git a/test/jalview/datamodel/SequenceFeatureTest.java b/test/jalview/datamodel/SequenceFeatureTest.java
index fbeb365..c955979 100644
--- a/test/jalview/datamodel/SequenceFeatureTest.java
+++ b/test/jalview/datamodel/SequenceFeatureTest.java
@@ -273,4 +273,47 @@ public class SequenceFeatureTest
             "group");
     assertTrue(sf.isContactFeature());
   }
+
+  @Test(groups = { "Functional" })
+  public void testGetDetailsReport()
+  {
+    // single locus, no group, no score
+    SequenceFeature sf = new SequenceFeature("variant", "G,C", 22, 22, null);
+    String expected = "
"
+            + ""
+            + "Type variant 
Start/end 22 
Description G,C ";
+    assertEquals(expected, sf.getDetailsReport());
+
+    // contact feature
+    sf = new SequenceFeature("Disulphide Bond", "a description", 28, 31,
+            null);
+    expected = "
"
+            + ""
+            + "Type Disulphide Bond 
Start/end 28:31 
Description a description ";
+    assertEquals(expected, sf.getDetailsReport());
+
+    sf = new SequenceFeature("variant", "G,C", 22, 33,
+            12.5f, "group");
+    sf.setValue("Parent", "ENSG001");
+    sf.setValue("Child", "ENSP002");
+    expected = "
"
+            + ""
+            + ""
+            + ""
+            + ""
+            + ""
+            + "Type variant 
Start/end 22-33 
Description G,C 
Score 12.5 
Group group 
Child ENSP002
Parent ENSG001";
+    assertEquals(expected, sf.getDetailsReport());
+
+    /*
+     * feature with embedded html link in description
+     */
+    String desc = "Fer2 Status: True Positive Pfam 8_8";
+    sf = new SequenceFeature("Pfam", desc, 8, 83, "Uniprot");
+    expected = "
"
+            + ""
+            + ""
+            + "Type Pfam 
Start/end 8-83 
Description Fer2 Status: True Positive Pfam 8_8 
Group Uniprot ";
+    assertEquals(expected, sf.getDetailsReport());
+  }
 }
diff --git a/test/jalview/datamodel/features/FeatureAttributesTest.java b/test/jalview/datamodel/features/FeatureAttributesTest.java
new file mode 100644
index 0000000..e47c787
--- /dev/null
+++ b/test/jalview/datamodel/features/FeatureAttributesTest.java
@@ -0,0 +1,131 @@
+package jalview.datamodel.features;
+
+import static org.testng.Assert.assertEquals;
+import static org.testng.Assert.assertNull;
+import static org.testng.Assert.assertTrue;
+
+import jalview.datamodel.SequenceFeature;
+import jalview.datamodel.features.FeatureAttributes.Datatype;
+
+import java.util.Comparator;
+import java.util.HashMap;
+import java.util.Map;
+
+import org.testng.annotations.AfterMethod;
+import org.testng.annotations.BeforeClass;
+import org.testng.annotations.Test;
+
+import junit.extensions.PA;
+
+public class FeatureAttributesTest
+{
+
+  /**
+   * clear down attributes map before tests
+   */
+  @BeforeClass
+  public void setUp()
+  {
+    FeatureAttributes fa = FeatureAttributes.getInstance();
+    ((Map) PA.getValue(fa, "attributes")).clear();
+  }
+
+  /**
+   * clear down attributes map after tests
+   */
+  @AfterMethod
+  public void tearDown()
+  {
+    FeatureAttributes fa = FeatureAttributes.getInstance();
+    ((Map) PA.getValue(fa, "attributes")).clear();
+  }
+
+  /**
+   * Test the method that keeps attribute names in non-case-sensitive order,
+   * including handling of 'compound' names
+   */
+  @Test(groups="Functional")
+  public void testAttributeNameComparator()
+  {
+    FeatureAttributes fa = FeatureAttributes.getInstance();
+    Comparator comp = (Comparator) PA.getValue(fa,
+            "comparator");
+
+    assertEquals(
+            comp.compare(new String[] { "CSQ" }, new String[] { "csq" }), 0);
+
+    assertTrue(comp.compare(new String[] { "CSQ", "a" },
+            new String[] { "csq" }) > 0);
+
+    assertTrue(comp.compare(new String[] { "CSQ" }, new String[] { "csq",
+        "b" }) < 0);
+
+    assertTrue(comp.compare(new String[] { "CSQ", "AF" }, new String[] {
+        "csq", "ac" }) > 0);
+
+    assertTrue(comp.compare(new String[] { "CSQ", "ac" }, new String[] {
+        "csq", "AF" }) < 0);
+  }
+
+  @Test(groups = "Functional")
+  public void testGetMinMax()
+  {
+    SequenceFeature sf = new SequenceFeature("Pfam", "desc", 10, 20,
+            "group");
+    FeatureAttributes fa = FeatureAttributes.getInstance();
+    assertNull(fa.getMinMax("Pfam", "kd"));
+    sf.setValue("domain", "xyz");
+    assertNull(fa.getMinMax("Pfam", "kd"));
+    sf.setValue("kd", "some text");
+    assertNull(fa.getMinMax("Pfam", "kd"));
+    sf.setValue("kd", "1.3");
+    assertEquals(fa.getMinMax("Pfam", "kd"), new float[] { 1.3f, 1.3f });
+    sf.setValue("kd", "-2.6");
+    assertEquals(fa.getMinMax("Pfam", "kd"), new float[] { -2.6f, 1.3f });
+    Map csq = new HashMap<>();
+    csq.put("AF", "-3");
+    sf.setValue("CSQ", csq);
+    assertEquals(fa.getMinMax("Pfam", "CSQ", "AF"),
+            new float[]
+            { -3f, -3f });
+    csq.put("AF", "4");
+    sf.setValue("CSQ", csq);
+    assertEquals(fa.getMinMax("Pfam", "CSQ", "AF"),
+            new float[]
+            { -3f, 4f });
+  }
+
+  /**
+   * Test the method that returns an attribute description, provided it is
+   * recorded and unique
+   */
+  @Test(groups = "Functional")
+  public void testGetDescription()
+  {
+    FeatureAttributes fa = FeatureAttributes.getInstance();
+    // with no description returns null
+    assertNull(fa.getDescription("Pfam", "kd"));
+    // with a unique description, returns that value
+    fa.addDescription("Pfam", "desc1", "kd");
+    assertEquals(fa.getDescription("Pfam", "kd"), "desc1");
+    // with ambiguous description, returns null
+    fa.addDescription("Pfam", "desc2", "kd");
+    assertNull(fa.getDescription("Pfam", "kd"));
+  }
+
+  @Test(groups = "Functional")
+  public void testDatatype()
+  {
+    FeatureAttributes fa = FeatureAttributes.getInstance();
+    assertNull(fa.getDatatype("Pfam", "kd"));
+    SequenceFeature sf = new SequenceFeature("Pfam", "desc", 10, 20,
+            "group");
+    sf.setValue("kd", "-1");
+    sf.setValue("domain", "Metal");
+    sf.setValue("phase", "1");
+    sf.setValue("phase", "reverse");
+    assertEquals(fa.getDatatype("Pfam", "kd"), Datatype.Number);
+    assertEquals(fa.getDatatype("Pfam", "domain"), Datatype.Character);
+    assertEquals(fa.getDatatype("Pfam", "phase"), Datatype.Mixed);
+  }
+}
diff --git a/test/jalview/datamodel/features/FeatureMatcherSetTest.java b/test/jalview/datamodel/features/FeatureMatcherSetTest.java
new file mode 100644
index 0000000..a2d2c9a
--- /dev/null
+++ b/test/jalview/datamodel/features/FeatureMatcherSetTest.java
@@ -0,0 +1,419 @@
+package jalview.datamodel.features;
+
+import static org.testng.Assert.assertEquals;
+import static org.testng.Assert.assertFalse;
+import static org.testng.Assert.assertNull;
+import static org.testng.Assert.assertSame;
+import static org.testng.Assert.assertTrue;
+import static org.testng.Assert.fail;
+
+import jalview.datamodel.SequenceFeature;
+import jalview.util.matcher.Condition;
+
+import java.util.HashMap;
+import java.util.Iterator;
+import java.util.Locale;
+import java.util.Map;
+
+import org.testng.annotations.Test;
+
+public class FeatureMatcherSetTest
+{
+  @Test(groups = "Functional")
+  public void testMatches_byAttribute()
+  {
+    /*
+     * a numeric matcher - MatcherTest covers more conditions
+     */
+    FeatureMatcherI fm = FeatureMatcher.byAttribute(Condition.GE, "-2",
+            "AF");
+    FeatureMatcherSetI fms = new FeatureMatcherSet();
+    fms.and(fm);
+    SequenceFeature sf = new SequenceFeature("Cath", "desc", 11, 12, "grp");
+    assertFalse(fms.matches(sf));
+    sf.setValue("AF", "foobar");
+    assertFalse(fms.matches(sf));
+    sf.setValue("AF", "-2");
+    assertTrue(fms.matches(sf));
+    sf.setValue("AF", "-1");
+    assertTrue(fms.matches(sf));
+    sf.setValue("AF", "-3");
+    assertFalse(fms.matches(sf));
+    sf.setValue("AF", "");
+    assertFalse(fms.matches(sf));
+
+    /*
+     * a string pattern matcher
+     */
+    fm = FeatureMatcher.byAttribute(Condition.Contains, "Cat", "AF");
+    fms = new FeatureMatcherSet();
+    fms.and(fm);
+    assertFalse(fms.matches(sf));
+    sf.setValue("AF", "raining cats and dogs");
+    assertTrue(fms.matches(sf));
+  }
+
+  @Test(groups = "Functional")
+  public void testAnd()
+  {
+    // condition1: AF value contains "dog" (matches)
+    FeatureMatcherI fm1 = FeatureMatcher.byAttribute(Condition.Contains,
+            "dog", "AF");
+    // condition 2: CSQ value does not contain "how" (does not match)
+    FeatureMatcherI fm2 = FeatureMatcher.byAttribute(Condition.NotContains,
+            "how", "CSQ");
+
+    SequenceFeature sf = new SequenceFeature("Cath", "helix domain", 11, 12,
+            6.2f, "grp");
+    sf.setValue("AF", "raining cats and dogs");
+    sf.setValue("CSQ", "showers");
+
+    assertTrue(fm1.matches(sf));
+    assertFalse(fm2.matches(sf));
+
+    FeatureMatcherSetI fms = new FeatureMatcherSet();
+    assertTrue(fms.matches(sf)); // if no conditions, then 'all' pass
+    fms.and(fm1);
+    assertTrue(fms.matches(sf));
+    fms.and(fm2);
+    assertFalse(fms.matches(sf));
+
+    /*
+     * OR a failed attribute condition with a matched label condition
+     */
+    fms = new FeatureMatcherSet();
+    fms.and(fm2);
+    assertFalse(fms.matches(sf));
+    FeatureMatcher byLabelPass = FeatureMatcher.byLabel(Condition.Contains,
+            "Helix");
+    fms.or(byLabelPass);
+    assertTrue(fms.matches(sf));
+
+    /*
+     * OR a failed attribute condition with a failed score condition
+     */
+    fms = new FeatureMatcherSet();
+    fms.and(fm2);
+    assertFalse(fms.matches(sf));
+    FeatureMatcher byScoreFail = FeatureMatcher.byScore(Condition.LT,
+            "5.9");
+    fms.or(byScoreFail);
+    assertFalse(fms.matches(sf));
+
+    /*
+     * OR failed attribute and score conditions with matched label condition
+     */
+    fms = new FeatureMatcherSet();
+    fms.or(fm2);
+    fms.or(byScoreFail);
+    assertFalse(fms.matches(sf));
+    fms.or(byLabelPass);
+    assertTrue(fms.matches(sf));
+  }
+
+  @Test(groups = "Functional")
+  public void testToString()
+  {
+    Locale.setDefault(Locale.ENGLISH);
+    FeatureMatcherI fm1 = FeatureMatcher.byAttribute(Condition.LT, "1.2",
+            "AF");
+    assertEquals(fm1.toString(), "AF < 1.2");
+
+    FeatureMatcher fm2 = FeatureMatcher.byAttribute(Condition.NotContains,
+            "path", "CLIN_SIG");
+    assertEquals(fm2.toString(), "CLIN_SIG does not contain 'path'");
+
+    /*
+     * AND them
+     */
+    FeatureMatcherSetI fms = new FeatureMatcherSet();
+    assertEquals(fms.toString(), "");
+    fms.and(fm1);
+    assertEquals(fms.toString(), "AF < 1.2");
+    fms.and(fm2);
+    assertEquals(fms.toString(),
+            "(AF < 1.2) and (CLIN_SIG does not contain 'path')");
+
+    /*
+     * OR them
+     */
+    fms = new FeatureMatcherSet();
+    assertEquals(fms.toString(), "");
+    fms.or(fm1);
+    assertEquals(fms.toString(), "AF < 1.2");
+    fms.or(fm2);
+    assertEquals(fms.toString(),
+            "(AF < 1.2) or (CLIN_SIG does not contain 'path')");
+
+    try
+    {
+      fms.and(fm1);
+      fail("Expected exception");
+    } catch (IllegalStateException e)
+    {
+      // expected
+    }
+  }
+
+  @Test(groups = "Functional")
+  public void testOr()
+  {
+    // condition1: AF value contains "dog" (matches)
+    FeatureMatcherI fm1 = FeatureMatcher.byAttribute(Condition.Contains,
+            "dog", "AF");
+    // condition 2: CSQ value does not contain "how" (does not match)
+    FeatureMatcherI fm2 = FeatureMatcher.byAttribute(Condition.NotContains,
+            "how", "CSQ");
+
+    SequenceFeature sf = new SequenceFeature("Cath", "desc", 11, 12, "grp");
+    sf.setValue("AF", "raining cats and dogs");
+    sf.setValue("CSQ", "showers");
+
+    assertTrue(fm1.matches(sf));
+    assertFalse(fm2.matches(sf));
+
+    FeatureMatcherSetI fms = new FeatureMatcherSet();
+    assertTrue(fms.matches(sf)); // if no conditions, then 'all' pass
+    fms.or(fm1);
+    assertTrue(fms.matches(sf));
+    fms.or(fm2);
+    assertTrue(fms.matches(sf)); // true or false makes true
+
+    fms = new FeatureMatcherSet();
+    fms.or(fm2);
+    assertFalse(fms.matches(sf));
+    fms.or(fm1);
+    assertTrue(fms.matches(sf)); // false or true makes true
+
+    try
+    {
+      fms.and(fm2);
+      fail("Expected exception");
+    } catch (IllegalStateException e)
+    {
+      // expected
+    }
+  }
+
+  @Test(groups = "Functional")
+  public void testIsEmpty()
+  {
+    FeatureMatcherI fm = FeatureMatcher.byAttribute(Condition.GE, "-2.0",
+            "AF");
+    FeatureMatcherSetI fms = new FeatureMatcherSet();
+    assertTrue(fms.isEmpty());
+    fms.and(fm);
+    assertFalse(fms.isEmpty());
+  }
+
+  @Test(groups = "Functional")
+  public void testGetMatchers()
+  {
+    FeatureMatcherSetI fms = new FeatureMatcherSet();
+
+    /*
+     * empty iterable:
+     */
+    Iterator iterator = fms.getMatchers().iterator();
+    assertFalse(iterator.hasNext());
+
+    /*
+     * one matcher:
+     */
+    FeatureMatcherI fm1 = FeatureMatcher.byAttribute(Condition.GE, "-2",
+            "AF");
+    fms.and(fm1);
+    iterator = fms.getMatchers().iterator();
+    assertSame(fm1, iterator.next());
+    assertFalse(iterator.hasNext());
+
+    /*
+     * two matchers:
+     */
+    FeatureMatcherI fm2 = FeatureMatcher.byAttribute(Condition.LT, "8f",
+            "AF");
+    fms.and(fm2);
+    iterator = fms.getMatchers().iterator();
+    assertSame(fm1, iterator.next());
+    assertSame(fm2, iterator.next());
+    assertFalse(iterator.hasNext());
+  }
+
+  /**
+   * Tests for the 'compound attribute' key i.e. where first key's value is a map
+   * from which we take the value for the second key, e.g. CSQ : Consequence
+   */
+  @Test(groups = "Functional")
+  public void testMatches_compoundKey()
+  {
+    /*
+     * a numeric matcher - MatcherTest covers more conditions
+     */
+    FeatureMatcherI fm = FeatureMatcher.byAttribute(Condition.GE, "-2",
+            "CSQ", "Consequence");
+    SequenceFeature sf = new SequenceFeature("Cath", "desc", 2, 10, "grp");
+    FeatureMatcherSetI fms = new FeatureMatcherSet();
+    fms.and(fm);
+    assertFalse(fms.matches(sf));
+    Map csq = new HashMap<>();
+    sf.setValue("CSQ", csq);
+    assertFalse(fms.matches(sf));
+    csq.put("Consequence", "-2");
+    assertTrue(fms.matches(sf));
+    csq.put("Consequence", "-1");
+    assertTrue(fms.matches(sf));
+    csq.put("Consequence", "-3");
+    assertFalse(fms.matches(sf));
+    csq.put("Consequence", "");
+    assertFalse(fms.matches(sf));
+    csq.put("Consequence", "junk");
+    assertFalse(fms.matches(sf));
+
+    /*
+     * a string pattern matcher
+     */
+    fm = FeatureMatcher.byAttribute(Condition.Contains, "Cat", "CSQ",
+            "Consequence");
+    fms = new FeatureMatcherSet();
+    fms.and(fm);
+    assertFalse(fms.matches(sf));
+    csq.put("PolyPhen", "damaging");
+    assertFalse(fms.matches(sf));
+    csq.put("Consequence", "damaging");
+    assertFalse(fms.matches(sf));
+    csq.put("Consequence", "Catastrophic");
+    assertTrue(fms.matches(sf));
+  }
+
+  /**
+   * Tests for toStableString which (unlike toString) does not i18n the
+   * conditions
+   * 
+   * @see FeatureMatcherTest#testToStableString()
+   */
+  @Test(groups = "Functional")
+  public void testToStableString()
+  {
+    FeatureMatcherI fm1 = FeatureMatcher.byAttribute(Condition.LT, "1.2",
+            "AF");
+    assertEquals(fm1.toStableString(), "AF LT 1.2");
+  
+    FeatureMatcher fm2 = FeatureMatcher.byAttribute(Condition.NotContains,
+            "path", "CLIN_SIG");
+    assertEquals(fm2.toStableString(), "CLIN_SIG NotContains path");
+  
+    /*
+     * AND them
+     */
+    FeatureMatcherSetI fms = new FeatureMatcherSet();
+    assertEquals(fms.toStableString(), "");
+    fms.and(fm1);
+    // no brackets needed if a single condition
+    assertEquals(fms.toStableString(), "AF LT 1.2");
+    // brackets if more than one condition
+    fms.and(fm2);
+    assertEquals(fms.toStableString(),
+            "(AF LT 1.2) AND (CLIN_SIG NotContains path)");
+  
+    /*
+     * OR them
+     */
+    fms = new FeatureMatcherSet();
+    assertEquals(fms.toStableString(), "");
+    fms.or(fm1);
+    assertEquals(fms.toStableString(), "AF LT 1.2");
+    fms.or(fm2);
+    assertEquals(fms.toStableString(),
+            "(AF LT 1.2) OR (CLIN_SIG NotContains path)");
+  
+    /*
+     * attribute or value including space is quoted
+     */
+    FeatureMatcher fm3 = FeatureMatcher.byAttribute(Condition.NotMatches,
+            "foo bar", "CSQ", "Poly Phen");
+    assertEquals(fm3.toStableString(),
+            "'CSQ:Poly Phen' NotMatches 'foo bar'");
+    fms.or(fm3);
+    assertEquals(fms.toStableString(),
+            "(AF LT 1.2) OR (CLIN_SIG NotContains path) OR ('CSQ:Poly Phen' NotMatches 'foo bar')");
+
+    try
+    {
+      fms.and(fm1);
+      fail("Expected exception");
+    } catch (IllegalStateException e)
+    {
+      // expected
+    }
+  }
+
+  /**
+   * Tests for parsing a string representation of a FeatureMatcherSet
+   * 
+   * @see FeatureMatcherSetTest#testToStableString()
+   */
+  @Test(groups = "Functional")
+  public void testFromString()
+  {
+    String descriptor = "AF LT 1.2";
+    FeatureMatcherSetI fms = FeatureMatcherSet.fromString(descriptor);
+
+    /*
+     * shortcut asserts by verifying a 'roundtrip', 
+     * which we trust if other tests pass :-)
+     */
+    assertEquals(fms.toStableString(), descriptor);
+
+    // brackets optional, quotes optional, condition case insensitive
+    fms = FeatureMatcherSet.fromString("('AF' lt '1.2')");
+    assertEquals(fms.toStableString(), descriptor);
+
+    descriptor = "(AF LT 1.2) AND (CLIN_SIG NotContains path)";
+    fms = FeatureMatcherSet.fromString(descriptor);
+    assertEquals(fms.toStableString(), descriptor);
+
+    // AND is not case-sensitive
+    fms = FeatureMatcherSet
+            .fromString("(AF LT 1.2) and (CLIN_SIG NotContains path)");
+    assertEquals(fms.toStableString(), descriptor);
+  
+    descriptor = "(AF LT 1.2) OR (CLIN_SIG NotContains path)";
+    fms = FeatureMatcherSet.fromString(descriptor);
+    assertEquals(fms.toStableString(), descriptor);
+
+    // OR is not case-sensitive
+    fms = FeatureMatcherSet
+            .fromString("(AF LT 1.2) or (CLIN_SIG NotContains path)");
+    assertEquals(fms.toStableString(), descriptor);
+
+    // can get away without brackets on last match condition
+    fms = FeatureMatcherSet
+            .fromString("(AF LT 1.2) or CLIN_SIG NotContains path");
+    assertEquals(fms.toStableString(), descriptor);
+  
+    descriptor = "(AF LT 1.2) OR (CLIN_SIG NotContains path) OR ('CSQ:Poly Phen' NotMatches 'foo bar')";
+    fms = FeatureMatcherSet.fromString(descriptor);
+    assertEquals(fms.toStableString(), descriptor);
+
+    // can't mix OR and AND
+    descriptor = "(AF LT 1.2) OR (CLIN_SIG NotContains path) AND ('CSQ:Poly Phen' NotMatches 'foo bar')";
+    assertNull(FeatureMatcherSet.fromString(descriptor));
+
+    // can't mix AND and OR
+    descriptor = "(AF LT 1.2) and (CLIN_SIG NotContains path) or ('CSQ:Poly Phen' NotMatches 'foo bar')";
+    assertNull(FeatureMatcherSet.fromString(descriptor));
+
+    // brackets missing
+    assertNull(FeatureMatcherSet
+            .fromString("AF LT 1.2 or CLIN_SIG NotContains path"));
+
+    // invalid conjunction
+    assertNull(FeatureMatcherSet.fromString("(AF LT 1.2) but (AF GT -2)"));
+
+    // unbalanced quote (1)
+    assertNull(FeatureMatcherSet.fromString("('AF lt '1.2')"));
+
+    // unbalanced quote (2)
+    assertNull(FeatureMatcherSet.fromString("('AF' lt '1.2)"));
+  }
+}
diff --git a/test/jalview/datamodel/features/FeatureMatcherTest.java b/test/jalview/datamodel/features/FeatureMatcherTest.java
new file mode 100644
index 0000000..4bd34cb
--- /dev/null
+++ b/test/jalview/datamodel/features/FeatureMatcherTest.java
@@ -0,0 +1,352 @@
+package jalview.datamodel.features;
+
+import static org.testng.Assert.assertEquals;
+import static org.testng.Assert.assertFalse;
+import static org.testng.Assert.assertNull;
+import static org.testng.Assert.assertSame;
+import static org.testng.Assert.assertTrue;
+
+import jalview.datamodel.SequenceFeature;
+import jalview.util.MessageManager;
+import jalview.util.matcher.Condition;
+
+import java.util.Locale;
+
+import org.testng.annotations.Test;
+
+public class FeatureMatcherTest
+{
+  @Test(groups = "Functional")
+  public void testMatches_byLabel()
+  {
+    SequenceFeature sf = new SequenceFeature("Cath", "this is my label", 11,
+            12, "grp");
+
+    /*
+     * contains - not case sensitive
+     */
+    assertTrue(
+            FeatureMatcher.byLabel(Condition.Contains, "IS").matches(sf));
+    assertTrue(FeatureMatcher.byLabel(Condition.Contains, "").matches(sf));
+    assertFalse(
+            FeatureMatcher.byLabel(Condition.Contains, "ISNT").matches(sf));
+
+    /*
+     * does not contain
+     */
+    assertTrue(FeatureMatcher.byLabel(Condition.NotContains, "isnt")
+            .matches(sf));
+    assertFalse(FeatureMatcher.byLabel(Condition.NotContains, "is")
+            .matches(sf));
+
+    /*
+     * matches
+     */
+    assertTrue(FeatureMatcher.byLabel(Condition.Matches, "THIS is MY label")
+            .matches(sf));
+    assertFalse(FeatureMatcher.byLabel(Condition.Matches, "THIS is MY")
+            .matches(sf));
+
+    /*
+     * does not match
+     */
+    assertFalse(FeatureMatcher
+            .byLabel(Condition.NotMatches, "THIS is MY label").matches(sf));
+    assertTrue(FeatureMatcher.byLabel(Condition.NotMatches, "THIS is MY")
+            .matches(sf));
+
+    /*
+     * is present / not present
+     */
+    assertTrue(FeatureMatcher.byLabel(Condition.Present, "").matches(sf));
+    assertFalse(
+            FeatureMatcher.byLabel(Condition.NotPresent, "").matches(sf));
+  }
+
+  @Test(groups = "Functional")
+  public void testMatches_byScore()
+  {
+    SequenceFeature sf = new SequenceFeature("Cath", "this is my label", 11,
+            12, 3.2f, "grp");
+
+    assertTrue(FeatureMatcher.byScore(Condition.LT, "3.3").matches(sf));
+    assertFalse(FeatureMatcher.byScore(Condition.LT, "3.2").matches(sf));
+    assertFalse(FeatureMatcher.byScore(Condition.LT, "2.2").matches(sf));
+
+    assertTrue(FeatureMatcher.byScore(Condition.LE, "3.3").matches(sf));
+    assertTrue(FeatureMatcher.byScore(Condition.LE, "3.2").matches(sf));
+    assertFalse(FeatureMatcher.byScore(Condition.LE, "2.2").matches(sf));
+
+    assertFalse(FeatureMatcher.byScore(Condition.EQ, "3.3").matches(sf));
+    assertTrue(FeatureMatcher.byScore(Condition.EQ, "3.2").matches(sf));
+
+    assertFalse(FeatureMatcher.byScore(Condition.GE, "3.3").matches(sf));
+    assertTrue(FeatureMatcher.byScore(Condition.GE, "3.2").matches(sf));
+    assertTrue(FeatureMatcher.byScore(Condition.GE, "2.2").matches(sf));
+
+    assertFalse(FeatureMatcher.byScore(Condition.GT, "3.3").matches(sf));
+    assertFalse(FeatureMatcher.byScore(Condition.GT, "3.2").matches(sf));
+    assertTrue(FeatureMatcher.byScore(Condition.GT, "2.2").matches(sf));
+  }
+
+  @Test(groups = "Functional")
+  public void testMatches_byAttribute()
+  {
+    /*
+     * a numeric matcher - MatcherTest covers more conditions
+     */
+    FeatureMatcherI fm = FeatureMatcher
+            .byAttribute(Condition.GE, "-2", "AF");
+    SequenceFeature sf = new SequenceFeature("Cath", "desc", 11, 12, "grp");
+    assertFalse(fm.matches(sf));
+    sf.setValue("AF", "foobar");
+    assertFalse(fm.matches(sf));
+    sf.setValue("AF", "-2");
+    assertTrue(fm.matches(sf));
+    sf.setValue("AF", "-1");
+    assertTrue(fm.matches(sf));
+    sf.setValue("AF", "-3");
+    assertFalse(fm.matches(sf));
+    sf.setValue("AF", "");
+    assertFalse(fm.matches(sf));
+
+    /*
+     * a string pattern matcher
+     */
+    fm = FeatureMatcher.byAttribute(Condition.Contains, "Cat", "AF");
+    assertFalse(fm.matches(sf));
+    sf.setValue("AF", "raining cats and dogs");
+    assertTrue(fm.matches(sf));
+
+    fm = FeatureMatcher.byAttribute(Condition.Present, "", "AC");
+    assertFalse(fm.matches(sf));
+    sf.setValue("AC", "21");
+    assertTrue(fm.matches(sf));
+
+    fm = FeatureMatcher.byAttribute(Condition.NotPresent, "", "AC_Females");
+    assertTrue(fm.matches(sf));
+    sf.setValue("AC_Females", "21");
+    assertFalse(fm.matches(sf));
+  }
+
+  @Test(groups = "Functional")
+  public void testToString()
+  {
+    Locale.setDefault(Locale.ENGLISH);
+
+    /*
+     * toString uses the i18n translation of the enum conditions
+     */
+    FeatureMatcherI fm = FeatureMatcher.byAttribute(Condition.LT, "1.2",
+            "AF");
+    assertEquals(fm.toString(), "AF < 1.2");
+
+    /*
+     * Present / NotPresent omit the value pattern
+     */
+    fm = FeatureMatcher.byAttribute(Condition.Present, "", "AF");
+    assertEquals(fm.toString(), "AF is present");
+    fm = FeatureMatcher.byAttribute(Condition.NotPresent, "", "AF");
+    assertEquals(fm.toString(), "AF is not present");
+
+    /*
+     * by Label
+     */
+    fm = FeatureMatcher.byLabel(Condition.Matches, "foobar");
+    assertEquals(fm.toString(),
+            MessageManager.getString("label.label") + " matches 'foobar'");
+
+    /*
+     * by Score
+     */
+    fm = FeatureMatcher.byScore(Condition.GE, "12.2");
+    assertEquals(fm.toString(),
+            MessageManager.getString("label.score") + " >= 12.2");
+  }
+
+  @Test(groups = "Functional")
+  public void testGetAttribute()
+  {
+    FeatureMatcherI fm = FeatureMatcher.byAttribute(Condition.GE, "-2",
+            "AF");
+    assertEquals(fm.getAttribute(), new String[] { "AF" });
+
+    /*
+     * compound key (attribute / subattribute)
+     */
+    fm = FeatureMatcher.byAttribute(Condition.GE, "-2F", "CSQ",
+            "Consequence");
+    assertEquals(fm.getAttribute(), new String[] { "CSQ", "Consequence" });
+
+    /*
+     * answers null if match is by Label or by Score
+     */
+    assertNull(FeatureMatcher.byLabel(Condition.NotContains, "foo")
+            .getAttribute());
+    assertNull(FeatureMatcher.byScore(Condition.LE, "-1").getAttribute());
+  }
+
+  @Test(groups = "Functional")
+  public void testIsByAttribute()
+  {
+    assertFalse(FeatureMatcher.byLabel(Condition.NotContains, "foo")
+            .isByAttribute());
+    assertFalse(FeatureMatcher.byScore(Condition.LE, "-1").isByAttribute());
+    assertTrue(FeatureMatcher.byAttribute(Condition.LE, "-1", "AC")
+            .isByAttribute());
+  }
+
+  @Test(groups = "Functional")
+  public void testIsByLabel()
+  {
+    assertTrue(FeatureMatcher.byLabel(Condition.NotContains, "foo")
+            .isByLabel());
+    assertFalse(FeatureMatcher.byScore(Condition.LE, "-1").isByLabel());
+    assertFalse(FeatureMatcher.byAttribute(Condition.LE, "-1", "AC")
+            .isByLabel());
+  }
+
+  @Test(groups = "Functional")
+  public void testIsByScore()
+  {
+    assertFalse(FeatureMatcher.byLabel(Condition.NotContains, "foo")
+            .isByScore());
+    assertTrue(FeatureMatcher.byScore(Condition.LE, "-1").isByScore());
+    assertFalse(FeatureMatcher.byAttribute(Condition.LE, "-1", "AC")
+            .isByScore());
+  }
+
+  @Test(groups = "Functional")
+  public void testGetMatcher()
+  {
+    FeatureMatcherI fm = FeatureMatcher.byAttribute(Condition.GE, "-2f",
+            "AF");
+    assertEquals(fm.getMatcher().getCondition(), Condition.GE);
+    assertEquals(fm.getMatcher().getFloatValue(), -2F);
+    assertEquals(fm.getMatcher().getPattern(), "-2.0");
+  }
+
+  @Test(groups = "Functional")
+  public void testFromString()
+  {
+    FeatureMatcherI fm = FeatureMatcher.fromString("'AF' LT 1.2");
+    assertFalse(fm.isByLabel());
+    assertFalse(fm.isByScore());
+    assertEquals(fm.getAttribute(), new String[] { "AF" });
+    assertSame(Condition.LT, fm.getMatcher().getCondition());
+    assertEquals(fm.getMatcher().getFloatValue(), 1.2f);
+    assertEquals(fm.getMatcher().getPattern(), "1.2");
+
+    // quotes are optional, condition is not case sensitive
+    fm = FeatureMatcher.fromString("AF lt '1.2'");
+    assertFalse(fm.isByLabel());
+    assertFalse(fm.isByScore());
+    assertEquals(fm.getAttribute(), new String[] { "AF" });
+    assertSame(Condition.LT, fm.getMatcher().getCondition());
+    assertEquals(fm.getMatcher().getFloatValue(), 1.2f);
+    assertEquals(fm.getMatcher().getPattern(), "1.2");
+
+    fm = FeatureMatcher.fromString("'AF' Present");
+    assertFalse(fm.isByLabel());
+    assertFalse(fm.isByScore());
+    assertEquals(fm.getAttribute(), new String[] { "AF" });
+    assertSame(Condition.Present, fm.getMatcher().getCondition());
+
+    fm = FeatureMatcher.fromString("CSQ:Consequence contains damaging");
+    assertFalse(fm.isByLabel());
+    assertFalse(fm.isByScore());
+    assertEquals(fm.getAttribute(), new String[] { "CSQ", "Consequence" });
+    assertSame(Condition.Contains, fm.getMatcher().getCondition());
+    assertEquals(fm.getMatcher().getPattern(), "damaging");
+
+    // keyword Label is not case sensitive
+    fm = FeatureMatcher.fromString("LABEL Matches 'foobar'");
+    assertTrue(fm.isByLabel());
+    assertFalse(fm.isByScore());
+    assertNull(fm.getAttribute());
+    assertSame(Condition.Matches, fm.getMatcher().getCondition());
+    assertEquals(fm.getMatcher().getPattern(), "foobar");
+
+    fm = FeatureMatcher.fromString("'Label' matches 'foo bar'");
+    assertTrue(fm.isByLabel());
+    assertFalse(fm.isByScore());
+    assertNull(fm.getAttribute());
+    assertSame(Condition.Matches, fm.getMatcher().getCondition());
+    assertEquals(fm.getMatcher().getPattern(), "foo bar");
+
+    // quotes optional on pattern
+    fm = FeatureMatcher.fromString("'Label' matches foo bar");
+    assertTrue(fm.isByLabel());
+    assertFalse(fm.isByScore());
+    assertNull(fm.getAttribute());
+    assertSame(Condition.Matches, fm.getMatcher().getCondition());
+    assertEquals(fm.getMatcher().getPattern(), "foo bar");
+
+    fm = FeatureMatcher.fromString("Score GE 12.2");
+    assertFalse(fm.isByLabel());
+    assertTrue(fm.isByScore());
+    assertNull(fm.getAttribute());
+    assertSame(Condition.GE, fm.getMatcher().getCondition());
+    assertEquals(fm.getMatcher().getPattern(), "12.2");
+    assertEquals(fm.getMatcher().getFloatValue(), 12.2f);
+
+    // keyword Score is not case sensitive
+    fm = FeatureMatcher.fromString("'SCORE' ge '12.2'");
+    assertFalse(fm.isByLabel());
+    assertTrue(fm.isByScore());
+    assertNull(fm.getAttribute());
+    assertSame(Condition.GE, fm.getMatcher().getCondition());
+    assertEquals(fm.getMatcher().getPattern(), "12.2");
+    assertEquals(fm.getMatcher().getFloatValue(), 12.2f);
+
+    // invalid numeric pattern
+    assertNull(FeatureMatcher.fromString("Score eq twelve"));
+    // unbalanced opening quote
+    assertNull(FeatureMatcher.fromString("'Score ge 12.2"));
+    // unbalanced pattern quote
+    assertNull(FeatureMatcher.fromString("'Score' ge '12.2"));
+    // pattern missing
+    assertNull(FeatureMatcher.fromString("Score ge"));
+    // condition and pattern missing
+    assertNull(FeatureMatcher.fromString("Score"));
+    // everything missing
+    assertNull(FeatureMatcher.fromString(""));
+  }
+
+  /**
+   * Tests for toStableString which (unlike toString) does not i18n the
+   * conditions
+   */
+  @Test(groups = "Functional")
+  public void testToStableString()
+  {
+    // attribute name not quoted unless it contains space
+    FeatureMatcherI fm = FeatureMatcher.byAttribute(Condition.LT, "1.2",
+            "AF");
+    assertEquals(fm.toStableString(), "AF LT 1.2");
+
+    /*
+     * Present / NotPresent omit the value pattern
+     */
+    fm = FeatureMatcher.byAttribute(Condition.Present, "", "AF");
+    assertEquals(fm.toStableString(), "AF Present");
+    fm = FeatureMatcher.byAttribute(Condition.NotPresent, "", "AF");
+    assertEquals(fm.toStableString(), "AF NotPresent");
+
+    /*
+     * by Label
+     * pattern not quoted unless it contains space
+     */
+    fm = FeatureMatcher.byLabel(Condition.Matches, "foobar");
+    assertEquals(fm.toStableString(), "Label Matches foobar");
+
+    fm = FeatureMatcher.byLabel(Condition.Matches, "foo bar");
+    assertEquals(fm.toStableString(), "Label Matches 'foo bar'");
+
+    /*
+     * by Score
+     */
+    fm = FeatureMatcher.byScore(Condition.GE, "12.2");
+    assertEquals(fm.toStableString(), "Score GE 12.2");
+  }
+}
diff --git a/test/jalview/ext/ensembl/EnsemblSeqProxyTest.java b/test/jalview/ext/ensembl/EnsemblSeqProxyTest.java
index e2af26b..42afa82 100644
--- a/test/jalview/ext/ensembl/EnsemblSeqProxyTest.java
+++ b/test/jalview/ext/ensembl/EnsemblSeqProxyTest.java
@@ -21,9 +21,7 @@
 package jalview.ext.ensembl;
 
 import static org.testng.AssertJUnit.assertEquals;
-import static org.testng.AssertJUnit.assertFalse;
 import static org.testng.AssertJUnit.assertSame;
-import static org.testng.AssertJUnit.assertTrue;
 
 import jalview.datamodel.Alignment;
 import jalview.datamodel.SequenceFeature;
diff --git a/test/jalview/ext/htsjdk/TestHtsContigDb.java b/test/jalview/ext/htsjdk/TestHtsContigDb.java
index 350b599..28c5cf0 100644
--- a/test/jalview/ext/htsjdk/TestHtsContigDb.java
+++ b/test/jalview/ext/htsjdk/TestHtsContigDb.java
@@ -20,13 +20,19 @@
  */
 package jalview.ext.htsjdk;
 
+import static org.testng.Assert.assertEquals;
+import static org.testng.Assert.assertFalse;
+import static org.testng.Assert.assertNotNull;
+import static org.testng.Assert.assertTrue;
+import static org.testng.Assert.fail;
+
 import jalview.datamodel.SequenceI;
-import jalview.gui.JvOptionPane;
 
 import java.io.File;
+import java.io.IOException;
+import java.nio.file.Files;
+import java.nio.file.StandardCopyOption;
 
-import org.testng.Assert;
-import org.testng.annotations.BeforeClass;
 import org.testng.annotations.Test;
 
 /**
@@ -35,25 +41,108 @@ import org.testng.annotations.Test;
  */
 public class TestHtsContigDb
 {
+  @Test(groups = "Functional")
+  public final void testGetSequenceProxy() throws Exception
+  {
+    String pathname = "test/jalview/ext/htsjdk/pgmb.fasta";
+    HtsContigDb db = new HtsContigDb("ADB", new File(pathname));
+    
+    assertTrue(db.isValid());
+    assertTrue(db.isIndexed()); // htsjdk opens the .fai file
+    
+    SequenceI sq = db.getSequenceProxy("Deminut");
+    assertNotNull(sq);
+    assertEquals(sq.getLength(), 606);
+
+    /*
+     * read a sequence earlier in the file
+     */
+    sq = db.getSequenceProxy("PPL_06716");
+    assertNotNull(sq);
+    assertEquals(sq.getLength(), 602);
+    
+    // dict = db.getDictionary(f, truncate))
+  }
 
-  @BeforeClass(alwaysRun = true)
-  public void setUpJvOptionPane()
+  /**
+   * Trying to open a .fai file directly results in IllegalArgumentException -
+   * have to provide the unindexed file name instead
+   */
+  @Test(
+    groups = "Functional",
+    expectedExceptions = java.lang.IllegalArgumentException.class)
+  public final void testGetSequenceProxy_indexed()
   {
-    JvOptionPane.setInteractiveMode(false);
-    JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
+    String pathname = "test/jalview/ext/htsjdk/pgmb.fasta.fai";
+    new HtsContigDb("ADB", new File(pathname));
+    fail("Expected exception opening .fai file");
   }
 
+  /**
+   * Tests that exercise
+   * 
+   * opening an unindexed fasta file
+   * creating a .fai index
+   * opening the fasta file, now using the index
+   * error on creating index if overwrite not allowed
+   * 
+   * 
+   * @throws IOException
+   */
   @Test(groups = "Functional")
-  public final void testHTSReferenceSequence() throws Exception
+  public void testCreateFastaSequenceIndex() throws IOException
   {
-    HtsContigDb remmadb = new HtsContigDb("REEMADB", new File(
-            "test/jalview/ext/htsjdk/pgmb.fasta"));
+    File fasta = new File("test/jalview/ext/htsjdk/pgmb.fasta");
+    
+    /*
+     * create .fai with no overwrite fails if it exists
+     */
+    try {
+      HtsContigDb.createFastaSequenceIndex(fasta.toPath(), false);
+      fail("Expected exception");
+    } catch (IOException e)
+    {
+      // expected
+    }
 
-    Assert.assertTrue(remmadb.isValid());
+    /*
+     * create a copy of the .fasta (as a temp file)
+     */
+    File copyFasta = File.createTempFile("copyFasta", ".fasta");
+    copyFasta.deleteOnExit();
+    assertTrue(copyFasta.exists());
+    Files.copy(fasta.toPath(), copyFasta.toPath(),
+            StandardCopyOption.REPLACE_EXISTING);
 
-    SequenceI sq = remmadb.getSequenceProxy("Deminut");
-    Assert.assertNotNull(sq);
-    Assert.assertNotEquals(0, sq.getLength());
+    /*
+     * open the Fasta file - not indexed, as no .fai file yet exists
+     */
+    HtsContigDb db = new HtsContigDb("ADB", copyFasta);
+    assertTrue(db.isValid());
+    assertFalse(db.isIndexed());
+    db.close();
+
+    /*
+     * create the .fai index, re-open the .fasta file - now indexed
+     */
+    HtsContigDb.createFastaSequenceIndex(copyFasta.toPath(), true);
+    db = new HtsContigDb("ADB", copyFasta);
+    assertTrue(db.isValid());
+    assertTrue(db.isIndexed());
+    db.close();
   }
 
+  /**
+   * A convenience 'test' that may be run to create a .fai file for any given
+   * fasta file
+   * 
+   * @throws IOException
+   */
+  @Test(enabled = false)
+  public void testCreateIndex() throws IOException
+  {
+
+    File fasta = new File("test/jalview/io/vcf/contigs.fasta");
+    HtsContigDb.createFastaSequenceIndex(fasta.toPath(), true);
+  }
 }
diff --git a/test/jalview/ext/htsjdk/VCFReaderTest.java b/test/jalview/ext/htsjdk/VCFReaderTest.java
new file mode 100644
index 0000000..bf617ae
--- /dev/null
+++ b/test/jalview/ext/htsjdk/VCFReaderTest.java
@@ -0,0 +1,200 @@
+package jalview.ext.htsjdk;
+
+import static org.testng.Assert.assertEquals;
+import static org.testng.Assert.assertFalse;
+import static org.testng.Assert.assertTrue;
+import htsjdk.samtools.util.CloseableIterator;
+import htsjdk.variant.variantcontext.Allele;
+import htsjdk.variant.variantcontext.VariantContext;
+
+import java.io.File;
+import java.io.IOException;
+import java.io.PrintWriter;
+import java.util.List;
+
+import org.testng.annotations.Test;
+
+public class VCFReaderTest
+{
+  private static final String[] VCF = new String[] {
+      "##fileformat=VCFv4.2",
+      "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO",
+      "20\t3\t.\tC\tG\t.\tPASS\tDP=100", // SNP C/G
+      "20\t7\t.\tG\tGA\t.\tPASS\tDP=100", // insertion G/GA
+      "18\t2\t.\tACG\tA\t.\tPASS\tDP=100" }; // deletion ACG/A
+
+  // gnomAD exome variant dataset
+  private static final String VCF_PATH = "/Volumes/gjb/smacgowan/NOBACK/resources/gnomad/gnomad.exomes.r2.0.1.sites.vcf.gz";
+
+  // "https://storage.cloud.google.com/gnomad-public/release/2.0.1/vcf/exomes/gnomad.exomes.r2.0.1.sites.vcf.gz";
+
+  /**
+   * A test to exercise some basic functionality of the htsjdk VCF reader,
+   * reading from a non-index VCF file
+   * 
+   * @throws IOException
+   */
+  @Test(groups = "Functional")
+  public void testReadVcf_plain() throws IOException
+  {
+    File f = writeVcfFile();
+    VCFReader reader = new VCFReader(f.getAbsolutePath());
+    CloseableIterator variants = reader.iterator();
+
+    /*
+     * SNP C/G variant
+     */
+    VariantContext vc = variants.next();
+    assertTrue(vc.isSNP());
+    Allele ref = vc.getReference();
+    assertEquals(ref.getBaseString(), "C");
+    List alleles = vc.getAlleles();
+    assertEquals(alleles.size(), 2);
+    assertTrue(alleles.get(0).isReference());
+    assertEquals(alleles.get(0).getBaseString(), "C");
+    assertFalse(alleles.get(1).isReference());
+    assertEquals(alleles.get(1).getBaseString(), "G");
+
+    /*
+     * Insertion G -> GA
+     */
+    vc = variants.next();
+    assertFalse(vc.isSNP());
+    assertTrue(vc.isSimpleInsertion());
+    ref = vc.getReference();
+    assertEquals(ref.getBaseString(), "G");
+    alleles = vc.getAlleles();
+    assertEquals(alleles.size(), 2);
+    assertTrue(alleles.get(0).isReference());
+    assertEquals(alleles.get(0).getBaseString(), "G");
+    assertFalse(alleles.get(1).isReference());
+    assertEquals(alleles.get(1).getBaseString(), "GA");
+
+    /*
+     * Deletion ACG -> A
+     */
+    vc = variants.next();
+    assertFalse(vc.isSNP());
+    assertTrue(vc.isSimpleDeletion());
+    ref = vc.getReference();
+    assertEquals(ref.getBaseString(), "ACG");
+    alleles = vc.getAlleles();
+    assertEquals(alleles.size(), 2);
+    assertTrue(alleles.get(0).isReference());
+    assertEquals(alleles.get(0).getBaseString(), "ACG");
+    assertFalse(alleles.get(1).isReference());
+    assertEquals(alleles.get(1).getBaseString(), "A");
+
+    assertFalse(variants.hasNext());
+
+    variants.close();
+    reader.close();
+  }
+
+  /**
+   * Creates a temporary file to be read by the htsjdk VCF reader
+   * 
+   * @return
+   * @throws IOException
+   */
+  protected File writeVcfFile() throws IOException
+  {
+    File f = File.createTempFile("Test", "vcf");
+    f.deleteOnExit();
+    PrintWriter pw = new PrintWriter(f);
+    for (String vcfLine : VCF) {
+      pw.println(vcfLine);
+    }
+    pw.close();
+    return f;
+  }
+  
+  /**
+   * A 'test' that demonstrates querying an indexed VCF file for features in a
+   * specified interval
+   * 
+   * @throws IOException
+   */
+  @Test
+  public void testQuery_indexed() throws IOException
+  {
+    /*
+     * if not specified, assumes index file is filename.tbi
+     */
+    VCFReader reader = new VCFReader(VCF_PATH);
+  
+    /*
+     * gene NMT1 (human) is on chromosome 17
+     * GCHR38 (Ensembl): 45051610-45109016
+     * GCHR37 (gnoMAD): 43128978-43186384
+     * CDS begins at offset 9720, first CDS variant at offset 9724
+     */
+    CloseableIterator features = reader.query("17",
+            43128978 + 9724, 43128978 + 9734); // first 11 CDS positions
+
+    assertEquals(printNext(features), 43138702);
+    assertEquals(printNext(features), 43138704);
+    assertEquals(printNext(features), 43138707);
+    assertEquals(printNext(features), 43138708);
+    assertEquals(printNext(features), 43138710);
+    assertEquals(printNext(features), 43138711);
+    assertFalse(features.hasNext());
+
+    features.close();
+    reader.close();
+  }
+
+  /**
+   * Prints the toString value of the next variant, and returns its start
+   * location
+   * 
+   * @param features
+   * @return
+   */
+  protected int printNext(CloseableIterator features)
+  {
+    VariantContext next = features.next();
+    System.out.println(next.toString());
+    return next.getStart();
+  }
+
+  // "https://storage.cloud.google.com/gnomad-public/release/2.0.1/vcf/exomes/gnomad.exomes.r2.0.1.sites.vcf.gz";
+  
+  /**
+   * Test the query method that wraps a non-indexed VCF file
+   * 
+   * @throws IOException
+   */
+  @Test(groups = "Functional")
+  public void testQuery_plain() throws IOException
+  {
+    File f = writeVcfFile();
+    VCFReader reader = new VCFReader(f.getAbsolutePath());
+
+    /*
+     * query for overlap of 5-8 - should find variant at 7
+     */
+    CloseableIterator variants = reader.query("20", 5, 8);
+  
+    /*
+     * INDEL G/GA variant
+     */
+    VariantContext vc = variants.next();
+    assertTrue(vc.isIndel());
+    assertEquals(vc.getStart(), 7);
+    assertEquals(vc.getEnd(), 7);
+    Allele ref = vc.getReference();
+    assertEquals(ref.getBaseString(), "G");
+    List alleles = vc.getAlleles();
+    assertEquals(alleles.size(), 2);
+    assertTrue(alleles.get(0).isReference());
+    assertEquals(alleles.get(0).getBaseString(), "G");
+    assertFalse(alleles.get(1).isReference());
+    assertEquals(alleles.get(1).getBaseString(), "GA");
+
+    assertFalse(variants.hasNext());
+
+    variants.close();
+    reader.close();
+  }
+}
diff --git a/test/jalview/ext/so/SequenceOntologyTest.java b/test/jalview/ext/so/SequenceOntologyTest.java
index b76a295..31e1887 100644
--- a/test/jalview/ext/so/SequenceOntologyTest.java
+++ b/test/jalview/ext/so/SequenceOntologyTest.java
@@ -107,4 +107,29 @@ public class SequenceOntologyTest
     assertFalse(so.isA("CDS_region", "CDS"));// part_of
     assertFalse(so.isA("polypeptide", "CDS")); // derives_from
   }
+
+  @Test(groups = "Functional")
+  public void testIsSequenceVariant()
+  {
+    assertFalse(so.isA("CDS", "sequence_variant"));
+    assertTrue(so.isA("sequence_variant", "sequence_variant"));
+
+    /*
+     * these should all be sub-types of sequence_variant
+     */
+    assertTrue(so.isA("structural_variant", "sequence_variant"));
+    assertTrue(so.isA("feature_variant", "sequence_variant"));
+    assertTrue(so.isA("gene_variant", "sequence_variant"));
+    assertTrue(so.isA("transcript_variant", "sequence_variant"));
+    assertTrue(so.isA("NMD_transcript_variant", "sequence_variant"));
+    assertTrue(so.isA("missense_variant", "sequence_variant"));
+    assertTrue(so.isA("synonymous_variant", "sequence_variant"));
+    assertTrue(so.isA("frameshift_variant", "sequence_variant"));
+    assertTrue(so.isA("5_prime_UTR_variant", "sequence_variant"));
+    assertTrue(so.isA("3_prime_UTR_variant", "sequence_variant"));
+    assertTrue(so.isA("stop_gained", "sequence_variant"));
+    assertTrue(so.isA("stop_lost", "sequence_variant"));
+    assertTrue(so.isA("inframe_deletion", "sequence_variant"));
+    assertTrue(so.isA("inframe_insertion", "sequence_variant"));
+  }
 }
diff --git a/test/jalview/gui/AlignFrameTest.java b/test/jalview/gui/AlignFrameTest.java
index af9c045..1ee25c7 100644
--- a/test/jalview/gui/AlignFrameTest.java
+++ b/test/jalview/gui/AlignFrameTest.java
@@ -26,6 +26,7 @@ import static org.testng.Assert.assertNotSame;
 import static org.testng.Assert.assertSame;
 import static org.testng.Assert.assertTrue;
 
+import jalview.api.FeatureColourI;
 import jalview.bin.Cache;
 import jalview.bin.Jalview;
 import jalview.datamodel.Alignment;
@@ -39,6 +40,7 @@ import jalview.io.FileLoader;
 import jalview.io.Jalview2xmlTests;
 import jalview.renderer.ResidueShaderI;
 import jalview.schemes.BuriedColourScheme;
+import jalview.schemes.FeatureColour;
 import jalview.schemes.HelixColourScheme;
 import jalview.schemes.JalviewColourScheme;
 import jalview.schemes.StrandColourScheme;
@@ -69,16 +71,21 @@ public class AlignFrameTest
   {
     SequenceI seq1 = new Sequence("Seq1", "ABCDEFGHIJ");
     SequenceI seq2 = new Sequence("Seq2", "ABCDEFGHIJ");
-    seq1.addSequenceFeature(new SequenceFeature("Metal", "", 1, 5,
-            Float.NaN, null));
-    seq2.addSequenceFeature(new SequenceFeature("Metal", "", 6, 10,
-            Float.NaN, null));
+    seq1.addSequenceFeature(new SequenceFeature("Metal", "", 1, 5, 0f, null));
+    seq2.addSequenceFeature(new SequenceFeature("Metal", "", 6, 10, 10f,
+            null));
     seq1.addSequenceFeature(new SequenceFeature("Turn", "", 2, 4,
             Float.NaN, null));
     seq2.addSequenceFeature(new SequenceFeature("Turn", "", 7, 9,
             Float.NaN, null));
     AlignmentI al = new Alignment(new SequenceI[] { seq1, seq2 });
-    AlignFrame alignFrame = new AlignFrame(al, al.getWidth(), al.getHeight());
+    AlignFrame alignFrame = new AlignFrame(al, al.getWidth(),
+            al.getHeight());
+
+    /*
+     * make all features visible (select feature columns checks visibility)
+     */
+    alignFrame.getFeatureRenderer().findAllFeatures(true);
 
     /*
      * hiding a feature not present does nothing
@@ -86,13 +93,11 @@ public class AlignFrameTest
     assertFalse(alignFrame.hideFeatureColumns("exon", true));
     assertTrue(alignFrame.getViewport().getColumnSelection().isEmpty());
     assertTrue(alignFrame.getViewport().getAlignment().getHiddenColumns()
-            .getHiddenColumnsCopy()
-            .isEmpty());
+            .getHiddenColumnsCopy().isEmpty());
     assertFalse(alignFrame.hideFeatureColumns("exon", false));
     assertTrue(alignFrame.getViewport().getColumnSelection().isEmpty());
     assertTrue(alignFrame.getViewport().getAlignment().getHiddenColumns()
-            .getHiddenColumnsCopy()
-            .isEmpty());
+            .getHiddenColumnsCopy().isEmpty());
 
     /*
      * hiding a feature in all columns does nothing
@@ -100,15 +105,31 @@ public class AlignFrameTest
     assertFalse(alignFrame.hideFeatureColumns("Metal", true));
     assertTrue(alignFrame.getViewport().getColumnSelection().isEmpty());
     List hidden = alignFrame.getViewport().getAlignment()
-            .getHiddenColumns()
-            .getHiddenColumnsCopy();
+            .getHiddenColumns().getHiddenColumnsCopy();
     assertTrue(hidden.isEmpty());
 
     /*
+     * threshold Metal to hide features where score < 5
+     * seq1 feature in columns 1-5 is hidden
+     * seq2 feature in columns 6-10 is shown
+     */
+    FeatureColourI fc = new FeatureColour(Color.red, Color.blue, 0f, 10f);
+    fc.setAboveThreshold(true);
+    fc.setThreshold(5f);
+    alignFrame.getFeatureRenderer().setColour("Metal", fc);
+    assertTrue(alignFrame.hideFeatureColumns("Metal", true));
+    hidden = alignFrame.getViewport().getAlignment().getHiddenColumns()
+            .getHiddenColumnsCopy();
+    assertEquals(hidden.size(), 1);
+    assertEquals(hidden.get(0)[0], 5);
+    assertEquals(hidden.get(0)[1], 9);
+
+    /*
      * hide a feature present in some columns
      * sequence positions [2-4], [7-9] are column positions
      * [1-3], [6-8] base zero
      */
+    alignFrame.getViewport().showAllHiddenColumns();
     assertTrue(alignFrame.hideFeatureColumns("Turn", true));
     hidden = alignFrame.getViewport().getAlignment().getHiddenColumns()
             .getHiddenColumnsCopy();
diff --git a/test/jalview/gui/FeatureSettingsTest.java b/test/jalview/gui/FeatureSettingsTest.java
new file mode 100644
index 0000000..6ddebf8
--- /dev/null
+++ b/test/jalview/gui/FeatureSettingsTest.java
@@ -0,0 +1,191 @@
+package jalview.gui;
+
+import static org.testng.Assert.assertEquals;
+import static org.testng.Assert.assertNull;
+import static org.testng.Assert.assertTrue;
+
+import jalview.api.FeatureColourI;
+import jalview.datamodel.SequenceFeature;
+import jalview.datamodel.SequenceI;
+import jalview.datamodel.features.FeatureMatcher;
+import jalview.datamodel.features.FeatureMatcherSet;
+import jalview.datamodel.features.FeatureMatcherSetI;
+import jalview.io.DataSourceType;
+import jalview.io.FileLoader;
+import jalview.schemes.FeatureColour;
+import jalview.util.matcher.Condition;
+
+import java.awt.Color;
+import java.io.File;
+import java.io.IOException;
+import java.util.HashMap;
+
+import org.testng.annotations.Test;
+
+public class FeatureSettingsTest
+{
+  /**
+   * Test a roundtrip of save and reload of feature colours and filters as XML
+   * 
+   * @throws IOException
+   */
+  @Test(groups = "Functional")
+  public void testSaveLoad() throws IOException
+  {
+    AlignFrame af = new FileLoader().LoadFileWaitTillLoaded(
+            ">Seq1\nACDEFGHIKLM", DataSourceType.PASTE);
+    SequenceI seq1 = af.getViewport().getAlignment().getSequenceAt(0);
+
+    /*
+     * add some features to the sequence
+     */
+    int score = 1;
+    addFeatures(seq1, "type1", score++);
+    addFeatures(seq1, "type2", score++);
+    addFeatures(seq1, "type3", score++);
+    addFeatures(seq1, "type4", score++);
+    addFeatures(seq1, "type5", score++);
+
+    /*
+     * set colour schemes for features
+     */
+    FeatureRenderer fr = af.getFeatureRenderer();
+
+    // type1: red
+    fr.setColour("type1", new FeatureColour(Color.red));
+
+    // type2: by label
+    FeatureColourI byLabel = new FeatureColour();
+    byLabel.setColourByLabel(true);
+    fr.setColour("type2", byLabel);
+
+    // type3: by score above threshold
+    FeatureColourI byScore = new FeatureColour(Color.BLACK, Color.BLUE, 1,
+            10);
+    byScore.setAboveThreshold(true);
+    byScore.setThreshold(2f);
+    fr.setColour("type3", byScore);
+
+    // type4: by attribute AF
+    FeatureColourI byAF = new FeatureColour();
+    byAF.setColourByLabel(true);
+    byAF.setAttributeName("AF");
+    fr.setColour("type4", byAF);
+
+    // type5: by attribute CSQ:PolyPhen below threshold
+    FeatureColourI byPolyPhen = new FeatureColour(Color.BLACK, Color.BLUE,
+            1, 10);
+    byPolyPhen.setBelowThreshold(true);
+    byPolyPhen.setThreshold(3f);
+    byPolyPhen.setAttributeName("CSQ", "PolyPhen");
+    fr.setColour("type5", byPolyPhen);
+
+    /*
+     * set filters for feature types
+     */
+
+    // filter type1 features by (label contains "x")
+    FeatureMatcherSetI filterByX = new FeatureMatcherSet();
+    filterByX.and(FeatureMatcher.byLabel(Condition.Contains, "x"));
+    fr.setFeatureFilter("type1", filterByX);
+
+    // filter type2 features by (score <= 2.4 and score > 1.1)
+    FeatureMatcherSetI filterByScore = new FeatureMatcherSet();
+    filterByScore.and(FeatureMatcher.byScore(Condition.LE, "2.4"));
+    filterByScore.and(FeatureMatcher.byScore(Condition.GT, "1.1"));
+    fr.setFeatureFilter("type2", filterByScore);
+
+    // filter type3 features by (AF contains X OR CSQ:PolyPhen != 0)
+    FeatureMatcherSetI filterByXY = new FeatureMatcherSet();
+    filterByXY
+            .and(FeatureMatcher.byAttribute(Condition.Contains, "X", "AF"));
+    filterByXY.or(FeatureMatcher.byAttribute(Condition.NE, "0", "CSQ",
+            "PolyPhen"));
+    fr.setFeatureFilter("type3", filterByXY);
+
+    /*
+     * save colours and filters to an XML file
+     */
+    File coloursFile = File.createTempFile("testSaveLoad", ".fc");
+    coloursFile.deleteOnExit();
+    FeatureSettings fs = new FeatureSettings(af);
+    fs.save(coloursFile);
+
+    /*
+     * change feature colours and filters
+     */
+    FeatureColourI pink = new FeatureColour(Color.pink);
+    fr.setColour("type1", pink);
+    fr.setColour("type2", pink);
+    fr.setColour("type3", pink);
+    fr.setColour("type4", pink);
+    fr.setColour("type5", pink);
+
+    FeatureMatcherSetI filter2 = new FeatureMatcherSet();
+    filter2.and(FeatureMatcher.byLabel(Condition.NotContains, "y"));
+    fr.setFeatureFilter("type1", filter2);
+    fr.setFeatureFilter("type2", filter2);
+    fr.setFeatureFilter("type3", filter2);
+    fr.setFeatureFilter("type4", filter2);
+    fr.setFeatureFilter("type5", filter2);
+
+    /*
+     * reload colours and filters from file and verify they are restored
+     */
+    fs.load(coloursFile);
+    FeatureColourI fc = fr.getFeatureStyle("type1");
+    assertTrue(fc.isSimpleColour());
+    assertEquals(fc.getColour(), Color.red);
+    fc = fr.getFeatureStyle("type2");
+    assertTrue(fc.isColourByLabel());
+    fc = fr.getFeatureStyle("type3");
+    assertTrue(fc.isGraduatedColour());
+    assertNull(fc.getAttributeName());
+    assertTrue(fc.isAboveThreshold());
+    assertEquals(fc.getThreshold(), 2f);
+    fc = fr.getFeatureStyle("type4");
+    assertTrue(fc.isColourByLabel());
+    assertTrue(fc.isColourByAttribute());
+    assertEquals(fc.getAttributeName(), new String[] { "AF" });
+    fc = fr.getFeatureStyle("type5");
+    assertTrue(fc.isGraduatedColour());
+    assertTrue(fc.isColourByAttribute());
+    assertEquals(fc.getAttributeName(), new String[] { "CSQ", "PolyPhen" });
+    assertTrue(fc.isBelowThreshold());
+    assertEquals(fc.getThreshold(), 3f);
+
+    assertEquals(fr.getFeatureFilter("type1").toStableString(), "Label Contains x");
+    assertEquals(fr.getFeatureFilter("type2").toStableString(),
+            "(Score LE 2.4) AND (Score GT 1.1)");
+    assertEquals(fr.getFeatureFilter("type3").toStableString(),
+            "(AF Contains X) OR (CSQ:PolyPhen NE 0.0)");
+  }
+
+  /**
+   * Adds two features of the given type to the given sequence, also setting the
+   * score as the value of attribute "AF" and sub-attribute "CSQ:PolyPhen"
+   * 
+   * @param seq
+   * @param featureType
+   * @param score
+   */
+  private void addFeatures(SequenceI seq, String featureType, int score)
+  {
+    addFeature(seq, featureType, score++);
+    addFeature(seq, featureType, score);
+  }
+
+  private void addFeature(SequenceI seq, String featureType, int score)
+  {
+    SequenceFeature sf = new SequenceFeature(featureType, "desc", 1, 2,
+            score, "grp");
+    sf.setValue("AF", score);
+    sf.setValue("CSQ", new HashMap()
+    {
+      {
+        put("PolyPhen", Integer.toString(score));
+      }
+    });
+    seq.addSequenceFeature(sf);
+  }
+}
diff --git a/test/jalview/gui/PopupMenuTest.java b/test/jalview/gui/PopupMenuTest.java
index 335240b..40e624d 100644
--- a/test/jalview/gui/PopupMenuTest.java
+++ b/test/jalview/gui/PopupMenuTest.java
@@ -26,21 +26,26 @@ import static org.testng.AssertJUnit.assertEquals;
 import static org.testng.AssertJUnit.assertFalse;
 import static org.testng.AssertJUnit.assertTrue;
 
+import jalview.bin.Cache;
 import jalview.datamodel.AlignmentAnnotation;
 import jalview.datamodel.AlignmentI;
 import jalview.datamodel.Annotation;
 import jalview.datamodel.DBRefEntry;
 import jalview.datamodel.DBRefSource;
-import jalview.datamodel.Sequence;
+import jalview.datamodel.SequenceFeature;
 import jalview.datamodel.SequenceI;
 import jalview.io.DataSourceType;
 import jalview.io.FileFormat;
 import jalview.io.FormatAdapter;
+import jalview.urls.api.UrlProviderFactoryI;
+import jalview.urls.desktop.DesktopUrlProviderFactory;
 import jalview.util.MessageManager;
+import jalview.util.UrlConstants;
 
 import java.awt.Component;
 import java.io.IOException;
 import java.util.ArrayList;
+import java.util.Collections;
 import java.util.List;
 
 import javax.swing.JMenu;
@@ -80,6 +85,25 @@ public class PopupMenuTest
   @BeforeMethod(alwaysRun = true)
   public void setUp() throws IOException
   {
+    Cache.loadProperties("test/jalview/io/testProps.jvprops");
+    String inMenuString = ("EMBL-EBI Search | http://www.ebi.ac.uk/ebisearch/search.ebi?db=allebi&query=$"
+            + SEQUENCE_ID
+            + "$"
+            + "|"
+            + "UNIPROT | http://www.uniprot.org/uniprot/$" + DB_ACCESSION + "$")
+            + "|"
+            + ("INTERPRO | http://www.ebi.ac.uk/interpro/entry/$"
+                    + DB_ACCESSION + "$")
+            + "|"
+            +
+            // Gene3D entry tests for case (in)sensitivity
+            ("Gene3D | http://gene3d.biochem.ucl.ac.uk/Gene3D/search?sterm=$"
+                    + DB_ACCESSION + "$&mode=protein");
+
+    UrlProviderFactoryI factory = new DesktopUrlProviderFactory(
+            UrlConstants.DEFAULT_LABEL, inMenuString, "");
+    Preferences.sequenceUrlLinks = factory.createUrlProvider();
+
     alignment = new FormatAdapter().readFile(TEST_DATA,
             DataSourceType.PASTE, FileFormat.Fasta);
     AlignFrame af = new AlignFrame(alignment, 700, 500);
@@ -495,17 +519,19 @@ public class PopupMenuTest
 
     // add all the dbrefs to the sequences: Uniprot 1 each, Interpro all 3 to
     // seq0, Gene3D to seq1
-    seqs.get(0).addDBRef(refs.get(0));
+    SequenceI seq = seqs.get(0);
+    seq.addDBRef(refs.get(0));
 
-    seqs.get(0).addDBRef(refs.get(1));
-    seqs.get(0).addDBRef(refs.get(2));
-    seqs.get(0).addDBRef(refs.get(3));
+    seq.addDBRef(refs.get(1));
+    seq.addDBRef(refs.get(2));
+    seq.addDBRef(refs.get(3));
     
     seqs.get(1).addDBRef(refs.get(4));
     seqs.get(1).addDBRef(refs.get(5));
     
     // get the Popup Menu for first sequence
-    testee = new PopupMenu(parentPanel, (Sequence) seqs.get(0), links);
+    List noFeatures = Collections. emptyList();
+    testee = new PopupMenu(parentPanel, seq, noFeatures);
     Component[] seqItems = testee.sequenceMenu.getMenuComponents();
     JMenu linkMenu = (JMenu) seqItems[6];
     Component[] linkItems = linkMenu.getMenuComponents();
@@ -519,15 +545,18 @@ public class PopupMenuTest
     // sequence id for each link should match corresponding DB accession id
     for (int i = 1; i < 4; i++)
     {
-      assertEquals(refs.get(i - 1).getSource(), ((JMenuItem) linkItems[i])
+      String msg = seq.getName() + " link[" + i + "]";
+      assertEquals(msg, refs.get(i - 1).getSource(),
+              ((JMenuItem) linkItems[i])
               .getText().split("\\|")[0]);
-      assertEquals(refs.get(i - 1).getAccessionId(),
+      assertEquals(msg, refs.get(i - 1).getAccessionId(),
               ((JMenuItem) linkItems[i])
               .getText().split("\\|")[1]);
     }
 
     // get the Popup Menu for second sequence
-    testee = new PopupMenu(parentPanel, (Sequence) seqs.get(1), links);
+    seq = seqs.get(1);
+    testee = new PopupMenu(parentPanel, seq, noFeatures);
     seqItems = testee.sequenceMenu.getMenuComponents();
     linkMenu = (JMenu) seqItems[6];
     linkItems = linkMenu.getMenuComponents();
@@ -541,9 +570,11 @@ public class PopupMenuTest
     // sequence id for each link should match corresponding DB accession id
     for (int i = 1; i < 3; i++)
     {
-      assertEquals(refs.get(i + 3).getSource(), ((JMenuItem) linkItems[i])
+      String msg = seq.getName() + " link[" + i + "]";
+      assertEquals(msg, refs.get(i + 3).getSource(),
+              ((JMenuItem) linkItems[i])
               .getText().split("\\|")[0].toUpperCase());
-      assertEquals(refs.get(i + 3).getAccessionId(),
+      assertEquals(msg, refs.get(i + 3).getAccessionId(),
               ((JMenuItem) linkItems[i]).getText().split("\\|")[1]);
     }
 
@@ -552,8 +583,7 @@ public class PopupMenuTest
     nomatchlinks.add("NOMATCH | http://www.uniprot.org/uniprot/$"
             + DB_ACCESSION + "$");
 
-    testee = new PopupMenu(parentPanel, (Sequence) seqs.get(0),
-            nomatchlinks);
+    testee = new PopupMenu(parentPanel, seq, noFeatures);
     seqItems = testee.sequenceMenu.getMenuComponents();
     linkMenu = (JMenu) seqItems[6];
     assertFalse(linkMenu.isEnabled());
diff --git a/test/jalview/gui/SeqCanvasTest.java b/test/jalview/gui/SeqCanvasTest.java
index a27bc3f..05b9aea 100644
--- a/test/jalview/gui/SeqCanvasTest.java
+++ b/test/jalview/gui/SeqCanvasTest.java
@@ -13,8 +13,6 @@ import junit.extensions.PA;
 
 import org.testng.annotations.Test;
 
-import sun.swing.SwingUtilities2;
-
 public class SeqCanvasTest
 {
   /**
@@ -48,7 +46,7 @@ public class SeqCanvasTest
     av.setScaleAboveWrapped(true);
     av.setScaleLeftWrapped(true);
     av.setScaleRightWrapped(true);
-    FontMetrics fm = SwingUtilities2.getFontMetrics(testee, av.getFont());
+    FontMetrics fm = testee.getFontMetrics(av.getFont());
     int labelWidth = fm.stringWidth("000") + charWidth;
     assertEquals(labelWidth, 39); // 3 x 9 + charWidth
 
@@ -218,7 +216,7 @@ public class SeqCanvasTest
     av.setScaleAboveWrapped(true);
     av.setScaleLeftWrapped(true);
     av.setScaleRightWrapped(true);
-    FontMetrics fm = SwingUtilities2.getFontMetrics(testee, av.getFont());
+    FontMetrics fm = testee.getFontMetrics(av.getFont());
     int labelWidth = fm.stringWidth("000") + charWidth;
     assertEquals(labelWidth, 39); // 3 x 9 + charWidth
     int annotationHeight = testee.getAnnotationHeight();
diff --git a/test/jalview/io/CrossRef2xmlTests.java b/test/jalview/io/CrossRef2xmlTests.java
index 0715857..b3db4de 100644
--- a/test/jalview/io/CrossRef2xmlTests.java
+++ b/test/jalview/io/CrossRef2xmlTests.java
@@ -39,6 +39,9 @@ import java.util.ArrayList;
 import java.util.Arrays;
 import java.util.HashMap;
 import java.util.List;
+import java.util.Map;
+
+import junit.extensions.PA;
 
 import org.testng.Assert;
 import org.testng.annotations.BeforeClass;
@@ -90,9 +93,9 @@ public class CrossRef2xmlTests extends Jalview2xmlBase
     // . codonframes
     //
     //
-    HashMap dbtoviewBit = new HashMap<>();
+    Map dbtoviewBit = new HashMap<>();
     List keyseq = new ArrayList<>();
-    HashMap savedProjects = new HashMap<>();
+    Map savedProjects = new HashMap<>();
 
     for (String[] did : new String[][] { { "UNIPROT", "P00338" } })
     {
@@ -186,15 +189,16 @@ public class CrossRef2xmlTests extends Jalview2xmlBase
 
             if (pass2 == 0)
             { // retrieve and show cross-refs in this thread
-              cra = new CrossRefAction(af, seqs, dna, db);
+              cra = CrossRefAction.getHandlerFor(seqs, dna, db, af);
               cra.run();
-              if (cra.getXrefViews().size() == 0)
+              cra_views = (List) PA.getValue(cra,
+                      "xrefViews");
+              if (cra_views.size() == 0)
               {
                 failedXrefMenuItems.add("No crossrefs retrieved for "
                         + first + " -> " + db);
                 continue;
               }
-              cra_views = cra.getXrefViews();
               assertNucleotide(cra_views.get(0),
                       "Nucleotide panel included proteins for " + first
                               + " -> " + db);
@@ -286,16 +290,18 @@ public class CrossRef2xmlTests extends Jalview2xmlBase
 
                   if (pass3 == 0)
                   {
-
                     SequenceI[] xrseqs = avp.getAlignment()
                             .getSequencesArray();
                     AlignFrame nextaf = Desktop.getAlignFrameFor(avp
                             .getAlignViewport());
 
-                    cra = new CrossRefAction(nextaf, xrseqs, avp
-                            .getAlignViewport().isNucleotide(), xrefdb);
+                    cra = CrossRefAction.getHandlerFor(xrseqs, avp
+                            .getAlignViewport().isNucleotide(), xrefdb,
+                            nextaf);
                     cra.run();
-                    if (cra.getXrefViews().size() == 0)
+                    cra_views2 = (List) PA.getValue(
+                            cra, "xrefViews");
+                    if (cra_views2.size() == 0)
                     {
                       failedXrefMenuItems
                               .add("No crossrefs retrieved for '"
@@ -303,7 +309,6 @@ public class CrossRef2xmlTests extends Jalview2xmlBase
                                       + " via '" + nextaf.getTitle() + "'");
                       continue;
                     }
-                    cra_views2 = cra.getXrefViews();
                     assertNucleotide(cra_views2.get(0),
                             "Nucleotide panel included proteins for '"
                                     + nextxref + "' to " + xrefdb
@@ -541,8 +546,8 @@ public class CrossRef2xmlTests extends Jalview2xmlBase
    *          viewpanel needs to be called with a distinct xrefpath to ensure
    *          each one's strings are compared)
    */
-  private void stringify(HashMap dbtoviewBit,
-          HashMap savedProjects, String xrefpath,
+  private void stringify(Map dbtoviewBit,
+          Map savedProjects, String xrefpath,
           AlignmentViewPanel avp)
   {
     if (savedProjects != null)
diff --git a/test/jalview/io/FeaturesFileTest.java b/test/jalview/io/FeaturesFileTest.java
index 152ab84..32ca841 100644
--- a/test/jalview/io/FeaturesFileTest.java
+++ b/test/jalview/io/FeaturesFileTest.java
@@ -23,7 +23,9 @@ package jalview.io;
 import static org.testng.AssertJUnit.assertEquals;
 import static org.testng.AssertJUnit.assertFalse;
 import static org.testng.AssertJUnit.assertNotNull;
+import static org.testng.AssertJUnit.assertSame;
 import static org.testng.AssertJUnit.assertTrue;
+import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
 
 import jalview.api.FeatureColourI;
 import jalview.api.FeatureRenderer;
@@ -32,11 +34,17 @@ import jalview.datamodel.AlignmentI;
 import jalview.datamodel.SequenceDummy;
 import jalview.datamodel.SequenceFeature;
 import jalview.datamodel.SequenceI;
+import jalview.datamodel.features.FeatureMatcher;
+import jalview.datamodel.features.FeatureMatcherI;
+import jalview.datamodel.features.FeatureMatcherSet;
+import jalview.datamodel.features.FeatureMatcherSetI;
 import jalview.datamodel.features.SequenceFeatures;
 import jalview.gui.AlignFrame;
 import jalview.gui.Desktop;
 import jalview.gui.JvOptionPane;
+import jalview.schemes.FeatureColour;
 import jalview.structure.StructureSelectionManager;
+import jalview.util.matcher.Condition;
 
 import java.awt.Color;
 import java.io.File;
@@ -44,6 +52,7 @@ import java.io.IOException;
 import java.util.ArrayList;
 import java.util.Arrays;
 import java.util.HashMap;
+import java.util.Iterator;
 import java.util.List;
 import java.util.Map;
 
@@ -467,10 +476,10 @@ public class FeaturesFileTest
      */
     FeatureRenderer fr = af.alignPanel.getFeatureRenderer();
     Map visible = fr.getDisplayedFeatureCols();
-    List visibleGroups = new ArrayList(
+    List visibleGroups = new ArrayList<>(
             Arrays.asList(new String[] {}));
     String exported = featuresFile.printJalviewFormat(
-            al.getSequencesArray(), visible, visibleGroups, false);
+            al.getSequencesArray(), visible, null, visibleGroups, false);
     String expected = "No Features Visible";
     assertEquals(expected, exported);
 
@@ -479,7 +488,7 @@ public class FeaturesFileTest
      */
     visibleGroups.add("uniprot");
     exported = featuresFile.printJalviewFormat(al.getSequencesArray(),
-            visible, visibleGroups, true);
+            visible, null, visibleGroups, true);
     expected = "Cath\tFER_CAPAA\t-1\t0\t0\tDomain\t0.0\n"
             + "desc1\tFER_CAPAN\t-1\t0\t0\tPfam\t1.3\n"
             + "desc3\tFER1_SOLLC\t-1\t0\t0\tPfam\n" // NaN is not output
@@ -493,9 +502,9 @@ public class FeaturesFileTest
     fr.setVisible("GAMMA-TURN");
     visible = fr.getDisplayedFeatureCols();
     exported = featuresFile.printJalviewFormat(al.getSequencesArray(),
-            visible, visibleGroups, false);
+            visible, null, visibleGroups, false);
     expected = "METAL\tcc9900\n"
-            + "GAMMA-TURN\tff0000|00ffff|20.0|95.0|below|66.0\n"
+            + "GAMMA-TURN\tscore|ff0000|00ffff|noValueMin|20.0|95.0|below|66.0\n"
             + "\nSTARTGROUP\tuniprot\n"
             + "Turn\tFER_CAPAA\t-1\t36\t38\tGAMMA-TURN\t0.0\n"
             + "Iron\tFER_CAPAA\t-1\t39\t39\tMETAL\t0.0\n"
@@ -508,13 +517,13 @@ public class FeaturesFileTest
     fr.setVisible("Pfam");
     visible = fr.getDisplayedFeatureCols();
     exported = featuresFile.printJalviewFormat(al.getSequencesArray(),
-            visible, visibleGroups, false);
+            visible, null, visibleGroups, false);
     /*
      * features are output within group, ordered by sequence and by type
      */
     expected = "METAL\tcc9900\n"
             + "Pfam\tff0000\n"
-            + "GAMMA-TURN\tff0000|00ffff|20.0|95.0|below|66.0\n"
+            + "GAMMA-TURN\tscore|ff0000|00ffff|noValueMin|20.0|95.0|below|66.0\n"
             + "\nSTARTGROUP\tuniprot\n"
             + "Turn\tFER_CAPAA\t-1\t36\t38\tGAMMA-TURN\t0.0\n"
             + "Iron\tFER_CAPAA\t-1\t39\t39\tMETAL\t0.0\n"
@@ -539,8 +548,8 @@ public class FeaturesFileTest
      */
     FeaturesFile featuresFile = new FeaturesFile();
     FeatureRenderer fr = af.alignPanel.getFeatureRenderer();
-    Map visible = new HashMap();
-    List visibleGroups = new ArrayList(
+    Map visible = new HashMap<>();
+    List visibleGroups = new ArrayList<>(
             Arrays.asList(new String[] {}));
     String exported = featuresFile.printGffFormat(al.getSequencesArray(),
             visible, visibleGroups, false);
@@ -623,4 +632,79 @@ public class FeaturesFileTest
             + "FER_CAPAN\tUniprot\tPfam\t20\t20\t0.0\t+\t2\tx=y;black=white\n";
     assertEquals(expected, exported);
   }
+
+  /**
+   * Test for parsing of feature filters as represented in a Jalview features
+   * file
+   * 
+   * @throws Exception
+   */
+  @Test(groups = { "Functional" })
+  public void testParseFilters() throws Exception
+  {
+    Map filters = new HashMap<>();
+    String text = "sequence_variant\tCSQ:PolyPhen NotContains 'damaging'\n"
+            + "missense_variant\t(label contains foobar) and (Score lt 1.3)";
+    FeaturesFile featuresFile = new FeaturesFile(text,
+            DataSourceType.PASTE);
+    featuresFile.parseFilters(filters);
+    assertEquals(filters.size(), 2);
+
+    FeatureMatcherSetI fm = filters.get("sequence_variant");
+    assertNotNull(fm);
+    Iterator matchers = fm.getMatchers().iterator();
+    FeatureMatcherI matcher = matchers.next();
+    assertFalse(matchers.hasNext());
+    String[] attributes = matcher.getAttribute();
+    assertArrayEquals(attributes, new String[] { "CSQ", "PolyPhen" });
+    assertSame(matcher.getMatcher().getCondition(), Condition.NotContains);
+    assertEquals(matcher.getMatcher().getPattern(), "damaging");
+
+    fm = filters.get("missense_variant");
+    assertNotNull(fm);
+    matchers = fm.getMatchers().iterator();
+    matcher = matchers.next();
+    assertTrue(matcher.isByLabel());
+    assertSame(matcher.getMatcher().getCondition(), Condition.Contains);
+    assertEquals(matcher.getMatcher().getPattern(), "foobar");
+    matcher = matchers.next();
+    assertTrue(matcher.isByScore());
+    assertSame(matcher.getMatcher().getCondition(), Condition.LT);
+    assertEquals(matcher.getMatcher().getPattern(), "1.3");
+    assertEquals(matcher.getMatcher().getFloatValue(), 1.3f);
+
+    assertFalse(matchers.hasNext());
+  }
+
+  @Test(groups = { "Functional" })
+  public void testOutputFeatureFilters()
+  {
+    FeaturesFile ff = new FeaturesFile();
+    StringBuilder sb = new StringBuilder();
+    Map visible = new HashMap<>();
+    visible.put("pfam", new FeatureColour(Color.red));
+    Map featureFilters = new HashMap<>();
+
+    // with no filters, nothing is output
+    ff.outputFeatureFilters(sb, visible, featureFilters);
+    assertEquals("", sb.toString());
+
+    // with filter for not visible features only, nothing is output
+    FeatureMatcherSet filter = new FeatureMatcherSet();
+    filter.and(FeatureMatcher.byLabel(Condition.Present, null));
+    featureFilters.put("foobar", filter);
+    ff.outputFeatureFilters(sb, visible, featureFilters);
+    assertEquals("", sb.toString());
+
+    // with filters for visible feature types
+    FeatureMatcherSet filter2 = new FeatureMatcherSet();
+    filter2.and(FeatureMatcher.byAttribute(Condition.Present, null, "CSQ",
+            "PolyPhen"));
+    filter2.and(FeatureMatcher.byScore(Condition.LE, "-2.4"));
+    featureFilters.put("pfam", filter2);
+    visible.put("foobar", new FeatureColour(Color.blue));
+    ff.outputFeatureFilters(sb, visible, featureFilters);
+    String expected = "\nSTARTFILTERS\nfoobar\tLabel Present\npfam\t(CSQ:PolyPhen Present) AND (Score LE -2.4)\nENDFILTERS\n\n";
+    assertEquals(expected, sb.toString());
+  }
 }
diff --git a/test/jalview/io/Jalview2xmlTests.java b/test/jalview/io/Jalview2xmlTests.java
index 6abb7e5..e9e0782 100644
--- a/test/jalview/io/Jalview2xmlTests.java
+++ b/test/jalview/io/Jalview2xmlTests.java
@@ -23,11 +23,13 @@ package jalview.io;
 import static org.testng.Assert.assertEquals;
 import static org.testng.Assert.assertFalse;
 import static org.testng.Assert.assertNotNull;
+import static org.testng.Assert.assertNull;
 import static org.testng.Assert.assertSame;
 import static org.testng.Assert.assertTrue;
 
 import jalview.api.AlignViewportI;
 import jalview.api.AlignmentViewPanel;
+import jalview.api.FeatureColourI;
 import jalview.api.ViewStyleI;
 import jalview.datamodel.AlignmentAnnotation;
 import jalview.datamodel.AlignmentI;
@@ -35,12 +37,17 @@ import jalview.datamodel.HiddenSequences;
 import jalview.datamodel.PDBEntry;
 import jalview.datamodel.PDBEntry.Type;
 import jalview.datamodel.SequenceCollectionI;
+import jalview.datamodel.SequenceFeature;
 import jalview.datamodel.SequenceGroup;
 import jalview.datamodel.SequenceI;
+import jalview.datamodel.features.FeatureMatcher;
+import jalview.datamodel.features.FeatureMatcherSet;
+import jalview.datamodel.features.FeatureMatcherSetI;
 import jalview.gui.AlignFrame;
 import jalview.gui.AlignViewport;
 import jalview.gui.AlignmentPanel;
 import jalview.gui.Desktop;
+import jalview.gui.FeatureRenderer;
 import jalview.gui.Jalview2XML;
 import jalview.gui.JvOptionPane;
 import jalview.gui.PopupMenu;
@@ -50,13 +57,16 @@ import jalview.schemes.AnnotationColourGradient;
 import jalview.schemes.BuriedColourScheme;
 import jalview.schemes.ColourSchemeI;
 import jalview.schemes.ColourSchemeProperty;
+import jalview.schemes.FeatureColour;
 import jalview.schemes.JalviewColourScheme;
 import jalview.schemes.RNAHelicesColour;
 import jalview.schemes.StrandColourScheme;
 import jalview.schemes.TCoffeeColourScheme;
 import jalview.structure.StructureImportSettings;
+import jalview.util.matcher.Condition;
 import jalview.viewmodel.AlignmentViewport;
 
+import java.awt.Color;
 import java.io.File;
 import java.io.IOException;
 import java.util.ArrayList;
@@ -413,7 +423,7 @@ public class Jalview2xmlTests extends Jalview2xmlBase
     String afid = af.getViewport().getSequenceSetId();
 
     // remember reference sequence for each panel
-    Map refseqs = new HashMap();
+    Map refseqs = new HashMap<>();
 
     /*
      * mark sequence 2, 3, 4.. in panels 1, 2, 3...
@@ -551,8 +561,8 @@ public class Jalview2xmlTests extends Jalview2xmlBase
      * remember representative and hidden sequences marked 
      * on each panel
      */
-    Map repSeqs = new HashMap();
-    Map> hiddenSeqNames = new HashMap>();
+    Map repSeqs = new HashMap<>();
+    Map> hiddenSeqNames = new HashMap<>();
 
     /*
      * mark sequence 2, 3, 4.. in panels 1, 2, 3...
@@ -568,7 +578,7 @@ public class Jalview2xmlTests extends Jalview2xmlBase
       repIndex = Math.max(repIndex, 1);
       SequenceI repSeq = alignment.getSequenceAt(repIndex);
       repSeqs.put(ap.getViewName(), repSeq);
-      List hiddenNames = new ArrayList();
+      List hiddenNames = new ArrayList<>();
       hiddenSeqNames.put(ap.getViewName(), hiddenNames);
 
       /*
@@ -841,4 +851,163 @@ public class Jalview2xmlTests extends Jalview2xmlBase
     assertTrue(rs.conservationApplied());
     assertEquals(rs.getConservationInc(), 30);
   }
+
+  /**
+   * Test save and reload of feature colour schemes and filter settings
+   * 
+   * @throws IOException
+   */
+  @Test(groups = { "Functional" })
+  public void testSaveLoadFeatureColoursAndFilters() throws IOException
+  {
+    AlignFrame af = new FileLoader().LoadFileWaitTillLoaded(
+            ">Seq1\nACDEFGHIKLM", DataSourceType.PASTE);
+    SequenceI seq1 = af.getViewport().getAlignment().getSequenceAt(0);
+
+    /*
+     * add some features to the sequence
+     */
+    int score = 1;
+    addFeatures(seq1, "type1", score++);
+    addFeatures(seq1, "type2", score++);
+    addFeatures(seq1, "type3", score++);
+    addFeatures(seq1, "type4", score++);
+    addFeatures(seq1, "type5", score++);
+
+    /*
+     * set colour schemes for features
+     */
+    FeatureRenderer fr = af.getFeatureRenderer();
+    fr.findAllFeatures(true);
+
+    // type1: red
+    fr.setColour("type1", new FeatureColour(Color.red));
+
+    // type2: by label
+    FeatureColourI byLabel = new FeatureColour();
+    byLabel.setColourByLabel(true);
+    fr.setColour("type2", byLabel);
+
+    // type3: by score above threshold
+    FeatureColourI byScore = new FeatureColour(Color.BLACK, Color.BLUE, 1,
+            10);
+    byScore.setAboveThreshold(true);
+    byScore.setThreshold(2f);
+    fr.setColour("type3", byScore);
+
+    // type4: by attribute AF
+    FeatureColourI byAF = new FeatureColour();
+    byAF.setColourByLabel(true);
+    byAF.setAttributeName("AF");
+    fr.setColour("type4", byAF);
+
+    // type5: by attribute CSQ:PolyPhen below threshold
+    FeatureColourI byPolyPhen = new FeatureColour(Color.BLACK, Color.BLUE,
+            1, 10);
+    byPolyPhen.setBelowThreshold(true);
+    byPolyPhen.setThreshold(3f);
+    byPolyPhen.setAttributeName("CSQ", "PolyPhen");
+    fr.setColour("type5", byPolyPhen);
+
+    /*
+     * set filters for feature types
+     */
+
+    // filter type1 features by (label contains "x")
+    FeatureMatcherSetI filterByX = new FeatureMatcherSet();
+    filterByX.and(FeatureMatcher.byLabel(Condition.Contains, "x"));
+    fr.setFeatureFilter("type1", filterByX);
+
+    // filter type2 features by (score <= 2.4 and score > 1.1)
+    FeatureMatcherSetI filterByScore = new FeatureMatcherSet();
+    filterByScore.and(FeatureMatcher.byScore(Condition.LE, "2.4"));
+    filterByScore.and(FeatureMatcher.byScore(Condition.GT, "1.1"));
+    fr.setFeatureFilter("type2", filterByScore);
+
+    // filter type3 features by (AF contains X OR CSQ:PolyPhen != 0)
+    FeatureMatcherSetI filterByXY = new FeatureMatcherSet();
+    filterByXY
+            .and(FeatureMatcher.byAttribute(Condition.Contains, "X", "AF"));
+    filterByXY.or(FeatureMatcher.byAttribute(Condition.NE, "0", "CSQ",
+            "PolyPhen"));
+    fr.setFeatureFilter("type3", filterByXY);
+
+    /*
+     * save as Jalview project
+     */
+    File tfile = File.createTempFile("JalviewTest", ".jvp");
+    tfile.deleteOnExit();
+    String filePath = tfile.getAbsolutePath();
+    assertTrue(af.saveAlignment(filePath, FileFormat.Jalview),
+            "Failed to store as a project.");
+
+    /*
+     * close current alignment and load the saved project
+     */
+    af.closeMenuItem_actionPerformed(true);
+    af = null;
+    af = new FileLoader()
+            .LoadFileWaitTillLoaded(filePath, DataSourceType.FILE);
+    assertNotNull(af, "Failed to import new project");
+
+    /*
+     * verify restored feature colour schemes and filters
+     */
+    fr = af.getFeatureRenderer();
+    FeatureColourI fc = fr.getFeatureStyle("type1");
+    assertTrue(fc.isSimpleColour());
+    assertEquals(fc.getColour(), Color.red);
+    fc = fr.getFeatureStyle("type2");
+    assertTrue(fc.isColourByLabel());
+    fc = fr.getFeatureStyle("type3");
+    assertTrue(fc.isGraduatedColour());
+    assertNull(fc.getAttributeName());
+    assertTrue(fc.isAboveThreshold());
+    assertEquals(fc.getThreshold(), 2f);
+    fc = fr.getFeatureStyle("type4");
+    assertTrue(fc.isColourByLabel());
+    assertTrue(fc.isColourByAttribute());
+    assertEquals(fc.getAttributeName(), new String[] { "AF" });
+    fc = fr.getFeatureStyle("type5");
+    assertTrue(fc.isGraduatedColour());
+    assertTrue(fc.isColourByAttribute());
+    assertEquals(fc.getAttributeName(), new String[] { "CSQ", "PolyPhen" });
+    assertTrue(fc.isBelowThreshold());
+    assertEquals(fc.getThreshold(), 3f);
+
+    assertEquals(fr.getFeatureFilter("type1").toStableString(),
+            "Label Contains x");
+    assertEquals(fr.getFeatureFilter("type2").toStableString(),
+            "(Score LE 2.4) AND (Score GT 1.1)");
+    assertEquals(fr.getFeatureFilter("type3").toStableString(),
+            "(AF Contains X) OR (CSQ:PolyPhen NE 0.0)");
+  }
+
+  private void addFeature(SequenceI seq, String featureType, int score)
+  {
+    SequenceFeature sf = new SequenceFeature(featureType, "desc", 1, 2,
+            score, "grp");
+    sf.setValue("AF", score);
+    sf.setValue("CSQ", new HashMap()
+    {
+      {
+        put("PolyPhen", Integer.toString(score));
+      }
+    });
+    seq.addSequenceFeature(sf);
+  }
+
+  /**
+   * Adds two features of the given type to the given sequence, also setting the
+   * score as the value of attribute "AF" and sub-attribute "CSQ:PolyPhen"
+   * 
+   * @param seq
+   * @param featureType
+   * @param score
+   */
+  private void addFeatures(SequenceI seq, String featureType, int score)
+  {
+    addFeature(seq, featureType, score++);
+    addFeature(seq, featureType, score);
+  }
 }
diff --git a/test/jalview/io/SequenceAnnotationReportTest.java b/test/jalview/io/SequenceAnnotationReportTest.java
index 9e61bec..87e35c7 100644
--- a/test/jalview/io/SequenceAnnotationReportTest.java
+++ b/test/jalview/io/SequenceAnnotationReportTest.java
@@ -23,15 +23,18 @@ package jalview.io;
 import static org.testng.AssertJUnit.assertEquals;
 import static org.testng.AssertJUnit.assertTrue;
 
+import jalview.api.FeatureColourI;
 import jalview.datamodel.DBRefEntry;
 import jalview.datamodel.Sequence;
 import jalview.datamodel.SequenceFeature;
 import jalview.datamodel.SequenceI;
 import jalview.gui.JvOptionPane;
 import jalview.io.gff.GffConstants;
+import jalview.renderer.seqfeatures.FeatureRenderer;
+import jalview.schemes.FeatureColour;
+import jalview.viewmodel.seqfeatures.FeatureRendererModel;
 
-import java.util.HashMap;
-import java.util.Hashtable;
+import java.awt.Color;
 import java.util.Map;
 
 import junit.extensions.PA;
@@ -95,8 +98,9 @@ public class SequenceAnnotationReportTest
     SequenceFeature sf = new SequenceFeature("METAL", "Fe2-S", 1, 3, 1.3f,
             "group");
 
-    Map minmax = new Hashtable();
-    sar.appendFeature(sb, 1, minmax, sf);
+    FeatureRendererModel fr = new FeatureRenderer(null);
+    Map minmax = fr.getMinMax();
+    sar.appendFeature(sb, 1, fr, sf);
     /*
      * map has no entry for this feature type - score is not shown:
      */
@@ -106,7 +110,7 @@ public class SequenceAnnotationReportTest
      * map has entry for this feature type - score is shown:
      */
     minmax.put("METAL", new float[][] { { 0f, 1f }, null });
-    sar.appendFeature(sb, 1, minmax, sf);
+    sar.appendFeature(sb, 1, fr, sf);
     // 
 is appended to a buffer > 6 in length
     assertEquals("METAL 1 3; Fe2-S
METAL 1 3; Fe2-S Score=1.3",
             sb.toString());
@@ -116,7 +120,7 @@ public class SequenceAnnotationReportTest
      */
     minmax.put("METAL", new float[][] { { 2f, 2f }, null });
     sb.setLength(0);
-    sar.appendFeature(sb, 1, minmax, sf);
+    sar.appendFeature(sb, 1, fr, sf);
     assertEquals("METAL 1 3; Fe2-S", sb.toString());
   }
 
@@ -132,8 +136,11 @@ public class SequenceAnnotationReportTest
     assertEquals("METAL 1 3; Fe2-S", sb.toString());
   }
 
+  /**
+   * A specific attribute value is included if it is used to colour the feature
+   */
   @Test(groups = "Functional")
-  public void testAppendFeature_clinicalSignificance()
+  public void testAppendFeature_colouredByAttribute()
   {
     SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
     StringBuilder sb = new StringBuilder();
@@ -141,12 +148,35 @@ public class SequenceAnnotationReportTest
             Float.NaN, "group");
     sf.setValue("clinical_significance", "Benign");
 
-    sar.appendFeature(sb, 1, null, sf);
-    assertEquals("METAL 1 3; Fe2-S; Benign", sb.toString());
+    /*
+     * first with no colour by attribute
+     */
+    FeatureRendererModel fr = new FeatureRenderer(null);
+    sar.appendFeature(sb, 1, fr, sf);
+    assertEquals("METAL 1 3; Fe2-S", sb.toString());
+
+    /*
+     * then with colour by an attribute the feature lacks
+     */
+    FeatureColourI fc = new FeatureColour(Color.white, Color.black, 5, 10);
+    fc.setAttributeName("Pfam");
+    fr.setColour("METAL", fc);
+    sb.setLength(0);
+    sar.appendFeature(sb, 1, fr, sf);
+    assertEquals("METAL 1 3; Fe2-S", sb.toString()); // no change
+
+    /*
+     * then with colour by an attribute the feature has
+     */
+    fc.setAttributeName("clinical_significance");
+    sb.setLength(0);
+    sar.appendFeature(sb, 1, fr, sf);
+    assertEquals("METAL 1 3; Fe2-S; clinical_significance=Benign",
+            sb.toString());
   }
 
   @Test(groups = "Functional")
-  public void testAppendFeature_withScoreStatusClinicalSignificance()
+  public void testAppendFeature_withScoreStatusAttribute()
   {
     SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
     StringBuilder sb = new StringBuilder();
@@ -154,11 +184,17 @@ public class SequenceAnnotationReportTest
             "group");
     sf.setStatus("Confirmed");
     sf.setValue("clinical_significance", "Benign");
-    Map minmax = new Hashtable();
+
+    FeatureRendererModel fr = new FeatureRenderer(null);
+    Map minmax = fr.getMinMax();
+    FeatureColourI fc = new FeatureColour(Color.white, Color.blue, 12, 22);
+    fc.setAttributeName("clinical_significance");
+    fr.setColour("METAL", fc);
     minmax.put("METAL", new float[][] { { 0f, 1f }, null });
-    sar.appendFeature(sb, 1, minmax, sf);
+    sar.appendFeature(sb, 1, fr, sf);
 
-    assertEquals("METAL 1 3; Fe2-S Score=1.3; (Confirmed); Benign",
+    assertEquals(
+            "METAL 1 3; Fe2-S Score=1.3; (Confirmed); clinical_significance=Benign",
             sb.toString());
   }
 
@@ -226,7 +262,7 @@ public class SequenceAnnotationReportTest
             null));
     sb.setLength(0);
     sar.createSequenceAnnotationReport(sb, seq, true, true, null);
-    String expected = "
SeqDesc
Type1 ; Nonpos";
+    String expected = "
SeqDesc
Type1 ; Nonpos Score=1.0";
     assertEquals(expected, sb.toString());
 
     /*
@@ -244,10 +280,13 @@ public class SequenceAnnotationReportTest
      */
     seq.addSequenceFeature(new SequenceFeature("Metal", "Desc", 0, 0, 5f,
             null));
-    Map minmax = new HashMap();
+
+    FeatureRendererModel fr = new FeatureRenderer(null);
+    Map minmax = fr.getMinMax();
     minmax.put("Metal", new float[][] { null, new float[] { 2f, 5f } });
+
     sb.setLength(0);
-    sar.createSequenceAnnotationReport(sb, seq, true, true, minmax);
+    sar.createSequenceAnnotationReport(sb, seq, true, true, fr);
     expected = "
SeqDesc
Metal ; Desc
Type1 ; Nonpos";
     assertEquals(expected, sb.toString());
     
@@ -260,19 +299,20 @@ public class SequenceAnnotationReportTest
     sf.setValue("linkonly", Boolean.TRUE);
     seq.addSequenceFeature(sf);
     sb.setLength(0);
-    sar.createSequenceAnnotationReport(sb, seq, true, true, minmax);
+    sar.createSequenceAnnotationReport(sb, seq, true, true, fr);
     assertEquals(expected, sb.toString()); // unchanged!
 
     /*
-     * 'clinical_significance' currently being specially included
+     * 'clinical_significance' attribute only included when
+     * used for feature colouring
      */
     SequenceFeature sf2 = new SequenceFeature("Variant", "Havana", 0, 0,
             5f, null);
     sf2.setValue(GffConstants.CLINICAL_SIGNIFICANCE, "benign");
     seq.addSequenceFeature(sf2);
     sb.setLength(0);
-    sar.createSequenceAnnotationReport(sb, seq, true, true, minmax);
-    expected = "
SeqDesc
Metal ; Desc
Type1 ; Nonpos
Variant ; Havana; benign";
+    sar.createSequenceAnnotationReport(sb, seq, true, true, fr);
+    expected = "
SeqDesc
Metal ; Desc
Type1 ; Nonpos
Variant ; Havana";
     assertEquals(expected, sb.toString());
 
     /*
@@ -280,18 +320,24 @@ public class SequenceAnnotationReportTest
      */
     seq.addDBRef(new DBRefEntry("PDB", "0", "3iu1"));
     seq.addDBRef(new DBRefEntry("Uniprot", "1", "P30419"));
+
     // with showDbRefs = false
     sb.setLength(0);
-    sar.createSequenceAnnotationReport(sb, seq, false, true, minmax);
+    sar.createSequenceAnnotationReport(sb, seq, false, true, fr);
     assertEquals(expected, sb.toString()); // unchanged
-    // with showDbRefs = true
+
+    // with showDbRefs = true, colour Variant features by clinical_significance
     sb.setLength(0);
-    sar.createSequenceAnnotationReport(sb, seq, true, true, minmax);
-    expected = "
SeqDesc
UNIPROT P30419
PDB 3iu1
Metal ; Desc
Type1 ; Nonpos
Variant ; Havana; benign";
+    FeatureColourI fc = new FeatureColour(Color.green, Color.pink, 2, 3);
+    fc.setAttributeName("clinical_significance");
+    fr.setColour("Variant", fc);
+    sar.createSequenceAnnotationReport(sb, seq, true, true, fr);
+    expected = "
SeqDesc
UNIPROT P30419
PDB 3iu1
Metal ; Desc
"
+            + "Type1 ; Nonpos
Variant ; Havana; clinical_significance=benign";
     assertEquals(expected, sb.toString());
     // with showNonPositionalFeatures = false
     sb.setLength(0);
-    sar.createSequenceAnnotationReport(sb, seq, true, false, minmax);
+    sar.createSequenceAnnotationReport(sb, seq, true, false, fr);
     expected = "
SeqDesc
UNIPROT P30419
PDB 3iu1";
     assertEquals(expected, sb.toString());
 
diff --git a/test/jalview/io/gff/SequenceOntologyLiteTest.java b/test/jalview/io/gff/SequenceOntologyLiteTest.java
new file mode 100644
index 0000000..0766666
--- /dev/null
+++ b/test/jalview/io/gff/SequenceOntologyLiteTest.java
@@ -0,0 +1,37 @@
+package jalview.io.gff;
+
+import static org.testng.AssertJUnit.assertFalse;
+import static org.testng.AssertJUnit.assertTrue;
+
+import org.testng.annotations.Test;
+
+public class SequenceOntologyLiteTest
+{
+  @Test(groups = "Functional")
+  public void testIsA_sequenceVariant()
+  {
+    SequenceOntologyI so = new SequenceOntologyLite();
+
+    assertFalse(so.isA("CDS", "sequence_variant"));
+    assertTrue(so.isA("sequence_variant", "sequence_variant"));
+
+    /*
+     * these should all be sub-types of sequence_variant
+     */
+    assertTrue(so.isA("structural_variant", "sequence_variant"));
+    assertTrue(so.isA("feature_variant", "sequence_variant"));
+    assertTrue(so.isA("gene_variant", "sequence_variant"));
+    assertTrue(so.isA("transcript_variant", "sequence_variant"));
+    assertTrue(so.isA("NMD_transcript_variant", "sequence_variant"));
+    assertTrue(so.isA("missense_variant", "sequence_variant"));
+    assertTrue(so.isA("synonymous_variant", "sequence_variant"));
+    assertTrue(so.isA("frameshift_variant", "sequence_variant"));
+    assertTrue(so.isA("5_prime_UTR_variant", "sequence_variant"));
+    assertTrue(so.isA("3_prime_UTR_variant", "sequence_variant"));
+    assertTrue(so.isA("stop_gained", "sequence_variant"));
+    assertTrue(so.isA("stop_lost", "sequence_variant"));
+    assertTrue(so.isA("inframe_deletion", "sequence_variant"));
+    assertTrue(so.isA("inframe_insertion", "sequence_variant"));
+    assertTrue(so.isA("splice_region_variant", "sequence_variant"));
+  }
+}
diff --git a/test/jalview/io/vcf/VCFLoaderTest.java b/test/jalview/io/vcf/VCFLoaderTest.java
new file mode 100644
index 0000000..7099282
--- /dev/null
+++ b/test/jalview/io/vcf/VCFLoaderTest.java
@@ -0,0 +1,681 @@
+package jalview.io.vcf;
+
+import static org.testng.Assert.assertEquals;
+
+import jalview.bin.Cache;
+import jalview.datamodel.AlignmentI;
+import jalview.datamodel.DBRefEntry;
+import jalview.datamodel.Mapping;
+import jalview.datamodel.Sequence;
+import jalview.datamodel.SequenceFeature;
+import jalview.datamodel.SequenceI;
+import jalview.datamodel.features.SequenceFeatures;
+import jalview.gui.AlignFrame;
+import jalview.io.DataSourceType;
+import jalview.io.FileLoader;
+import jalview.io.gff.Gff3Helper;
+import jalview.io.gff.SequenceOntologyI;
+import jalview.util.MapList;
+
+import java.io.File;
+import java.io.IOException;
+import java.io.PrintWriter;
+import java.util.List;
+import java.util.Map;
+
+import org.testng.annotations.BeforeClass;
+import org.testng.annotations.Test;
+
+public class VCFLoaderTest
+{
+  private static final float DELTA = 0.00001f;
+
+  // columns 9717- of gene P30419 from Ensembl (much modified)
+  private static final String FASTA = ""
+          +
+          /*
+           * forward strand 'gene' and 'transcript' with two exons
+           */
+          ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n"
+          + "CAAGCTGGCGGACGAGAGTGTGACA\n"
+          + ">transcript1/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
+
+          /*
+           * reverse strand gene and transcript (reverse complement alleles!)
+           */
+          + ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n"
+          + "TGTCACACTCTCGTCCGCCAGCTTG\n"
+          + ">transcript2/1-18\n" + "-GTCACACTCT----CGCCAGCT--\n"
+
+          /*
+           * 'gene' on chromosome 5 with two transcripts
+           */
+          + ">gene3/1-25 chromosome:GRCh38:5:45051610:45051634:1\n"
+          + "CAAGCTGGCGGACGAGAGTGTGACA\n"
+          + ">transcript3/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
+          + ">transcript4/1-18\n-----TGG-GGACGAGAGTGTGA-A\n";
+
+  private static final String[] VCF = { "##fileformat=VCFv4.2",
+      "##INFO=",
+      "##reference=Homo_sapiens/GRCh38",
+      "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO",
+      // A/T,C variants in position 2 of gene sequence (precedes transcript)
+      // should create 2 variant features with respective scores
+      "17\t45051611\t.\tA\tT,C\t1666.64\tRF\tAC=15;AF=5.0e-03,4.0e-03",
+      // SNP G/C in position 4 of gene sequence, position 2 of transcript
+      // insertion G/GA is transferred to nucleotide but not to peptide
+      "17\t45051613\t.\tG\tGA,C\t1666.64\tRF\tAC=15;AF=3.0e-03,2.0e-03" };
+
+  @BeforeClass
+  public void setUp()
+  {
+    /*
+     * configure to capture all available VCF and VEP (CSQ) fields
+     */
+    Cache.loadProperties("test/jalview/io/testProps.jvprops");
+    Cache.setProperty("VCF_FIELDS", ".*");
+    Cache.setProperty("VEP_FIELDS", ".*");
+    Cache.initLogger();
+  }
+
+  @Test(groups = "Functional")
+  public void testDoLoad() throws IOException
+  {
+    AlignmentI al = buildAlignment();
+
+    File f = makeVcf();
+    VCFLoader loader = new VCFLoader(f.getPath());
+
+    loader.doLoad(al.getSequencesArray(), null);
+
+    /*
+     * verify variant feature(s) added to gene
+     * NB alleles at a locus may not be processed, and features added,
+     * in the order in which they appear in the VCF record as method
+     * VariantContext.getAlternateAlleles() does not guarantee order
+     * - order of assertions here matches what we find (is not important) 
+     */
+    List geneFeatures = al.getSequenceAt(0)
+            .getSequenceFeatures();
+    SequenceFeatures.sortFeatures(geneFeatures, true);
+    assertEquals(geneFeatures.size(), 4);
+    SequenceFeature sf = geneFeatures.get(0);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 2);
+    assertEquals(sf.getEnd(), 2);
+    assertEquals(sf.getScore(), 4.0e-03, DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,C");
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    sf = geneFeatures.get(1);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 2);
+    assertEquals(sf.getEnd(), 2);
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 5.0e-03, DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,T");
+
+    sf = geneFeatures.get(2);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 4);
+    assertEquals(sf.getEnd(), 4);
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 2.0e-03, DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
+
+    sf = geneFeatures.get(3);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 4);
+    assertEquals(sf.getEnd(), 4);
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 3.0e-03, DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
+
+    /*
+     * verify variant feature(s) added to transcript
+     */
+    List transcriptFeatures = al.getSequenceAt(1)
+            .getSequenceFeatures();
+    assertEquals(transcriptFeatures.size(), 2);
+    sf = transcriptFeatures.get(0);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 2);
+    assertEquals(sf.getEnd(), 2);
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 2.0e-03, DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
+    sf = transcriptFeatures.get(1);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 2);
+    assertEquals(sf.getEnd(), 2);
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 3.0e-03, DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
+
+    /*
+     * verify SNP variant feature(s) computed and added to protein
+     * first codon AGC varies to ACC giving S/T
+     */
+    DBRefEntry[] dbRefs = al.getSequenceAt(1).getDBRefs();
+    SequenceI peptide = null;
+    for (DBRefEntry dbref : dbRefs)
+    {
+      if (dbref.getMap().getMap().getFromRatio() == 3)
+      {
+        peptide = dbref.getMap().getTo();
+      }
+    }
+    List proteinFeatures = peptide.getSequenceFeatures();
+    assertEquals(proteinFeatures.size(), 1);
+    sf = proteinFeatures.get(0);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 1);
+    assertEquals(sf.getEnd(), 1);
+    assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
+    assertEquals(sf.getDescription(), "p.Ser1Thr");
+  }
+
+  private File makeVcf() throws IOException
+  {
+    File f = File.createTempFile("Test", ".vcf");
+    f.deleteOnExit();
+    PrintWriter pw = new PrintWriter(f);
+    for (String vcfLine : VCF)
+    {
+      pw.println(vcfLine);
+    }
+    pw.close();
+    return f;
+  }
+
+  /**
+   * Make a simple alignment with one 'gene' and one 'transcript'
+   * 
+   * @return
+   */
+  private AlignmentI buildAlignment()
+  {
+    AlignFrame af = new FileLoader().LoadFileWaitTillLoaded(FASTA,
+            DataSourceType.PASTE);
+
+    /*
+     * map gene1 sequence to chromosome (normally done when the sequence is fetched
+     * from Ensembl and transcripts computed)
+     */
+    AlignmentI alignment = af.getViewport().getAlignment();
+    SequenceI gene1 = alignment.findName("gene1");
+    int[] to = new int[] { 45051610, 45051634 };
+    int[] from = new int[] { gene1.getStart(), gene1.getEnd() };
+    gene1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
+            1, 1));
+
+    /*
+     * map 'transcript1' to chromosome via 'gene1'
+     * transcript1/1-18 is gene1/3-10,15-24
+     * which is chromosome 45051612-45051619,45051624-45051633
+     */
+    to = new int[] { 45051612, 45051619, 45051624, 45051633 };
+    SequenceI transcript1 = alignment.findName("transcript1");
+    from = new int[] { transcript1.getStart(), transcript1.getEnd() };
+    transcript1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
+            from, to,
+            1, 1));
+
+    /*
+     * map gene2 to chromosome reverse strand
+     */
+    SequenceI gene2 = alignment.findName("gene2");
+    to = new int[] { 45051634, 45051610 };
+    from = new int[] { gene2.getStart(), gene2.getEnd() };
+    gene2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
+            1, 1));
+
+    /*
+     * map 'transcript2' to chromosome via 'gene2'
+     * transcript2/1-18 is gene2/2-11,16-23
+     * which is chromosome 45051633-45051624,45051619-45051612
+     */
+    to = new int[] { 45051633, 45051624, 45051619, 45051612 };
+    SequenceI transcript2 = alignment.findName("transcript2");
+    from = new int[] { transcript2.getStart(), transcript2.getEnd() };
+    transcript2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
+            from, to,
+            1, 1));
+
+    /*
+     * add a protein product as a DBRef on transcript1
+     */
+    SequenceI peptide1 = new Sequence("ENSP001", "SWRECD");
+    MapList mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 },
+            3, 1);
+    Mapping map = new Mapping(peptide1, mapList);
+    DBRefEntry product = new DBRefEntry("", "", "ENSP001", map);
+    transcript1.addDBRef(product);
+
+    /*
+     * add a protein product as a DBRef on transcript2
+     */
+    SequenceI peptide2 = new Sequence("ENSP002", "VTLSPA");
+    mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
+    map = new Mapping(peptide2, mapList);
+    product = new DBRefEntry("", "", "ENSP002", map);
+    transcript2.addDBRef(product);
+
+    /*
+     * map gene3 to chromosome 
+     */
+    SequenceI gene3 = alignment.findName("gene3");
+    to = new int[] { 45051610, 45051634 };
+    from = new int[] { gene3.getStart(), gene3.getEnd() };
+    gene3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(from, to,
+            1, 1));
+
+    /*
+     * map 'transcript3' to chromosome
+     */
+    SequenceI transcript3 = alignment.findName("transcript3");
+    to = new int[] { 45051612, 45051619, 45051624, 45051633 };
+    from = new int[] { transcript3.getStart(), transcript3.getEnd() };
+    transcript3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
+            from, to,
+            1, 1));
+
+    /*
+     * map 'transcript4' to chromosome
+     */
+    SequenceI transcript4 = alignment.findName("transcript4");
+    to = new int[] { 45051615, 45051617, 45051619, 45051632, 45051634,
+        45051634 };
+    from = new int[] { transcript4.getStart(), transcript4.getEnd() };
+    transcript4.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
+            from, to,
+            1, 1));
+
+    /*
+     * add a protein product as a DBRef on transcript3
+     */
+    SequenceI peptide3 = new Sequence("ENSP003", "SWRECD");
+    mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
+    map = new Mapping(peptide3, mapList);
+    product = new DBRefEntry("", "", "ENSP003", map);
+    transcript3.addDBRef(product);
+
+    return alignment;
+  }
+
+  /**
+   * Test with 'gene' and 'transcript' mapped to the reverse strand of the
+   * chromosome. The VCF variant positions (in forward coordinates) should get
+   * correctly located on sequence positions.
+   * 
+   * @throws IOException
+   */
+  @Test(groups = "Functional")
+  public void testDoLoad_reverseStrand() throws IOException
+  {
+    AlignmentI al = buildAlignment();
+
+    File f = makeVcf();
+
+    VCFLoader loader = new VCFLoader(f.getPath());
+
+    loader.doLoad(al.getSequencesArray(), null);
+
+    /*
+     * verify variant feature(s) added to gene2
+     * gene2/1-25 maps to chromosome 45051634- reverse strand
+     */
+    List geneFeatures = al.getSequenceAt(2)
+            .getSequenceFeatures();
+    SequenceFeatures.sortFeatures(geneFeatures, true);
+    assertEquals(geneFeatures.size(), 4);
+
+    /*
+     * variant A/T at 45051611 maps to T/A at gene position 24
+     */
+    SequenceFeature sf = geneFeatures.get(3);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 24);
+    assertEquals(sf.getEnd(), 24);
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 5.0e-03, DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,A");
+
+    /*
+     * variant A/C at 45051611 maps to T/G at gene position 24
+     */
+    sf = geneFeatures.get(2);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 24);
+    assertEquals(sf.getEnd(), 24);
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 4.0e-03, DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,G");
+
+    /*
+     * variant G/C at 45051613 maps to C/G at gene position 22
+     */
+    sf = geneFeatures.get(1);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 22);
+    assertEquals(sf.getEnd(), 22);
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 2.0e-03, DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
+
+    /*
+     * insertion G/GA at 45051613 maps to an insertion at
+     * the preceding position (21) on reverse strand gene
+     * reference: CAAGC -> GCTTG/21-25
+     * genomic variant: CAAGAC (G/GA)
+     * gene variant: GTCTTG (G/GT at 21)
+     */
+    sf = geneFeatures.get(0);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 21);
+    assertEquals(sf.getEnd(), 21);
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 3.0e-03, DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
+
+    /*
+     * verify 2 variant features added to transcript2
+     */
+    List transcriptFeatures = al.getSequenceAt(3)
+            .getSequenceFeatures();
+    assertEquals(transcriptFeatures.size(), 2);
+
+    /*
+     * insertion G/GT at position 21 of gene maps to position 16 of transcript
+     */
+    sf = transcriptFeatures.get(0);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 16);
+    assertEquals(sf.getEnd(), 16);
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 3.0e-03, DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
+
+    /*
+     * SNP C/G at position 22 of gene maps to position 17 of transcript
+     */
+    sf = transcriptFeatures.get(1);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 17);
+    assertEquals(sf.getEnd(), 17);
+    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 2.0e-03, DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
+
+    /*
+     * verify variant feature(s) computed and added to protein
+     * last codon GCT varies to GGT giving A/G in the last peptide position
+     */
+    DBRefEntry[] dbRefs = al.getSequenceAt(3).getDBRefs();
+    SequenceI peptide = null;
+    for (DBRefEntry dbref : dbRefs)
+    {
+      if (dbref.getMap().getMap().getFromRatio() == 3)
+      {
+        peptide = dbref.getMap().getTo();
+      }
+    }
+    List proteinFeatures = peptide.getSequenceFeatures();
+    assertEquals(proteinFeatures.size(), 1);
+    sf = proteinFeatures.get(0);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 6);
+    assertEquals(sf.getEnd(), 6);
+    assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
+    assertEquals(sf.getDescription(), "p.Ala6Gly");
+  }
+
+  /**
+   * Tests that if VEP consequence (CSQ) data is present in the VCF data, then
+   * it is added to the variant feature, but restricted where possible to the
+   * consequences for a specific transcript
+   * 
+   * @throws IOException
+   */
+  @Test(groups = "Functional")
+  public void testDoLoad_vepCsq() throws IOException
+  {
+    AlignmentI al = buildAlignment();
+
+    VCFLoader loader = new VCFLoader("test/jalview/io/vcf/testVcf.vcf");
+
+    /*
+     * VCF data file with variants at gene3 positions
+     * 1 C/A
+     * 5 C/T
+     * 9 CGT/C (deletion)
+     * 13 C/G, C/T
+     * 17 A/AC (insertion), A/G
+     */
+    loader.doLoad(al.getSequencesArray(), null);
+
+    /*
+     * verify variant feature(s) added to gene3
+     */
+    List geneFeatures = al.findName("gene3")
+            .getSequenceFeatures();
+    SequenceFeatures.sortFeatures(geneFeatures, true);
+    assertEquals(geneFeatures.size(), 7);
+    SequenceFeature sf = geneFeatures.get(0);
+    assertEquals(sf.getBegin(), 1);
+    assertEquals(sf.getEnd(), 1);
+    assertEquals(sf.getScore(), 0.1f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,A");
+    // gene features include Consequence for all transcripts
+    Map map = (Map) sf.getValue("CSQ");
+    assertEquals(map.size(), 9);
+
+    sf = geneFeatures.get(1);
+    assertEquals(sf.getBegin(), 5);
+    assertEquals(sf.getEnd(), 5);
+    assertEquals(sf.getScore(), 0.2f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,T");
+    map = (Map) sf.getValue("CSQ");
+    assertEquals(map.size(), 9);
+
+    sf = geneFeatures.get(2);
+    assertEquals(sf.getBegin(), 9);
+    assertEquals(sf.getEnd(), 11); // deletion over 3 positions
+    assertEquals(sf.getScore(), 0.3f, DELTA);
+    assertEquals(sf.getValue("alleles"), "CGG,C");
+    map = (Map) sf.getValue("CSQ");
+    assertEquals(map.size(), 9);
+
+    sf = geneFeatures.get(3);
+    assertEquals(sf.getBegin(), 13);
+    assertEquals(sf.getEnd(), 13);
+    assertEquals(sf.getScore(), 0.5f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,T");
+    map = (Map) sf.getValue("CSQ");
+    assertEquals(map.size(), 9);
+
+    sf = geneFeatures.get(4);
+    assertEquals(sf.getBegin(), 13);
+    assertEquals(sf.getEnd(), 13);
+    assertEquals(sf.getScore(), 0.4f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,G");
+    map = (Map) sf.getValue("CSQ");
+    assertEquals(map.size(), 9);
+
+    sf = geneFeatures.get(5);
+    assertEquals(sf.getBegin(), 17);
+    assertEquals(sf.getEnd(), 17);
+    assertEquals(sf.getScore(), 0.7f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,G");
+    map = (Map) sf.getValue("CSQ");
+    assertEquals(map.size(), 9);
+
+    sf = geneFeatures.get(6);
+    assertEquals(sf.getBegin(), 17);
+    assertEquals(sf.getEnd(), 17); // insertion
+    assertEquals(sf.getScore(), 0.6f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,AC");
+    map = (Map) sf.getValue("CSQ");
+    assertEquals(map.size(), 9);
+
+    /*
+     * verify variant feature(s) added to transcript3
+     * at columns 5 (1), 17 (2), positions 3, 11
+     * note the deletion at columns 9-11 is not transferred since col 11
+     * has no mapping to transcript 3 
+     */
+    List transcriptFeatures = al.findName("transcript3")
+            .getSequenceFeatures();
+    SequenceFeatures.sortFeatures(transcriptFeatures, true);
+    assertEquals(transcriptFeatures.size(), 3);
+    sf = transcriptFeatures.get(0);
+    assertEquals(sf.getBegin(), 3);
+    assertEquals(sf.getEnd(), 3);
+    assertEquals(sf.getScore(), 0.2f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,T");
+    // transcript features only have Consequence for that transcripts
+    map = (Map) sf.getValue("CSQ");
+    assertEquals(map.size(), 9);
+    assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
+
+    sf = transcriptFeatures.get(1);
+    assertEquals(sf.getBegin(), 11);
+    assertEquals(sf.getEnd(), 11);
+    assertEquals(sf.getScore(), 0.7f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,G");
+    assertEquals(map.size(), 9);
+    assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
+
+    sf = transcriptFeatures.get(2);
+    assertEquals(sf.getBegin(), 11);
+    assertEquals(sf.getEnd(), 11);
+    assertEquals(sf.getScore(), 0.6f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,AC");
+    assertEquals(map.size(), 9);
+    assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
+
+    /*
+     * verify variants computed on protein product for transcript3
+     * peptide is SWRECD
+     * codon variants are AGC/AGT position 1 which is synonymous
+     * and GAG/GGG which is E/G in position 4
+     * the insertion variant is not transferred to the peptide
+     */
+    DBRefEntry[] dbRefs = al.findName("transcript3").getDBRefs();
+    SequenceI peptide = null;
+    for (DBRefEntry dbref : dbRefs)
+    {
+      if (dbref.getMap().getMap().getFromRatio() == 3)
+      {
+        peptide = dbref.getMap().getTo();
+      }
+    }
+    List proteinFeatures = peptide.getSequenceFeatures();
+    SequenceFeatures.sortFeatures(proteinFeatures, true);
+    assertEquals(proteinFeatures.size(), 2);
+    sf = proteinFeatures.get(0);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 1);
+    assertEquals(sf.getEnd(), 1);
+    assertEquals(sf.getType(), SequenceOntologyI.SYNONYMOUS_VARIANT);
+    assertEquals(sf.getDescription(), "AGT");
+    sf = proteinFeatures.get(1);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 4);
+    assertEquals(sf.getEnd(), 4);
+    assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
+    assertEquals(sf.getDescription(), "p.Glu4Gly");
+
+    /*
+     * verify variant feature(s) added to transcript4
+     * at columns 13 (2) and 17 (2), positions 7 and 11
+     */
+    transcriptFeatures = al.findName("transcript4").getSequenceFeatures();
+    SequenceFeatures.sortFeatures(transcriptFeatures, true);
+    assertEquals(transcriptFeatures.size(), 4);
+    sf = transcriptFeatures.get(0);
+    assertEquals(sf.getBegin(), 7);
+    assertEquals(sf.getEnd(), 7);
+    assertEquals(sf.getScore(), 0.5f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,T");
+    assertEquals(map.size(), 9);
+    assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
+
+    sf = transcriptFeatures.get(1);
+    assertEquals(sf.getBegin(), 7);
+    assertEquals(sf.getEnd(), 7);
+    assertEquals(sf.getScore(), 0.4f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,G");
+    assertEquals(map.size(), 9);
+    assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
+
+    sf = transcriptFeatures.get(2);
+    assertEquals(sf.getBegin(), 11);
+    assertEquals(sf.getEnd(), 11);
+    assertEquals(sf.getScore(), 0.7f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,G");
+    assertEquals(map.size(), 9);
+    assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
+
+    sf = transcriptFeatures.get(3);
+    assertEquals(sf.getBegin(), 11);
+    assertEquals(sf.getEnd(), 11);
+    assertEquals(sf.getScore(), 0.6f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,AC");
+    assertEquals(map.size(), 9);
+    assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
+  }
+
+  /**
+   * A test that demonstrates loading a contig sequence from an indexed sequence
+   * database which is the reference for a VCF file
+   * 
+   * @throws IOException
+   */
+  @Test(groups = "Functional")
+  public void testLoadVCFContig() throws IOException
+  {
+    VCFLoader loader = new VCFLoader(
+            "test/jalview/io/vcf/testVcf2.vcf");
+
+    SequenceI seq = loader.loadVCFContig("contig123");
+    assertEquals(seq.getLength(), 15);
+    assertEquals(seq.getSequenceAsString(), "AAAAACCCCCGGGGG");
+    List features = seq.getSequenceFeatures();
+    SequenceFeatures.sortFeatures(features, true);
+    assertEquals(features.size(), 2);
+    SequenceFeature sf = features.get(0);
+    assertEquals(sf.getBegin(), 8);
+    assertEquals(sf.getEnd(), 8);
+    assertEquals(sf.getDescription(), "C,A");
+    sf = features.get(1);
+    assertEquals(sf.getBegin(), 12);
+    assertEquals(sf.getEnd(), 12);
+    assertEquals(sf.getDescription(), "G,T");
+
+    seq = loader.loadVCFContig("contig789");
+    assertEquals(seq.getLength(), 25);
+    assertEquals(seq.getSequenceAsString(), "GGGGGTTTTTAAAAACCCCCGGGGG");
+    features = seq.getSequenceFeatures();
+    SequenceFeatures.sortFeatures(features, true);
+    assertEquals(features.size(), 2);
+    sf = features.get(0);
+    assertEquals(sf.getBegin(), 2);
+    assertEquals(sf.getEnd(), 2);
+    assertEquals(sf.getDescription(), "G,T");
+    sf = features.get(1);
+    assertEquals(sf.getBegin(), 21);
+    assertEquals(sf.getEnd(), 21);
+    assertEquals(sf.getDescription(), "G,A");
+
+    seq = loader.loadVCFContig("contig456");
+    assertEquals(seq.getLength(), 20);
+    assertEquals(seq.getSequenceAsString(), "CCCCCGGGGGTTTTTAAAAA");
+    features = seq.getSequenceFeatures();
+    SequenceFeatures.sortFeatures(features, true);
+    assertEquals(features.size(), 1);
+    sf = features.get(0);
+    assertEquals(sf.getBegin(), 15);
+    assertEquals(sf.getEnd(), 15);
+    assertEquals(sf.getDescription(), "T,C");
+  }
+}
\ No newline at end of file
diff --git a/test/jalview/io/vcf/contigs.fasta b/test/jalview/io/vcf/contigs.fasta
new file mode 100644
index 0000000..ec839b6
--- /dev/null
+++ b/test/jalview/io/vcf/contigs.fasta
@@ -0,0 +1,6 @@
+>contig123
+AAAAACCCCCGGGGG
+>contig456
+CCCCCGGGGGTTTTTAAAAA
+>contig789
+GGGGGTTTTTAAAAACCCCCGGGGG
diff --git a/test/jalview/io/vcf/contigs.fasta.fai b/test/jalview/io/vcf/contigs.fasta.fai
new file mode 100644
index 0000000..e9f5067
--- /dev/null
+++ b/test/jalview/io/vcf/contigs.fasta.fai
@@ -0,0 +1,3 @@
+contig123	15	11	15	16
+contig456	20	38	20	21
+contig789	25	70	25	26
diff --git a/test/jalview/io/vcf/testVcf.dat b/test/jalview/io/vcf/testVcf.dat
new file mode 100644
index 0000000..77e070c
--- /dev/null
+++ b/test/jalview/io/vcf/testVcf.dat
@@ -0,0 +1,13 @@
+##fileformat=VCFv4.2
+##INFO=
+##INFO=
+##INFO=
+##INFO=
+##INFO=
+##reference=/Homo_sapiens/GRCh38
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO
+5	45051610	.	C	A	81.96	RF;AC0	AC=1;AF=0.1;AN=0;AF_Female=2;AB_MEDIAN=6.00000e-01;CSQ=A|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,A|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad
+5	45051614	.	C	T	1666.64	RF	AC=1;AF=0.2;AN=0;AF_Female=2;AB_MEDIAN=6.00000e-01;CSQ=T|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,T|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad
+5	45051618	.	CGG	C	41.94	AC0	AC=1;AF=0.3;AN=0;AF_Female=2;AB_MEDIAN=6.00000e-01;CSQ=C|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,C|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad,CSQ=CGT|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,CGT|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad
+5	45051622	.	C	G,T	224.23	RF;AC0	AC=1,2;AF=0.4,0.5;AN=0;AF_Female=2;AB_MEDIAN=6.00000e-01;CSQ=G|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,G|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad,T|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,T|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad
+5	45051626	.	A	AC,G	433.35	RF;AC0	AC=3,4;AF=0.6,0.7;AN=0;AF_Female=2;AB_MEDIAN=6.00000e-01;CSQ=G|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,G|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad,AC|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,AC|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad
diff --git a/test/jalview/io/vcf/testVcf.vcf b/test/jalview/io/vcf/testVcf.vcf
new file mode 100644
index 0000000..77e070c
--- /dev/null
+++ b/test/jalview/io/vcf/testVcf.vcf
@@ -0,0 +1,13 @@
+##fileformat=VCFv4.2
+##INFO=
+##INFO=
+##INFO=
+##INFO=
+##INFO=
+##reference=/Homo_sapiens/GRCh38
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO
+5	45051610	.	C	A	81.96	RF;AC0	AC=1;AF=0.1;AN=0;AF_Female=2;AB_MEDIAN=6.00000e-01;CSQ=A|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,A|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad
+5	45051614	.	C	T	1666.64	RF	AC=1;AF=0.2;AN=0;AF_Female=2;AB_MEDIAN=6.00000e-01;CSQ=T|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,T|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad
+5	45051618	.	CGG	C	41.94	AC0	AC=1;AF=0.3;AN=0;AF_Female=2;AB_MEDIAN=6.00000e-01;CSQ=C|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,C|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad,CSQ=CGT|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,CGT|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad
+5	45051622	.	C	G,T	224.23	RF;AC0	AC=1,2;AF=0.4,0.5;AN=0;AF_Female=2;AB_MEDIAN=6.00000e-01;CSQ=G|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,G|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad,T|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,T|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad
+5	45051626	.	A	AC,G	433.35	RF;AC0	AC=3,4;AF=0.6,0.7;AN=0;AF_Female=2;AB_MEDIAN=6.00000e-01;CSQ=G|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,G|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad,AC|missense_variant|MODIFIER|WASH7P|gene3|Transcript|transcript3|rna|Benign,AC|downstream_gene_variant|MODIFIER|WASH7P|gene3|Transcript|transcript4|mrna|Bad
diff --git a/test/jalview/io/vcf/testVcf2.vcf b/test/jalview/io/vcf/testVcf2.vcf
new file mode 100644
index 0000000..aa3792a
--- /dev/null
+++ b/test/jalview/io/vcf/testVcf2.vcf
@@ -0,0 +1,13 @@
+##fileformat=VCFv4.2
+##INFO=
+##contig=
+##contig=
+##contig=
+##INFO=
+##reference=test/jalview/io/vcf/contigs.fasta
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO
+contig123	8	.	C	A	81.96	.	AC=1;AF=0.1
+contig123	12	.	G	T	1666.64	.	AC=1;AF=0.2
+contig456	15	.	T	C	41.94	.	AC=1;AF=0.3
+contig789	2	.	G	T	224.23	.	AC=1,2;AF=0
+contig789	21	.	G	A	433.35	.	AC=3;AF=0.6
diff --git a/test/jalview/renderer/seqfeatures/FeatureColourFinderTest.java b/test/jalview/renderer/seqfeatures/FeatureColourFinderTest.java
index f6dfed6..d8b905e 100644
--- a/test/jalview/renderer/seqfeatures/FeatureColourFinderTest.java
+++ b/test/jalview/renderer/seqfeatures/FeatureColourFinderTest.java
@@ -15,6 +15,7 @@ import jalview.gui.FeatureRenderer;
 import jalview.io.DataSourceType;
 import jalview.io.FileLoader;
 import jalview.schemes.FeatureColour;
+import jalview.viewmodel.seqfeatures.FeatureRendererModel.FeatureSettingsBean;
 
 import java.awt.Color;
 import java.util.List;
@@ -172,9 +173,9 @@ public class FeatureColourFinderTest
      * - currently no way other than mimicking reordering of
      * table in Feature Settings
      */
-    Object[][] data = new Object[2][];
-    data[0] = new Object[] { "Metal", red, true };
-    data[1] = new Object[] { "Domain", green, true };
+    FeatureSettingsBean[] data = new FeatureSettingsBean[2];
+    data[0] = new FeatureSettingsBean("Metal", red, null, true);
+    data[1] = new FeatureSettingsBean("Domain", green, null, true);
     fr.setFeaturePriority(data);
     c = finder.findFeatureColour(Color.blue, seq, 10);
     assertEquals(c, Color.red);
@@ -182,7 +183,7 @@ public class FeatureColourFinderTest
     /*
      * ..and turn off display of Metal
      */
-    data[0][2] = false;
+    data[0] = new FeatureSettingsBean("Metal", red, null, false);
     fr.setFeaturePriority(data);
     c = finder.findFeatureColour(Color.blue, seq, 10);
     assertEquals(c, Color.green);
@@ -216,8 +217,8 @@ public class FeatureColourFinderTest
     /*
      * turn off display of Metal - is this the easiest way to do it??
      */
-    Object[][] data = new Object[1][];
-    data[0] = new Object[] { "Metal", red, false };
+    FeatureSettingsBean[] data = new FeatureSettingsBean[1];
+    data[0] = new FeatureSettingsBean("Metal", red, null, false);
     fr.setFeaturePriority(data);
     c = finder.findFeatureColour(Color.blue, seq, 10);
     assertEquals(c, Color.blue);
@@ -225,7 +226,7 @@ public class FeatureColourFinderTest
     /*
      * turn display of Metal back on
      */
-    data[0] = new Object[] { "Metal", red, true };
+    data[0] = new FeatureSettingsBean("Metal", red, null, true);
     fr.setFeaturePriority(data);
     c = finder.findFeatureColour(Color.blue, seq, 10);
     assertEquals(c, Color.red);
@@ -399,9 +400,9 @@ public class FeatureColourFinderTest
      * 1) 0.6 * green(0, 255, 0) + 0.4 * cyan(0, 255, 255) = (0, 255, 102)
      * 2) 0.6* red(255, 0, 0) + 0.4 * (0, 255, 102) = (153, 102, 41) rounded
      */
-    Object[][] data = new Object[2][];
-    data[0] = new Object[] { "Metal", red, true };
-    data[1] = new Object[] { "Domain", green, true };
+    FeatureSettingsBean[] data = new FeatureSettingsBean[2];
+    data[0] = new FeatureSettingsBean("Metal", red, null, true);
+    data[1] = new FeatureSettingsBean("Domain", green, null, true);
     fr.setFeaturePriority(data);
     c = finder.findFeatureColour(Color.cyan, seq, 10);
     assertEquals(c, new Color(153, 102, 41));
@@ -411,7 +412,7 @@ public class FeatureColourFinderTest
      * Domain (green) above background (pink)
      * 0.6 * green(0, 255, 0) + 0.4 * pink(255, 175, 175) = (102, 223, 70)
      */
-    data[0][2] = false;
+    data[0] = new FeatureSettingsBean("Metal", red, null, false);
     fr.setFeaturePriority(data);
     c = finder.findFeatureColour(Color.pink, seq, 10);
     assertEquals(c, new Color(102, 223, 70));
@@ -447,8 +448,8 @@ public class FeatureColourFinderTest
     /*
      * turn off display of Metal
      */
-    Object[][] data = new Object[1][];
-    data[0] = new Object[] { "Metal", red, false };
+    FeatureSettingsBean[] data = new FeatureSettingsBean[1];
+    data[0] = new FeatureSettingsBean("Metal", red, null, false);
     fr.setFeaturePriority(data);
     assertTrue(finder.noFeaturesDisplayed());
 
@@ -503,9 +504,9 @@ public class FeatureColourFinderTest
     /*
      * render order is kd above Metal
      */
-    Object[][] data = new Object[2][];
-    data[0] = new Object[] { kdFeature, fc, true };
-    data[1] = new Object[] { metalFeature, green, true };
+    FeatureSettingsBean[] data = new FeatureSettingsBean[2];
+    data[0] = new FeatureSettingsBean(kdFeature, fc, null, true);
+    data[1] = new FeatureSettingsBean(metalFeature, green, null, true);
     fr.setFeaturePriority(data);
 
     av.setShowSequenceFeatures(true);
diff --git a/test/jalview/renderer/seqfeatures/FeatureRendererTest.java b/test/jalview/renderer/seqfeatures/FeatureRendererTest.java
index d3cddf9..cebef11 100644
--- a/test/jalview/renderer/seqfeatures/FeatureRendererTest.java
+++ b/test/jalview/renderer/seqfeatures/FeatureRendererTest.java
@@ -2,20 +2,27 @@ package jalview.renderer.seqfeatures;
 
 import static org.testng.Assert.assertEquals;
 import static org.testng.Assert.assertFalse;
+import static org.testng.Assert.assertNull;
 import static org.testng.Assert.assertTrue;
 
 import jalview.api.AlignViewportI;
 import jalview.api.FeatureColourI;
 import jalview.datamodel.SequenceFeature;
 import jalview.datamodel.SequenceI;
+import jalview.datamodel.features.FeatureMatcher;
+import jalview.datamodel.features.FeatureMatcherSet;
+import jalview.datamodel.features.FeatureMatcherSetI;
 import jalview.gui.AlignFrame;
 import jalview.io.DataSourceType;
 import jalview.io.FileLoader;
 import jalview.schemes.FeatureColour;
+import jalview.util.matcher.Condition;
+import jalview.viewmodel.seqfeatures.FeatureRendererModel.FeatureSettingsBean;
 
 import java.awt.Color;
 import java.util.ArrayList;
 import java.util.Arrays;
+import java.util.HashMap;
 import java.util.List;
 import java.util.Map;
 
@@ -61,9 +68,8 @@ public class FeatureRendererTest
     seqs.get(2).addSequenceFeature(
             new SequenceFeature("Pfam", "Desc", 14, 22, 2f, "RfamGroup"));
     // bug in findAllFeatures - group not checked for a known feature type
-    seqs.get(2).addSequenceFeature(
-            new SequenceFeature("Rfam", "Desc", 5, 9, Float.NaN,
-                    "RfamGroup"));
+    seqs.get(2).addSequenceFeature(new SequenceFeature("Rfam", "Desc", 5, 9,
+            Float.NaN, "RfamGroup"));
     // existing feature type with null group
     seqs.get(3).addSequenceFeature(
             new SequenceFeature("Rfam", "Desc", 5, 9, Float.NaN, null));
@@ -116,13 +122,14 @@ public class FeatureRendererTest
      * change render order (todo: an easier way)
      * nb here last comes first in the data array
      */
-    Object[][] data = new Object[3][];
+    FeatureSettingsBean[] data = new FeatureSettingsBean[3];
     FeatureColourI colour = new FeatureColour(Color.RED);
-    data[0] = new Object[] { "Rfam", colour, true };
-    data[1] = new Object[] { "Pfam", colour, false };
-    data[2] = new Object[] { "Scop", colour, false };
+    data[0] = new FeatureSettingsBean("Rfam", colour, null, true);
+    data[1] = new FeatureSettingsBean("Pfam", colour, null, false);
+    data[2] = new FeatureSettingsBean("Scop", colour, null, false);
     fr.setFeaturePriority(data);
-    assertEquals(fr.getRenderOrder(), Arrays.asList("Scop", "Pfam", "Rfam"));
+    assertEquals(fr.getRenderOrder(),
+            Arrays.asList("Scop", "Pfam", "Rfam"));
     assertEquals(fr.getDisplayedFeatureTypes(), Arrays.asList("Rfam"));
 
     /*
@@ -217,12 +224,13 @@ public class FeatureRendererTest
     /*
      * make "Type2" not displayed
      */
-    Object[][] data = new Object[4][];
     FeatureColourI colour = new FeatureColour(Color.RED);
-    data[0] = new Object[] { "Type1", colour, true };
-    data[1] = new Object[] { "Type2", colour, false };
-    data[2] = new Object[] { "Type3", colour, true };
-    data[3] = new Object[] { "Disulphide Bond", colour, true };
+    FeatureSettingsBean[] data = new FeatureSettingsBean[4];
+    data[0] = new FeatureSettingsBean("Type1", colour, null, true);
+    data[1] = new FeatureSettingsBean("Type2", colour, null, false);
+    data[2] = new FeatureSettingsBean("Type3", colour, null, true);
+    data[3] = new FeatureSettingsBean("Disulphide Bond", colour, null,
+            true);
     fr.setFeaturePriority(data);
 
     features = fr.findFeaturesAtColumn(seq, 15);
@@ -252,6 +260,37 @@ public class FeatureRendererTest
     features = fr.findFeaturesAtColumn(seq, 5);
     assertEquals(features.size(), 1);
     assertTrue(features.contains(sf8));
+
+    /*
+     * give "Type3" features a graduated colour scheme
+     * - first with no threshold
+     */
+    FeatureColourI gc = new FeatureColour(Color.yellow, Color.red, null, 0f,
+            10f);
+    fr.getFeatureColours().put("Type3", gc);
+    features = fr.findFeaturesAtColumn(seq, 8);
+    assertTrue(features.contains(sf4));
+    // now with threshold > 2f - feature score of 1f is excluded
+    gc.setAboveThreshold(true);
+    gc.setThreshold(2f);
+    features = fr.findFeaturesAtColumn(seq, 8);
+    assertFalse(features.contains(sf4));
+
+    /*
+     * make "Type3" graduated colour by attribute "AF"
+     * - first with no attribute held - feature should be excluded
+     */
+    gc.setAttributeName("AF");
+    features = fr.findFeaturesAtColumn(seq, 8);
+    assertFalse(features.contains(sf4));
+    // now with the attribute above threshold - should be included
+    sf4.setValue("AF", "2.4");
+    features = fr.findFeaturesAtColumn(seq, 8);
+    assertTrue(features.contains(sf4));
+    // now with the attribute below threshold - should be excluded
+    sf4.setValue("AF", "1.4");
+    features = fr.findFeaturesAtColumn(seq, 8);
+    assertFalse(features.contains(sf4));
   }
 
   @Test(groups = "Functional")
@@ -264,7 +303,7 @@ public class FeatureRendererTest
     FeatureRenderer fr = new FeatureRenderer(av);
 
     List features = new ArrayList<>();
-    fr.filterFeaturesForDisplay(features, null); // empty list, does nothing
+    fr.filterFeaturesForDisplay(features); // empty list, does nothing
 
     SequenceI seq = av.getAlignment().getSequenceAt(0);
     SequenceFeature sf1 = new SequenceFeature("Cath", "", 6, 8, Float.NaN,
@@ -297,7 +336,7 @@ public class FeatureRendererTest
      * filter out duplicate (co-located) features
      * note: which gets removed is not guaranteed
      */
-    fr.filterFeaturesForDisplay(features, new FeatureColour(Color.blue));
+    fr.filterFeaturesForDisplay(features);
     assertEquals(features.size(), 3);
     assertTrue(features.contains(sf1) || features.contains(sf4));
     assertFalse(features.contains(sf1) && features.contains(sf4));
@@ -306,58 +345,166 @@ public class FeatureRendererTest
     assertTrue(features.contains(sf5));
 
     /*
-     * hide group 3 - sf3 is removed, sf2 is retained
+     * hide groups 2 and 3 makes no difference to this method
      */
+    fr.setGroupVisibility("group2", false);
     fr.setGroupVisibility("group3", false);
     features = seq.getSequenceFeatures();
-    fr.filterFeaturesForDisplay(features, new FeatureColour(Color.blue));
+    fr.filterFeaturesForDisplay(features);
     assertEquals(features.size(), 3);
     assertTrue(features.contains(sf1) || features.contains(sf4));
     assertFalse(features.contains(sf1) && features.contains(sf4));
-    assertTrue(features.contains(sf2));
-    assertFalse(features.contains(sf3));
+    assertTrue(features.contains(sf2) || features.contains(sf3));
+    assertFalse(features.contains(sf2) && features.contains(sf3));
     assertTrue(features.contains(sf5));
+  }
+
+  @Test(groups = "Functional")
+  public void testGetColour()
+  {
+    AlignFrame af = new FileLoader().LoadFileWaitTillLoaded(">s1\nABCD\n",
+            DataSourceType.PASTE);
+    AlignViewportI av = af.getViewport();
+    FeatureRenderer fr = new FeatureRenderer(av);
 
     /*
-     * hide group 2, show group 3 - sf2 is removed, sf3 is retained
+     * simple colour, feature type and group displayed
      */
-    fr.setGroupVisibility("group2", false);
-    fr.setGroupVisibility("group3", true);
-    features = seq.getSequenceFeatures();
-    fr.filterFeaturesForDisplay(features, null);
-    assertEquals(features.size(), 3);
-    assertTrue(features.contains(sf1) || features.contains(sf4));
-    assertFalse(features.contains(sf1) && features.contains(sf4));
-    assertFalse(features.contains(sf2));
-    assertTrue(features.contains(sf3));
-    assertTrue(features.contains(sf5));
+    FeatureColourI fc = new FeatureColour(Color.red);
+    fr.getFeatureColours().put("Cath", fc);
+    SequenceFeature sf1 = new SequenceFeature("Cath", "", 6, 8, Float.NaN,
+            "group1");
+    assertEquals(fr.getColour(sf1), Color.red);
 
     /*
-     * no filtering of co-located features with graduated colour scheme
-     * filterFeaturesForDisplay does _not_ check colour threshold
-     * sf2 is removed as its group is hidden
+     * hide feature type, then unhide
+     * - feature type visibility should not affect the result
      */
-    features = seq.getSequenceFeatures();
-    fr.filterFeaturesForDisplay(features, new FeatureColour(Color.black,
-            Color.white, 0f, 1f));
-    assertEquals(features.size(), 4);
-    assertTrue(features.contains(sf1));
-    assertTrue(features.contains(sf3));
-    assertTrue(features.contains(sf4));
-    assertTrue(features.contains(sf5));
+    FeatureSettingsBean[] data = new FeatureSettingsBean[1];
+    data[0] = new FeatureSettingsBean("Cath", fc, null, false);
+    fr.setFeaturePriority(data);
+    assertEquals(fr.getColour(sf1), Color.red);
+    data[0] = new FeatureSettingsBean("Cath", fc, null, true);
+    fr.setFeaturePriority(data);
+    assertEquals(fr.getColour(sf1), Color.red);
 
     /*
-     * co-located features with colour by label
-     * should not get filtered
+     * hide feature group, then unhide
      */
-    features = seq.getSequenceFeatures();
-    FeatureColour fc = new FeatureColour(Color.black);
-    fc.setColourByLabel(true);
-    fr.filterFeaturesForDisplay(features, fc);
-    assertEquals(features.size(), 4);
-    assertTrue(features.contains(sf1));
-    assertTrue(features.contains(sf3));
-    assertTrue(features.contains(sf4));
-    assertTrue(features.contains(sf5));
+    fr.setGroupVisibility("group1", false);
+    assertNull(fr.getColour(sf1));
+    fr.setGroupVisibility("group1", true);
+    assertEquals(fr.getColour(sf1), Color.red);
+
+    /*
+     * graduated colour by score, no threshold, no score
+     * 
+     */
+    FeatureColourI gc = new FeatureColour(Color.yellow, Color.red,
+            Color.green, 1f, 11f);
+    fr.getFeatureColours().put("Cath", gc);
+    assertEquals(fr.getColour(sf1), Color.green);
+
+    /*
+     * graduated colour by score, no threshold, with score value
+     */
+    SequenceFeature sf2 = new SequenceFeature("Cath", "", 6, 8, 6f,
+            "group1");
+    // score 6 is half way from yellow(255, 255, 0) to red(255, 0, 0)
+    Color expected = new Color(255, 128, 0);
+    assertEquals(fr.getColour(sf2), expected);
+
+    /*
+     * above threshold, score is above threshold - no change
+     */
+    gc.setAboveThreshold(true);
+    gc.setThreshold(5f);
+    assertEquals(fr.getColour(sf2), expected);
+
+    /*
+     * threshold is min-max; now score 6 is 1/6 of the way from 5 to 11
+     * or from yellow(255, 255, 0) to red(255, 0, 0)
+     */
+    gc = new FeatureColour(Color.yellow, Color.red, Color.green, 5f, 11f);
+    fr.getFeatureColours().put("Cath", gc);
+    gc.setAutoScaled(false); // this does little other than save a checkbox setting!
+    assertEquals(fr.getColour(sf2), new Color(255, 213, 0));
+
+    /*
+     * feature score is below threshold - no colour
+     */
+    gc.setAboveThreshold(true);
+    gc.setThreshold(7f);
+    assertNull(fr.getColour(sf2));
+
+    /*
+     * feature score is above threshold - no colour
+     */
+    gc.setBelowThreshold(true);
+    gc.setThreshold(3f);
+    assertNull(fr.getColour(sf2));
+
+    /*
+     * colour by feature attribute value
+     * first with no value held
+     */
+    gc = new FeatureColour(Color.yellow, Color.red, Color.green, 1f, 11f);
+    fr.getFeatureColours().put("Cath", gc);
+    gc.setAttributeName("AF");
+    assertEquals(fr.getColour(sf2), Color.green);
+
+    // with non-numeric attribute value
+    sf2.setValue("AF", "Five");
+    assertEquals(fr.getColour(sf2), Color.green);
+
+    // with numeric attribute value
+    sf2.setValue("AF", "6");
+    assertEquals(fr.getColour(sf2), expected);
+
+    // with numeric value outwith threshold
+    gc.setAboveThreshold(true);
+    gc.setThreshold(10f);
+    assertNull(fr.getColour(sf2));
+
+    // with filter on AF < 4
+    gc.setAboveThreshold(false);
+    assertEquals(fr.getColour(sf2), expected);
+    FeatureMatcherSetI filter = new FeatureMatcherSet();
+    filter.and(FeatureMatcher.byAttribute(Condition.LT, "4.0", "AF"));
+    fr.setFeatureFilter("Cath", filter);
+    assertNull(fr.getColour(sf2));
+
+    // with filter on 'Consequence contains missense'
+    filter = new FeatureMatcherSet();
+    filter.and(FeatureMatcher.byAttribute(Condition.Contains, "missense",
+            "Consequence"));
+    fr.setFeatureFilter("Cath", filter);
+    // if feature has no Consequence attribute, no colour
+    assertNull(fr.getColour(sf2));
+    // if attribute does not match filter, no colour
+    sf2.setValue("Consequence", "Synonymous");
+    assertNull(fr.getColour(sf2));
+    // attribute matches filter
+    sf2.setValue("Consequence", "Missense variant");
+    assertEquals(fr.getColour(sf2), expected);
+
+    // with filter on CSQ:Feature contains "ENST01234"
+    filter = new FeatureMatcherSet();
+    filter.and(FeatureMatcher.byAttribute(Condition.Matches, "ENST01234",
+            "CSQ", "Feature"));
+    fr.setFeatureFilter("Cath", filter);
+    // if feature has no CSQ data, no colour
+    assertNull(fr.getColour(sf2));
+    // if CSQ data does not include Feature, no colour
+    Map csqData = new HashMap<>();
+    csqData.put("BIOTYPE", "Transcript");
+    sf2.setValue("CSQ", csqData);
+    assertNull(fr.getColour(sf2));
+    // if attribute does not match filter, no colour
+    csqData.put("Feature", "ENST9876");
+    assertNull(fr.getColour(sf2));
+    // attribute matches filter
+    csqData.put("Feature", "ENST01234");
+    assertEquals(fr.getColour(sf2), expected);
   }
 }
diff --git a/test/jalview/schemes/Blosum62ColourSchemeTest.java b/test/jalview/schemes/Blosum62ColourSchemeTest.java
index 0b5b6bd..030a90f 100644
--- a/test/jalview/schemes/Blosum62ColourSchemeTest.java
+++ b/test/jalview/schemes/Blosum62ColourSchemeTest.java
@@ -20,7 +20,7 @@ public class Blosum62ColourSchemeTest
    * 

    * 
    */
-  @Test
+  @Test(groups = "Functional")
   public void testFindColour()
   {
     ColourSchemeI blosum = new Blosum62ColourScheme();
diff --git a/test/jalview/schemes/FeatureColourTest.java b/test/jalview/schemes/FeatureColourTest.java
index 7a72c15..2eb718b 100644
--- a/test/jalview/schemes/FeatureColourTest.java
+++ b/test/jalview/schemes/FeatureColourTest.java
@@ -25,7 +25,9 @@ import static org.testng.AssertJUnit.assertFalse;
 import static org.testng.AssertJUnit.assertNull;
 import static org.testng.AssertJUnit.assertTrue;
 import static org.testng.AssertJUnit.fail;
+import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
 
+import jalview.api.FeatureColourI;
 import jalview.datamodel.SequenceFeature;
 import jalview.gui.JvOptionPane;
 import jalview.util.ColorUtils;
@@ -36,6 +38,8 @@ import java.awt.Color;
 import org.testng.annotations.BeforeClass;
 import org.testng.annotations.Test;
 
+import junit.extensions.PA;
+
 public class FeatureColourTest
 {
 
@@ -57,6 +61,8 @@ public class FeatureColourTest
     assertTrue(fc1.getColour().equals(Color.RED));
     assertFalse(fc1.isGraduatedColour());
     assertFalse(fc1.isColourByLabel());
+    assertFalse(fc1.isColourByAttribute());
+    assertNull(fc1.getAttributeName());
 
     /*
      * min-max colour
@@ -68,9 +74,31 @@ public class FeatureColourTest
     assertTrue(fc1.isGraduatedColour());
     assertFalse(fc1.isColourByLabel());
     assertTrue(fc1.isAboveThreshold());
+    assertFalse(fc1.isColourByAttribute());
+    assertNull(fc1.getAttributeName());
     assertEquals(12f, fc1.getThreshold());
     assertEquals(Color.gray, fc1.getMinColour());
     assertEquals(Color.black, fc1.getMaxColour());
+    assertEquals(Color.gray, fc1.getNoColour());
+    assertEquals(10f, fc1.getMin());
+    assertEquals(20f, fc1.getMax());
+
+    /*
+     * min-max-noValue colour
+     */
+    fc = new FeatureColour(Color.gray, Color.black, Color.green, 10f, 20f);
+    fc.setAboveThreshold(true);
+    fc.setThreshold(12f);
+    fc1 = new FeatureColour(fc);
+    assertTrue(fc1.isGraduatedColour());
+    assertFalse(fc1.isColourByLabel());
+    assertFalse(fc1.isColourByAttribute());
+    assertNull(fc1.getAttributeName());
+    assertTrue(fc1.isAboveThreshold());
+    assertEquals(12f, fc1.getThreshold());
+    assertEquals(Color.gray, fc1.getMinColour());
+    assertEquals(Color.black, fc1.getMaxColour());
+    assertEquals(Color.green, fc1.getNoColour());
     assertEquals(10f, fc1.getMin());
     assertEquals(20f, fc1.getMax());
 
@@ -82,6 +110,127 @@ public class FeatureColourTest
     fc1 = new FeatureColour(fc);
     assertTrue(fc1.isColourByLabel());
     assertFalse(fc1.isGraduatedColour());
+    assertFalse(fc1.isColourByAttribute());
+    assertNull(fc1.getAttributeName());
+
+    /*
+     * colour by attribute (label)
+     */
+    fc = new FeatureColour();
+    fc.setColourByLabel(true);
+    fc.setAttributeName("AF");
+    fc1 = new FeatureColour(fc);
+    assertTrue(fc1.isColourByLabel());
+    assertFalse(fc1.isGraduatedColour());
+    assertTrue(fc1.isColourByAttribute());
+    assertArrayEquals(new String[] { "AF" }, fc1.getAttributeName());
+
+    /*
+     * colour by attribute (value)
+     */
+    fc = new FeatureColour(Color.gray, Color.black, Color.green, 10f, 20f);
+    fc.setAboveThreshold(true);
+    fc.setThreshold(12f);
+    fc.setAttributeName("AF");
+    fc1 = new FeatureColour(fc);
+    assertTrue(fc1.isGraduatedColour());
+    assertFalse(fc1.isColourByLabel());
+    assertTrue(fc1.isColourByAttribute());
+    assertArrayEquals(new String[] { "AF" }, fc1.getAttributeName());
+    assertTrue(fc1.isAboveThreshold());
+    assertEquals(12f, fc1.getThreshold());
+    assertEquals(Color.gray, fc1.getMinColour());
+    assertEquals(Color.black, fc1.getMaxColour());
+    assertEquals(Color.green, fc1.getNoColour());
+    assertEquals(10f, fc1.getMin());
+    assertEquals(20f, fc1.getMax());
+  }
+
+  @Test(groups = { "Functional" })
+  public void testCopyConstructor_minMax()
+  {
+    /*
+     * graduated colour
+     */
+    FeatureColour fc = new FeatureColour(Color.BLUE, Color.RED, 1f, 5f);
+    assertTrue(fc.isGraduatedColour());
+    assertFalse(fc.isColourByLabel());
+    assertFalse(fc.isColourByAttribute());
+    assertNull(fc.getAttributeName());
+    assertEquals(1f, fc.getMin());
+    assertEquals(5f, fc.getMax());
+
+    /*
+     * update min-max bounds
+     */
+    FeatureColour fc1 = new FeatureColour(fc, 2f, 6f);
+    assertTrue(fc1.isGraduatedColour());
+    assertFalse(fc1.isColourByLabel());
+    assertFalse(fc1.isColourByAttribute());
+    assertNull(fc1.getAttributeName());
+    assertEquals(2f, fc1.getMin());
+    assertEquals(6f, fc1.getMax());
+    assertFalse((boolean) PA.getValue(fc1, "isHighToLow"));
+
+    /*
+     * update min-max bounds - high to low
+     */
+    fc1 = new FeatureColour(fc, 23f, 16f);
+    assertTrue(fc1.isGraduatedColour());
+    assertFalse(fc1.isColourByLabel());
+    assertFalse(fc1.isColourByAttribute());
+    assertNull(fc1.getAttributeName());
+    assertEquals(23f, fc1.getMin());
+    assertEquals(16f, fc1.getMax());
+    assertTrue((boolean) PA.getValue(fc1, "isHighToLow"));
+
+    /*
+     * graduated colour by attribute
+     */
+    fc1.setAttributeName("AF");
+    fc1 = new FeatureColour(fc1, 13f, 36f);
+    assertTrue(fc1.isGraduatedColour());
+    assertFalse(fc1.isColourByLabel());
+    assertTrue(fc1.isColourByAttribute());
+    assertArrayEquals(new String[] { "AF" }, fc1.getAttributeName());
+    assertEquals(13f, fc1.getMin());
+    assertEquals(36f, fc1.getMax());
+    assertFalse((boolean) PA.getValue(fc1, "isHighToLow"));
+
+    /*
+     * colour by label
+     */
+    fc = new FeatureColour(Color.BLUE, Color.RED, 1f, 5f);
+    fc.setColourByLabel(true);
+    assertFalse(fc.isGraduatedColour());
+    assertTrue(fc.isColourByLabel());
+    assertFalse(fc.isColourByAttribute());
+    assertNull(fc.getAttributeName());
+    assertEquals(1f, fc.getMin());
+    assertEquals(5f, fc.getMax());
+
+    /*
+     * update min-max bounds
+     */
+    fc1 = new FeatureColour(fc, 2f, 6f);
+    assertFalse(fc1.isGraduatedColour());
+    assertTrue(fc1.isColourByLabel());
+    assertFalse(fc1.isColourByAttribute());
+    assertNull(fc1.getAttributeName());
+    assertEquals(2f, fc1.getMin());
+    assertEquals(6f, fc1.getMax());
+
+    /*
+     * colour by attribute text
+     */
+    fc1.setAttributeName("AC");
+    fc1 = new FeatureColour(fc1, 13f, 36f);
+    assertFalse(fc1.isGraduatedColour());
+    assertTrue(fc1.isColourByLabel());
+    assertTrue(fc1.isColourByAttribute());
+    assertArrayEquals(new String[] { "AC" }, fc1.getAttributeName());
+    assertEquals(13f, fc1.getMin());
+    assertEquals(36f, fc1.getMax());
   }
 
   @Test(groups = { "Functional" })
@@ -106,8 +255,11 @@ public class FeatureColourTest
   @Test(groups = { "Functional" })
   public void testGetColor_Graduated()
   {
-    // graduated colour from score 0 to 100, gray(128, 128, 128) to red(255, 0,
-    // 0)
+    /*
+     * graduated colour from 
+     * score 0 to 100
+     * gray(128, 128, 128) to red(255, 0, 0)
+     */
     FeatureColour fc = new FeatureColour(Color.GRAY, Color.RED, 0f, 100f);
     // feature score is 75 which is 3/4 of the way from GRAY to RED
     SequenceFeature sf = new SequenceFeature("type", "desc", 0, 20, 75f,
@@ -174,20 +326,29 @@ public class FeatureColourTest
     assertEquals("domain\tlabel", fc.toJalviewFormat("domain"));
 
     /*
+     * colour by attribute text (no threshold)
+     */
+    fc = new FeatureColour();
+    fc.setColourByLabel(true);
+    fc.setAttributeName("CLIN_SIG");
+    assertEquals("domain\tattribute|CLIN_SIG", fc.toJalviewFormat("domain"));
+    
+    /*
      * colour by label (autoscaled) (an odd state you can reach by selecting
      * 'above threshold', then deselecting 'threshold is min/max' then 'colour
      * by label')
      */
+    fc.setAttributeName((String[]) null);
     fc.setAutoScaled(true);
     assertEquals("domain\tlabel", fc.toJalviewFormat("domain"));
 
     /*
-     * colour by label (above threshold) (min/max values are output though not
-     * used by this scheme)
+     * colour by label (above threshold) 
      */
     fc.setAutoScaled(false);
     fc.setThreshold(12.5f);
     fc.setAboveThreshold(true);
+    // min/max values are output though not used by this scheme
     assertEquals("domain\tlabel|||0.0|0.0|above|12.5",
             fc.toJalviewFormat("domain"));
 
@@ -199,38 +360,80 @@ public class FeatureColourTest
             fc.toJalviewFormat("domain"));
 
     /*
-     * graduated colour, no threshold
+     * colour by attributes text (below threshold)
+     */
+    fc.setBelowThreshold(true);
+    fc.setAttributeName("CSQ", "Consequence");
+    assertEquals("domain\tattribute|CSQ:Consequence|||0.0|0.0|below|12.5",
+            fc.toJalviewFormat("domain"));
+
+    /*
+     * graduated colour by score, no threshold
+     * - default constructor sets noValueColor = minColor
      */
     fc = new FeatureColour(Color.GREEN, Color.RED, 12f, 25f);
     String greenHex = Format.getHexString(Color.GREEN);
-    String expected = String.format("domain\t%s|%s|abso|12.0|25.0|none",
-            greenHex, redHex);
+    String expected = String.format(
+            "domain\tscore|%s|%s|noValueMin|abso|12.0|25.0|none", greenHex,
+            redHex);
     assertEquals(expected, fc.toJalviewFormat("domain"));
 
     /*
+     * graduated colour by score, no threshold, no value gets min colour
+     */
+    fc = new FeatureColour(Color.GREEN, Color.RED, Color.GREEN, 12f, 25f);
+    expected = String.format(
+            "domain\tscore|%s|%s|noValueMin|abso|12.0|25.0|none", greenHex,
+            redHex);
+    assertEquals(expected, fc.toJalviewFormat("domain"));
+
+    /*
+     * graduated colour by score, no threshold, no value gets max colour
+     */
+    fc = new FeatureColour(Color.GREEN, Color.RED, Color.RED, 12f, 25f);
+    expected = String.format(
+            "domain\tscore|%s|%s|noValueMax|abso|12.0|25.0|none", greenHex,
+            redHex);
+    assertEquals(expected, fc.toJalviewFormat("domain"));
+    
+    /*
      * colour ranges over the actual score ranges (not min/max)
      */
     fc.setAutoScaled(true);
-    expected = String.format("domain\t%s|%s|12.0|25.0|none", greenHex,
+    expected = String.format(
+            "domain\tscore|%s|%s|noValueMax|12.0|25.0|none", greenHex,
             redHex);
     assertEquals(expected, fc.toJalviewFormat("domain"));
 
     /*
-     * graduated colour below threshold
+     * graduated colour by score, below threshold
      */
     fc.setThreshold(12.5f);
     fc.setBelowThreshold(true);
-    expected = String.format("domain\t%s|%s|12.0|25.0|below|12.5",
+    expected = String.format(
+            "domain\tscore|%s|%s|noValueMax|12.0|25.0|below|12.5",
             greenHex, redHex);
     assertEquals(expected, fc.toJalviewFormat("domain"));
 
     /*
-     * graduated colour above threshold
+     * graduated colour by score, above threshold
      */
     fc.setThreshold(12.5f);
     fc.setAboveThreshold(true);
     fc.setAutoScaled(false);
-    expected = String.format("domain\t%s|%s|abso|12.0|25.0|above|12.5",
+    expected = String.format(
+            "domain\tscore|%s|%s|noValueMax|abso|12.0|25.0|above|12.5",
+            greenHex, redHex);
+    assertEquals(expected, fc.toJalviewFormat("domain"));
+
+    /*
+     * graduated colour by attribute, above threshold
+     */
+    fc.setAttributeName("CSQ", "AF");
+    fc.setAboveThreshold(true);
+    fc.setAutoScaled(false);
+    expected = String.format(
+            "domain\tattribute|CSQ:AF|%s|%s|noValueMax|abso|12.0|25.0|above|12.5",
             greenHex, redHex);
     assertEquals(expected, fc.toJalviewFormat("domain"));
   }
@@ -244,7 +447,7 @@ public class FeatureColourTest
     /*
      * simple colour by name
      */
-    FeatureColour fc = FeatureColour.parseJalviewFeatureColour("red");
+    FeatureColourI fc = FeatureColour.parseJalviewFeatureColour("red");
     assertTrue(fc.isSimpleColour());
     assertEquals(Color.RED, fc.getColour());
 
@@ -292,7 +495,28 @@ public class FeatureColourTest
     assertEquals(12.0f, fc.getThreshold());
 
     /*
-     * graduated colour (by name) (no threshold)
+     * colour by attribute text (no threshold)
+     */
+    fc = FeatureColour.parseJalviewFeatureColour("attribute|CLIN_SIG");
+    assertTrue(fc.isColourByAttribute());
+    assertTrue(fc.isColourByLabel());
+    assertFalse(fc.hasThreshold());
+    assertArrayEquals(new String[] { "CLIN_SIG" }, fc.getAttributeName());
+
+    /*
+     * colour by attributes text (with score threshold)
+     */
+    fc = FeatureColour.parseJalviewFeatureColour(
+            "attribute|CSQ:Consequence|||0.0|0.0|above|12.0");
+    assertTrue(fc.isColourByLabel());
+    assertTrue(fc.isColourByAttribute());
+    assertArrayEquals(new String[] { "CSQ", "Consequence" },
+            fc.getAttributeName());
+    assertTrue(fc.isAboveThreshold());
+    assertEquals(12.0f, fc.getThreshold());
+
+    /*
+     * graduated colour by score (with colour names) (no threshold)
      */
     fc = FeatureColour.parseJalviewFeatureColour("red|green|10.0|20.0");
     assertTrue(fc.isGraduatedColour());
@@ -304,7 +528,35 @@ public class FeatureColourTest
     assertTrue(fc.isAutoScaled());
 
     /*
-     * graduated colour (by hex code) (above threshold)
+     * graduated colour (explicitly by 'score') (no threshold)
+     */
+    fc = FeatureColour
+            .parseJalviewFeatureColour("Score|red|green|10.0|20.0");
+    assertTrue(fc.isGraduatedColour());
+    assertFalse(fc.hasThreshold());
+    assertEquals(Color.RED, fc.getMinColour());
+    assertEquals(Color.GREEN, fc.getMaxColour());
+    assertEquals(10f, fc.getMin());
+    assertEquals(20f, fc.getMax());
+    assertTrue(fc.isAutoScaled());
+
+    /*
+     * graduated colour by attribute (no threshold)
+     */
+    fc = FeatureColour
+            .parseJalviewFeatureColour("attribute|AF|red|green|10.0|20.0");
+    assertTrue(fc.isGraduatedColour());
+    assertTrue(fc.isColourByAttribute());
+    assertArrayEquals(new String[] { "AF" }, fc.getAttributeName());
+    assertFalse(fc.hasThreshold());
+    assertEquals(Color.RED, fc.getMinColour());
+    assertEquals(Color.GREEN, fc.getMaxColour());
+    assertEquals(10f, fc.getMin());
+    assertEquals(20f, fc.getMax());
+    assertTrue(fc.isAutoScaled());
+
+    /*
+     * graduated colour by score (colours by hex code) (above threshold)
      */
     String descriptor = String.format("%s|%s|10.0|20.0|above|15",
             Format.getHexString(Color.RED),
@@ -321,9 +573,26 @@ public class FeatureColourTest
     assertTrue(fc.isAutoScaled());
 
     /*
+     * graduated colour by attributes (below threshold)
+     */
+    fc = FeatureColour.parseJalviewFeatureColour(
+            "attribute|CSQ:AF|red|green|10.0|20.0|below|13");
+    assertTrue(fc.isGraduatedColour());
+    assertTrue(fc.isColourByAttribute());
+    assertArrayEquals(new String[] { "CSQ", "AF" }, fc.getAttributeName());
+    assertTrue(fc.hasThreshold());
+    assertTrue(fc.isBelowThreshold());
+    assertEquals(13f, fc.getThreshold());
+    assertEquals(Color.RED, fc.getMinColour());
+    assertEquals(Color.GREEN, fc.getMaxColour());
+    assertEquals(10f, fc.getMin());
+    assertEquals(20f, fc.getMax());
+    assertTrue(fc.isAutoScaled());
+
+    /*
      * graduated colour (by RGB triplet) (below threshold), absolute scale
      */
-    descriptor = String.format("255,0,0|0,255,0|abso|10.0|20.0|below|15");
+    descriptor = "255,0,0|0,255,0|abso|10.0|20.0|below|15";
     fc = FeatureColour.parseJalviewFeatureColour(descriptor);
     assertTrue(fc.isGraduatedColour());
     assertFalse(fc.isAutoScaled());
@@ -335,9 +604,63 @@ public class FeatureColourTest
     assertEquals(10f, fc.getMin());
     assertEquals(20f, fc.getMax());
 
-    descriptor = String
-            .format("blue|255,0,255|absolute|20.0|95.0|below|66.0");
+    descriptor = "blue|255,0,255|absolute|20.0|95.0|below|66.0";
     fc = FeatureColour.parseJalviewFeatureColour(descriptor);
     assertTrue(fc.isGraduatedColour());
   }
+
+  @Test(groups = { "Functional" })
+  public void testGetColor_colourByAttributeText()
+  {
+    FeatureColour fc = new FeatureColour();
+    fc.setColourByLabel(true);
+    fc.setAttributeName("consequence");
+    SequenceFeature sf = new SequenceFeature("type", "desc", 0, 20, 1f,
+            null);
+
+    /*
+     * if feature has no such attribute, use 'no value' colour
+     */
+    assertEquals(FeatureColour.DEFAULT_NO_COLOUR, fc.getColor(sf));
+
+    /*
+     * if feature has attribute, generate colour from value
+     */
+    sf.setValue("consequence", "benign");
+    Color expected = ColorUtils.createColourFromName("benign");
+    assertEquals(expected, fc.getColor(sf));
+  }
+
+  @Test(groups = { "Functional" })
+  public void testGetColor_GraduatedByAttributeValue()
+  {
+    /*
+     * graduated colour based on attribute value for AF
+     * given a min-max range of 0-100
+     */
+    FeatureColour fc = new FeatureColour(new Color(50, 100, 150),
+            new Color(150, 200, 250), Color.yellow, 0f, 100f);
+    String attName = "AF";
+    fc.setAttributeName(attName);
+
+    /*
+     * first case: feature lacks the attribute - use 'no value' colour
+     */
+    SequenceFeature sf = new SequenceFeature("type", "desc", 0, 20, 75f,
+            null);
+    assertEquals(Color.yellow, fc.getColor(sf));
+
+    /*
+     * second case: attribute present but not numeric - treat as if absent
+     */
+    sf.setValue(attName, "twelve");
+    assertEquals(Color.yellow, fc.getColor(sf));
+
+    /*
+     * third case: valid attribute value
+     */
+    sf.setValue(attName, "20.0");
+    Color expected = new Color(70, 120, 170);
+    assertEquals(expected, fc.getColor(sf));
+  }
 }
diff --git a/test/jalview/util/MapListTest.java b/test/jalview/util/MapListTest.java
index a2f38e2..029b681 100644
--- a/test/jalview/util/MapListTest.java
+++ b/test/jalview/util/MapListTest.java
@@ -426,7 +426,7 @@ public class MapListTest
   @Test(groups = { "Functional" })
   public void testGetRanges()
   {
-    List ranges = new ArrayList();
+    List ranges = new ArrayList<>();
     ranges.add(new int[] { 2, 3 });
     ranges.add(new int[] { 5, 6 });
     assertEquals("[2, 3, 5, 6]", Arrays.toString(MapList.getRanges(ranges)));
@@ -603,7 +603,7 @@ public class MapListTest
   public void testAddRange()
   {
     int[] range = { 1, 5 };
-    List ranges = new ArrayList();
+    List ranges = new ArrayList<>();
 
     // add to empty list:
     MapList.addRange(range, ranges);
@@ -702,7 +702,7 @@ public class MapListTest
   public void testCoalesceRanges()
   {
     assertNull(MapList.coalesceRanges(null));
-    List ranges = new ArrayList();
+    List ranges = new ArrayList<>();
     assertSame(ranges, MapList.coalesceRanges(ranges));
     ranges.add(new int[] { 1, 3 });
     assertSame(ranges, MapList.coalesceRanges(ranges));
@@ -763,7 +763,7 @@ public class MapListTest
   @Test(groups = { "Functional" })
   public void testCoalesceRanges_withOverlap()
   {
-    List ranges = new ArrayList();
+    List ranges = new ArrayList<>();
     ranges.add(new int[] { 1, 3 });
     ranges.add(new int[] { 2, 5 });
 
@@ -814,4 +814,155 @@ public class MapListTest
     assertEquals(1, merged.size());
     assertArrayEquals(new int[] { 9, 0 }, merged.get(0));
   }
+
+  /**
+   * Test the method that compounds ('traverses') two mappings
+   */
+  @Test(groups = "Functional")
+  public void testTraverse()
+  {
+    /*
+     * simple 1:1 plus 1:1 forwards
+     */
+    MapList ml1 = new MapList(new int[] { 3, 4, 8, 12 }, new int[] { 5, 8,
+        11, 13 }, 1, 1);
+    MapList ml2 = new MapList(new int[] { 1, 50 }, new int[] { 40, 45, 70,
+        75, 90, 127 }, 1, 1);
+    MapList compound = ml1.traverse(ml2);
+
+    assertEquals(compound.getFromRatio(), 1);
+    assertEquals(compound.getToRatio(), 1);
+    List fromRanges = compound.getFromRanges();
+    assertEquals(fromRanges.size(), 2);
+    assertArrayEquals(new int[] { 3, 4 }, fromRanges.get(0));
+    assertArrayEquals(new int[] { 8, 12 }, fromRanges.get(1));
+    List toRanges = compound.getToRanges();
+    assertEquals(toRanges.size(), 2);
+    // 5-8 maps to 44-45,70-71
+    // 11-13 maps to 74-75,90
+    assertArrayEquals(new int[] { 44, 45, 70, 71 }, toRanges.get(0));
+    assertArrayEquals(new int[] { 74, 75, 90, 90 }, toRanges.get(1));
+
+    /*
+     * 1:1 over 1:1 backwards ('reverse strand')
+     */
+    ml1 = new MapList(new int[] { 1, 50 }, new int[] { 70, 119 }, 1, 1);
+    ml2 = new MapList(new int[] { 1, 500 },
+            new int[] { 1000, 901, 600, 201 }, 1, 1);
+    compound = ml1.traverse(ml2);
+
+    assertEquals(compound.getFromRatio(), 1);
+    assertEquals(compound.getToRatio(), 1);
+    fromRanges = compound.getFromRanges();
+    assertEquals(fromRanges.size(), 1);
+    assertArrayEquals(new int[] { 1, 50 }, fromRanges.get(0));
+    toRanges = compound.getToRanges();
+    assertEquals(toRanges.size(), 1);
+    assertArrayEquals(new int[] { 931, 901, 600, 582 }, toRanges.get(0));
+
+    /*
+     * 1:1 plus 1:3 should result in 1:3
+     */
+    ml1 = new MapList(new int[] { 1, 30 }, new int[] { 11, 40 }, 1, 1);
+    ml2 = new MapList(new int[] { 1, 100 }, new int[] { 1, 50, 91, 340 },
+            1, 3);
+    compound = ml1.traverse(ml2);
+
+    assertEquals(compound.getFromRatio(), 1);
+    assertEquals(compound.getToRatio(), 3);
+    fromRanges = compound.getFromRanges();
+    assertEquals(fromRanges.size(), 1);
+    assertArrayEquals(new int[] { 1, 30 }, fromRanges.get(0));
+    // 11-40 maps to 31-50,91-160
+    toRanges = compound.getToRanges();
+    assertEquals(toRanges.size(), 1);
+    assertArrayEquals(new int[] { 31, 50, 91, 160 }, toRanges.get(0));
+
+    /*
+     * 3:1 plus 1:1 should result in 3:1
+     */
+    ml1 = new MapList(new int[] { 1, 30 }, new int[] { 11, 20 }, 3, 1);
+    ml2 = new MapList(new int[] { 1, 100 }, new int[] { 1, 15, 91, 175 },
+            1, 1);
+    compound = ml1.traverse(ml2);
+
+    assertEquals(compound.getFromRatio(), 3);
+    assertEquals(compound.getToRatio(), 1);
+    fromRanges = compound.getFromRanges();
+    assertEquals(fromRanges.size(), 1);
+    assertArrayEquals(new int[] { 1, 30 }, fromRanges.get(0));
+    // 11-20 maps to 11-15, 91-95
+    toRanges = compound.getToRanges();
+    assertEquals(toRanges.size(), 1);
+    assertArrayEquals(new int[] { 11, 15, 91, 95 }, toRanges.get(0));
+
+    /*
+     * 1:3 plus 3:1 should result in 1:1
+     */
+    ml1 = new MapList(new int[] { 21, 40 }, new int[] { 13, 72 }, 1, 3);
+    ml2 = new MapList(new int[] { 1, 300 }, new int[] { 51, 70, 121, 200 },
+            3, 1);
+    compound = ml1.traverse(ml2);
+
+    assertEquals(compound.getFromRatio(), 1);
+    assertEquals(compound.getToRatio(), 1);
+    fromRanges = compound.getFromRanges();
+    assertEquals(fromRanges.size(), 1);
+    assertArrayEquals(new int[] { 21, 40 }, fromRanges.get(0));
+    // 13-72 maps 3:1 to 55-70, 121-124
+    toRanges = compound.getToRanges();
+    assertEquals(toRanges.size(), 1);
+    assertArrayEquals(new int[] { 55, 70, 121, 124 }, toRanges.get(0));
+
+    /*
+     * 3:1 plus 1:3 should result in 1:1
+     */
+    ml1 = new MapList(new int[] { 31, 90 }, new int[] { 13, 32 }, 3, 1);
+    ml2 = new MapList(new int[] { 11, 40 }, new int[] { 41, 50, 71, 150 },
+            1, 3);
+    compound = ml1.traverse(ml2);
+
+    assertEquals(compound.getFromRatio(), 1);
+    assertEquals(compound.getToRatio(), 1);
+    fromRanges = compound.getFromRanges();
+    assertEquals(fromRanges.size(), 1);
+    assertArrayEquals(new int[] { 31, 90 }, fromRanges.get(0));
+    // 13-32 maps to 47-50,71-126
+    toRanges = compound.getToRanges();
+    assertEquals(toRanges.size(), 1);
+    assertArrayEquals(new int[] { 47, 50, 71, 126 }, toRanges.get(0));
+
+    /*
+     * method returns null if not all regions are mapped through
+     */
+    ml1 = new MapList(new int[] { 1, 50 }, new int[] { 101, 150 }, 1, 1);
+    ml2 = new MapList(new int[] { 131, 180 }, new int[] { 201, 250 }, 1, 3);
+    compound = ml1.traverse(ml2);
+    assertNull(compound);
+  }
+
+  /**
+   * Test that method that inspects for the (first) forward or reverse 'to' range.
+   * Single position ranges are ignored.
+   */
+  @Test(groups = { "Functional" })
+  public void testIsToForwardsStrand()
+  {
+    // [3-9] declares forward strand
+    MapList ml = new MapList(new int[] { 20, 11 },
+            new int[]
+            { 2, 2, 3, 9, 12, 11 }, 1, 1);
+    assertTrue(ml.isToForwardStrand());
+
+    // [11-5] declares reverse strand ([13-14] is ignored)
+    ml = new MapList(new int[] { 20, 11 },
+            new int[]
+            { 2, 2, 11, 5, 13, 14 }, 1, 1);
+    assertFalse(ml.isToForwardStrand());
+
+    // all single position ranges - defaults to forward strand
+    ml = new MapList(new int[] { 3, 1 }, new int[] { 2, 2, 4, 4, 6, 6 }, 1,
+            1);
+    assertTrue(ml.isToForwardStrand());
+  }
 }
diff --git a/test/jalview/util/MappingUtilsTest.java b/test/jalview/util/MappingUtilsTest.java
index 5226819..d4cf98a 100644
--- a/test/jalview/util/MappingUtilsTest.java
+++ b/test/jalview/util/MappingUtilsTest.java
@@ -1149,6 +1149,95 @@ public class MappingUtilsTest
     assertEquals("[12, 11, 8, 4]", Arrays.toString(ranges));
   }
 
+  @Test(groups = { "Functional" })
+  public void testRangeContains()
+  {
+    /*
+     * both forward ranges
+     */
+    assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
+        1, 10 }));
+    assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
+        2, 10 }));
+    assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
+        1, 9 }));
+    assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
+        4, 5 }));
+    assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
+        0, 9 }));
+    assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
+        -10, -9 }));
+    assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
+        1, 11 }));
+    assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
+        11, 12 }));
+
+    /*
+     * forward range, reverse query
+     */
+    assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
+        10, 1 }));
+    assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
+        9, 1 }));
+    assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
+        10, 2 }));
+    assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
+        5, 5 }));
+    assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
+        11, 1 }));
+    assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
+        10, 0 }));
+
+    /*
+     * reverse range, forward query
+     */
+    assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
+        1, 10 }));
+    assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
+        1, 9 }));
+    assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
+        2, 10 }));
+    assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
+        6, 6 }));
+    assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
+        6, 11 }));
+    assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
+        11, 20 }));
+    assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
+        -3, -2 }));
+
+    /*
+     * both reverse
+     */
+    assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
+        10, 1 }));
+    assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
+        9, 1 }));
+    assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
+        10, 2 }));
+    assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
+        3, 3 }));
+    assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
+        11, 1 }));
+    assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
+        10, 0 }));
+    assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
+        12, 11 }));
+    assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
+        -5, -8 }));
+
+    /*
+     * bad arguments
+     */
+    assertFalse(MappingUtils.rangeContains(new int[] { 1, 10, 12 },
+            new int[] {
+        1, 10 }));
+    assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 },
+            new int[] { 1 }));
+    assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, null));
+    assertFalse(MappingUtils.rangeContains(null, new int[] { 1, 10 }));
+  }
+
   @Test(groups = "Functional")
   public void testRemoveEndPositions()
   {
diff --git a/test/jalview/util/MathUtilsTest.java b/test/jalview/util/MathUtilsTest.java
new file mode 100644
index 0000000..dc23472
--- /dev/null
+++ b/test/jalview/util/MathUtilsTest.java
@@ -0,0 +1,26 @@
+package jalview.util;
+
+import static org.testng.Assert.assertEquals;
+
+import org.testng.annotations.Test;
+
+public class MathUtilsTest
+{
+  @Test(groups = "Functional")
+  public void testGcd()
+  {
+    assertEquals(MathUtils.gcd(0, 0), 0);
+    assertEquals(MathUtils.gcd(0, 1), 1);
+    assertEquals(MathUtils.gcd(1, 0), 1);
+    assertEquals(MathUtils.gcd(1, 1), 1);
+    assertEquals(MathUtils.gcd(1, -1), 1);
+    assertEquals(MathUtils.gcd(-1, 1), 1);
+    assertEquals(MathUtils.gcd(2, 3), 1);
+    assertEquals(MathUtils.gcd(4, 2), 2);
+    assertEquals(MathUtils.gcd(2, 4), 2);
+    assertEquals(MathUtils.gcd(2, -4), 2);
+    assertEquals(MathUtils.gcd(-2, 4), 2);
+    assertEquals(MathUtils.gcd(-2, -4), 2);
+    assertEquals(MathUtils.gcd(2 * 3 * 5 * 7 * 11, 3 * 7 * 13 * 17), 3 * 7);
+  }
+}
diff --git a/test/jalview/util/StringUtilsTest.java b/test/jalview/util/StringUtilsTest.java
index b6f8a25..084219a 100644
--- a/test/jalview/util/StringUtilsTest.java
+++ b/test/jalview/util/StringUtilsTest.java
@@ -228,4 +228,26 @@ public class StringUtilsTest
     assertEquals("", StringUtils.toSentenceCase(""));
     assertNull(StringUtils.toSentenceCase(null));
   }
+
+  @Test(groups = { "Functional" })
+  public void testStripHtmlTags()
+  {
+    assertNull(StringUtils.stripHtmlTags(null));
+    assertEquals("", StringUtils.stripHtmlTags(""));
+    assertEquals(
+            "label",
+            StringUtils
+                    .stripHtmlTags("label"));
+
+    // if no "" tag, < and > get html-encoded (not sure why)
+    assertEquals("<a href=\"something\">label</href>",
+            StringUtils.stripHtmlTags("label"));
+
+    //  gets removed but not  (is this intentional?)
+    assertEquals("hello",
+            StringUtils.stripHtmlTags("
hello"));
+
+    assertEquals("kdHydro < 12.53",
+            StringUtils.stripHtmlTags("kdHydro < 12.53"));
+  }
 }
diff --git a/test/jalview/util/matcher/ConditionTest.java b/test/jalview/util/matcher/ConditionTest.java
new file mode 100644
index 0000000..2a12534
--- /dev/null
+++ b/test/jalview/util/matcher/ConditionTest.java
@@ -0,0 +1,76 @@
+package jalview.util.matcher;
+
+import static org.testng.Assert.assertEquals;
+import static org.testng.Assert.assertNull;
+
+import java.util.Locale;
+
+import org.testng.annotations.Test;
+
+public class ConditionTest
+{
+  @Test(groups = "Functional")
+  public void testToString()
+  {
+    Locale.setDefault(Locale.UK);
+    assertEquals(Condition.Contains.toString(), "Contains");
+    assertEquals(Condition.NotContains.toString(), "Does not contain");
+    assertEquals(Condition.Matches.toString(), "Matches");
+    assertEquals(Condition.NotMatches.toString(), "Does not match");
+    assertEquals(Condition.Present.toString(), "Is present");
+    assertEquals(Condition.NotPresent.toString(), "Is not present");
+    assertEquals(Condition.LT.toString(), "<");
+    assertEquals(Condition.LE.toString(), "<=");
+    assertEquals(Condition.GT.toString(), ">");
+    assertEquals(Condition.GE.toString(), ">=");
+    assertEquals(Condition.EQ.toString(), "=");
+    assertEquals(Condition.NE.toString(), "not =");
+
+    /*
+     * repeat call to get coverage of value caching
+     */
+    assertEquals(Condition.NE.toString(), "not =");
+  }
+
+  @Test(groups = "Functional")
+  public void testGetStableName()
+  {
+    assertEquals(Condition.Contains.getStableName(), "Contains");
+    assertEquals(Condition.NotContains.getStableName(), "NotContains");
+    assertEquals(Condition.Matches.getStableName(), "Matches");
+    assertEquals(Condition.NotMatches.getStableName(), "NotMatches");
+    assertEquals(Condition.Present.getStableName(), "Present");
+    assertEquals(Condition.NotPresent.getStableName(), "NotPresent");
+    assertEquals(Condition.LT.getStableName(), "LT");
+    assertEquals(Condition.LE.getStableName(), "LE");
+    assertEquals(Condition.GT.getStableName(), "GT");
+    assertEquals(Condition.GE.getStableName(), "GE");
+    assertEquals(Condition.EQ.getStableName(), "EQ");
+    assertEquals(Condition.NE.getStableName(), "NE");
+  }
+
+  @Test(groups = "Functional")
+  public void testFromString()
+  {
+    assertEquals(Condition.fromString("Contains"), Condition.Contains);
+    // not case sensitive
+    assertEquals(Condition.fromString("contains"), Condition.Contains);
+    assertEquals(Condition.fromString("CONTAINS"), Condition.Contains);
+    assertEquals(Condition.fromString("NotContains"),
+            Condition.NotContains);
+    assertEquals(Condition.fromString("Matches"), Condition.Matches);
+    assertEquals(Condition.fromString("NotMatches"), Condition.NotMatches);
+    assertEquals(Condition.fromString("Present"), Condition.Present);
+    assertEquals(Condition.fromString("NotPresent"), Condition.NotPresent);
+    assertEquals(Condition.fromString("LT"), Condition.LT);
+    assertEquals(Condition.fromString("LE"), Condition.LE);
+    assertEquals(Condition.fromString("GT"), Condition.GT);
+    assertEquals(Condition.fromString("GE"), Condition.GE);
+    assertEquals(Condition.fromString("EQ"), Condition.EQ);
+    assertEquals(Condition.fromString("NE"), Condition.NE);
+
+    assertNull(Condition.fromString("Equals"));
+    assertNull(Condition.fromString(""));
+    assertNull(Condition.fromString(null));
+  }
+}
diff --git a/test/jalview/util/matcher/MatcherTest.java b/test/jalview/util/matcher/MatcherTest.java
new file mode 100644
index 0000000..a47fb60
--- /dev/null
+++ b/test/jalview/util/matcher/MatcherTest.java
@@ -0,0 +1,273 @@
+package jalview.util.matcher;
+
+import static org.testng.Assert.assertEquals;
+import static org.testng.Assert.assertFalse;
+import static org.testng.Assert.assertNotEquals;
+import static org.testng.Assert.assertTrue;
+import static org.testng.Assert.fail;
+
+import java.util.Locale;
+
+import org.testng.annotations.Test;
+
+import junit.extensions.PA;
+
+public class MatcherTest
+{
+  @Test(groups = "Functional")
+  public void testConstructor()
+  {
+    MatcherI m = new Matcher(Condition.Contains, "foo");
+    assertEquals(m.getCondition(), Condition.Contains);
+    assertEquals(m.getPattern(), "foo");
+    assertEquals(PA.getValue(m, "uppercasePattern"), "FOO");
+    assertEquals(m.getFloatValue(), 0f);
+
+    m = new Matcher(Condition.GT, -2.1f);
+    assertEquals(m.getCondition(), Condition.GT);
+    assertEquals(m.getPattern(), "-2.1");
+    assertEquals(m.getFloatValue(), -2.1f);
+
+    m = new Matcher(Condition.NotContains, "-1.2f");
+    assertEquals(m.getCondition(), Condition.NotContains);
+    assertEquals(m.getPattern(), "-1.2f");
+    assertEquals(m.getFloatValue(), 0f);
+
+    m = new Matcher(Condition.GE, "-1.2f");
+    assertEquals(m.getCondition(), Condition.GE);
+    assertEquals(m.getPattern(), "-1.2");
+    assertEquals(m.getFloatValue(), -1.2f);
+
+    try
+    {
+      new Matcher(null, 0f);
+      fail("Expected exception");
+    } catch (NullPointerException e)
+    {
+      // expected
+    }
+
+    try
+    {
+      new Matcher(Condition.LT, "123,456");
+      fail("Expected exception");
+    } catch (NumberFormatException e)
+    {
+      // expected
+    }
+  }
+
+  /**
+   * Tests for float comparison conditions
+   */
+  @Test(groups = "Functional")
+  public void testMatches_float()
+  {
+    /*
+     * EQUALS test
+     */
+    MatcherI m = new Matcher(Condition.EQ, 2f);
+    assertTrue(m.matches("2"));
+    assertTrue(m.matches("2.0"));
+    assertFalse(m.matches("2.01"));
+
+    /*
+     * NOT EQUALS test
+     */
+    m = new Matcher(Condition.NE, 2f);
+    assertFalse(m.matches("2"));
+    assertFalse(m.matches("2.0"));
+    assertTrue(m.matches("2.01"));
+
+    /*
+     * >= test
+     */
+    m = new Matcher(Condition.GE, 2f);
+    assertTrue(m.matches("2"));
+    assertTrue(m.matches("2.1"));
+    assertFalse(m.matches("1.9"));
+
+    /*
+     * > test
+     */
+    m = new Matcher(Condition.GT, 2f);
+    assertFalse(m.matches("2"));
+    assertTrue(m.matches("2.1"));
+    assertFalse(m.matches("1.9"));
+
+    /*
+     * <= test
+     */
+    m = new Matcher(Condition.LE, 2f);
+    assertTrue(m.matches("2"));
+    assertFalse(m.matches("2.1"));
+    assertTrue(m.matches("1.9"));
+
+    /*
+     * < test
+     */
+    m = new Matcher(Condition.LT, 2f);
+    assertFalse(m.matches("2"));
+    assertFalse(m.matches("2.1"));
+    assertTrue(m.matches("1.9"));
+  }
+
+  @Test(groups = "Functional")
+  public void testMatches_floatNullOrInvalid()
+  {
+    for (Condition cond : Condition.values())
+    {
+      if (cond.isNumeric())
+      {
+        MatcherI m = new Matcher(cond, 2f);
+        assertFalse(m.matches(null));
+        assertFalse(m.matches(""));
+        assertFalse(m.matches("two"));
+      }
+    }
+  }
+
+  /**
+   * Tests for string comparison conditions
+   */
+  @Test(groups = "Functional")
+  public void testMatches_pattern()
+  {
+    /*
+     * Contains
+     */
+    MatcherI m = new Matcher(Condition.Contains, "benign");
+    assertTrue(m.matches("benign"));
+    assertTrue(m.matches("MOSTLY BENIGN OBSERVED")); // not case-sensitive
+    assertFalse(m.matches("pathogenic"));
+    assertFalse(m.matches(null));
+
+    /*
+     * does not contain
+     */
+    m = new Matcher(Condition.NotContains, "benign");
+    assertFalse(m.matches("benign"));
+    assertFalse(m.matches("MOSTLY BENIGN OBSERVED")); // not case-sensitive
+    assertTrue(m.matches("pathogenic"));
+    assertTrue(m.matches(null)); // null value passes this condition
+
+    /*
+     * matches
+     */
+    m = new Matcher(Condition.Matches, "benign");
+    assertTrue(m.matches("benign"));
+    assertTrue(m.matches(" Benign ")); // trim before testing
+    assertFalse(m.matches("MOSTLY BENIGN"));
+    assertFalse(m.matches("pathogenic"));
+    assertFalse(m.matches(null));
+
+    /*
+     * does not match
+     */
+    m = new Matcher(Condition.NotMatches, "benign");
+    assertFalse(m.matches("benign"));
+    assertFalse(m.matches(" Benign ")); // trim before testing
+    assertTrue(m.matches("MOSTLY BENIGN"));
+    assertTrue(m.matches("pathogenic"));
+    assertTrue(m.matches(null));
+
+    /*
+     * value is present (is not null)
+     */
+    m = new Matcher(Condition.Present, null);
+    assertTrue(m.matches("benign"));
+    assertTrue(m.matches(""));
+    assertFalse(m.matches(null));
+
+    /*
+     * value is not present (is null)
+     */
+    m = new Matcher(Condition.NotPresent, null);
+    assertFalse(m.matches("benign"));
+    assertFalse(m.matches(""));
+    assertTrue(m.matches(null));
+
+    /*
+     * a float with a string match condition will be treated as string
+     */
+    Matcher m1 = new Matcher(Condition.Contains, "32");
+    assertFalse(m1.matches(-203f));
+    assertTrue(m1.matches(-4321.0f));
+  }
+
+  /**
+   * If a float is passed with a string condition it gets converted to a string
+   */
+  @Test(groups = "Functional")
+  public void testMatches_floatWithStringCondition()
+  {
+    MatcherI m = new Matcher(Condition.Contains, 1.2e-6f);
+    assertTrue(m.matches("1.2e-6"));
+
+    m = new Matcher(Condition.Contains, 0.0000001f);
+    assertTrue(m.matches("1.0e-7"));
+    assertTrue(m.matches("1.0E-7"));
+    assertFalse(m.matches("0.0000001f"));
+  }
+
+  @Test(groups = "Functional")
+  public void testToString()
+  {
+    Locale.setDefault(Locale.ENGLISH);
+
+    MatcherI m = new Matcher(Condition.LT, 1.2e-6f);
+    assertEquals(m.toString(), "< 1.2E-6");
+
+    m = new Matcher(Condition.NotMatches, "ABC");
+    assertEquals(m.toString(), "Does not match 'ABC'");
+
+    m = new Matcher(Condition.Contains, -1.2f);
+    assertEquals(m.toString(), "Contains '-1.2'");
+  }
+
+  @Test(groups = "Functional")
+  public void testEquals()
+  {
+    /*
+     * string condition
+     */
+    MatcherI m = new Matcher(Condition.NotMatches, "ABC");
+    assertFalse(m.equals(null));
+    assertFalse(m.equals("foo"));
+    assertTrue(m.equals(m));
+    assertTrue(m.equals(new Matcher(Condition.NotMatches, "ABC")));
+    // not case-sensitive:
+    assertTrue(m.equals(new Matcher(Condition.NotMatches, "abc")));
+    assertFalse(m.equals(new Matcher(Condition.Matches, "ABC")));
+    assertFalse(m.equals(new Matcher(Condition.NotMatches, "def")));
+
+    /*
+     * numeric conditions
+     */
+    m = new Matcher(Condition.LT, -1f);
+    assertFalse(m.equals(null));
+    assertFalse(m.equals("foo"));
+    assertTrue(m.equals(m));
+    assertTrue(m.equals(new Matcher(Condition.LT, -1f)));
+    assertTrue(m.equals(new Matcher(Condition.LT, "-1f")));
+    assertTrue(m.equals(new Matcher(Condition.LT, "-1.00f")));
+    assertFalse(m.equals(new Matcher(Condition.LE, -1f)));
+    assertFalse(m.equals(new Matcher(Condition.GE, -1f)));
+    assertFalse(m.equals(new Matcher(Condition.NE, -1f)));
+    assertFalse(m.equals(new Matcher(Condition.LT, 1f)));
+    assertFalse(m.equals(new Matcher(Condition.LT, -1.1f)));
+  }
+
+  @Test(groups = "Functional")
+  public void testHashCode()
+  {
+    MatcherI m1 = new Matcher(Condition.NotMatches, "ABC");
+    MatcherI m2 = new Matcher(Condition.NotMatches, "ABC");
+    MatcherI m3 = new Matcher(Condition.NotMatches, "AB");
+    MatcherI m4 = new Matcher(Condition.Matches, "ABC");
+    assertEquals(m1.hashCode(), m2.hashCode());
+    assertNotEquals(m1.hashCode(), m3.hashCode());
+    assertNotEquals(m1.hashCode(), m4.hashCode());
+    assertNotEquals(m3.hashCode(), m4.hashCode());
+  }
+}
diff --git a/utils/MessageBundleChecker.java b/utils/MessageBundleChecker.java
index 4489a93..c870f6d 100644
--- a/utils/MessageBundleChecker.java
+++ b/utils/MessageBundleChecker.java
@@ -24,6 +24,7 @@ import java.io.FileReader;
 import java.io.IOException;
 import java.util.HashSet;
 import java.util.Properties;
+import java.util.Set;
 import java.util.TreeSet;
 import java.util.regex.Pattern;
 
@@ -89,7 +90,9 @@ public class MessageBundleChecker implements BufferedLineReader.LineCleaner
 
   private int javaCount;
 
-  private HashSet invalidKeys;
+  private Set invalidKeys;
+
+  private Set dynamicKeys;
 
   /**
    * Runs the scan given the path to the root of Java source directories
@@ -125,7 +128,7 @@ public class MessageBundleChecker implements BufferedLineReader.LineCleaner
   private void doMain(String srcPath) throws IOException
   {
     System.out.println("Scanning " + srcPath
-            + " for calls to MessageManager");
+            + " for calls to MessageManager\n");
     sourcePath = srcPath;
     loadMessages();
     File dir = new File(srcPath);
@@ -134,7 +137,10 @@ public class MessageBundleChecker implements BufferedLineReader.LineCleaner
       System.out.println(srcPath + " not found");
       return;
     }
-    invalidKeys = new HashSet();
+
+    invalidKeys = new HashSet<>();
+    dynamicKeys = new HashSet<>();
+
     if (dir.isDirectory())
     {
       scanDirectory(dir);
@@ -152,17 +158,60 @@ public class MessageBundleChecker implements BufferedLineReader.LineCleaner
   private void reportResults()
   {
     System.out.println("\nScanned " + javaCount + " source files");
-    System.out.println("Message.properties has " + messages.size()
+    System.out.println(
+            "Messages.properties has " + messages.size()
             + " keys");
-    System.out.println("Found " + invalidKeys.size()
-            + " possibly invalid parameter calls");
+    if (!invalidKeys.isEmpty())
+    {
+      System.out.println("Found " + invalidKeys.size()
+              + " possibly invalid parameter call"
+              + (invalidKeys.size() > 1 ? "s" : ""));
+    }
 
-    System.out.println(messageKeys.size()
-            + " keys not found, either unused or constructed dynamically");
+    System.out.println("Keys not found, assumed constructed dynamically:");
+    int dynamicCount = 0;
     for (String key : messageKeys)
     {
-      System.out.println("    " + key);
+      if (isDynamic(key))
+      {
+        System.out.println("    " + key);
+        dynamicCount++;
+      }
+    }
+
+    if (dynamicCount < messageKeys.size())
+    {
+      System.out.println((messageKeys.size() - dynamicCount)
+              + " keys not found, possibly unused");
+      for (String key : messageKeys)
+      {
+        if (!isDynamic(key))
+        {
+          System.out.println("    " + key);
+        }
+      }
+    }
+    System.out
+            .println("(Run i18nAnt.xml to compare other message bundles)");
+  }
+
+  /**
+   * Answers true if the key starts with one of the recorded dynamic key stubs,
+   * else false
+   * 
+   * @param key
+   * @return
+   */
+  private boolean isDynamic(String key)
+  {
+    for (String dynamic : dynamicKeys)
+    {
+      if (key.startsWith(dynamic))
+      {
+        return true;
+      }
     }
+    return false;
   }
 
   /**
@@ -275,14 +324,17 @@ public class MessageBundleChecker implements BufferedLineReader.LineCleaner
         continue;
       }
 
+      String messageKey = getMessageKey(method, methodArgs);
+
       if (METHOD3 == method)
       {
         System.out.println(String.format("Dynamic key at %s line %s %s",
                 path.substring(sourcePath.length()), lineNos, line));
+        String key = messageKey.substring(1, messageKey.length() - 1);
+        dynamicKeys.add(key);
         continue;
       }
 
-      String messageKey = getMessageKey(method, methodArgs);
       if (messageKey == null)
       {
         System.out.println(String.format("Trouble parsing %s line %s %s",
@@ -370,7 +422,7 @@ public class MessageBundleChecker implements BufferedLineReader.LineCleaner
     messages.load(reader);
     reader.close();
 
-    messageKeys = new TreeSet();
+    messageKeys = new TreeSet<>();
     for (Object key : messages.keySet())
     {
       messageKeys.add((String) key);
diff --git a/utils/proguard.jar b/utils/proguard.jar
deleted file mode 100755
index dfb7f29..0000000
Binary files a/utils/proguard.jar and /dev/null differ
diff --git a/utils/proguard_5.3.3.jar b/utils/proguard_5.3.3.jar
new file mode 100755
index 0000000..08f4a4c
Binary files /dev/null and b/utils/proguard_5.3.3.jar differ

Type	variant
Start/end	22-33
Description	G,C
Score	12.5
Group	group
Child		ENSP002
Parent		ENSG001

Type	Pfam
Start/end	8-83
Description	Fer2 Status: True Positive Pfam 8_8
Group	Uniprot