From: gmungoc Date: Thu, 18 Jun 2015 16:13:10 +0000 (+0100) Subject: JAL-892 JAL-1779 save/restore Varna viewer to/from project X-Git-Tag: Release_2_10_0~601 X-Git-Url: http://source.jalview.org/gitweb/?a=commitdiff_plain;h=7aef14d879f7bfb8af464a6b7700a99413eab0c6;p=jalview.git JAL-892 JAL-1779 save/restore Varna viewer to/from project --- diff --git a/src/jalview/datamodel/RnaViewerModel.java b/src/jalview/datamodel/RnaViewerModel.java new file mode 100644 index 0000000..33783ec --- /dev/null +++ b/src/jalview/datamodel/RnaViewerModel.java @@ -0,0 +1,46 @@ +package jalview.datamodel; + + +/** + * A data bean class to hold properties of an RNA viewer + */ +public class RnaViewerModel +{ + public final String viewId; + + public final String title; + + public final int x; + + public final int y; + + public final int width; + + public final int height; + + public final int dividerLocation; + + /** + * Constructor + * + * @param viewId + * @param title + * @param xpos + * @param ypos + * @param width + * @param height + * @param dividerLocation + */ + public RnaViewerModel(String viewId, String title, int xpos, int ypos, + int width, + int height, int dividerLocation) + { + this.viewId = viewId; + this.title = title; + this.x = xpos; + this.y = ypos; + this.width = width; + this.height = height; + this.dividerLocation = dividerLocation; + } +} diff --git a/src/jalview/ext/varna/RnaModel.java b/src/jalview/ext/varna/RnaModel.java new file mode 100644 index 0000000..44c6cf6 --- /dev/null +++ b/src/jalview/ext/varna/RnaModel.java @@ -0,0 +1,37 @@ +package jalview.ext.varna; + +import fr.orsay.lri.varna.models.rna.RNA; + +import jalview.datamodel.AlignmentAnnotation; +import jalview.datamodel.SequenceI; + +/** + * Data bean wrapping the data items that define one RNA view + */ +public class RnaModel +{ + public final String title; + + public final AlignmentAnnotation ann; + + public final SequenceI seq; + + public final boolean gapped; + + public final RNA rna; + + // path to a file holding VARNA session state XML + public final String varnaSession; + + public RnaModel(String t, AlignmentAnnotation aa, SequenceI s, RNA r, + boolean g, + String sessionFile) + { + title = t; + ann = aa; + seq = s; + gapped = g; + rna = r; + varnaSession = sessionFile; + } +} \ No newline at end of file diff --git a/src/jalview/gui/AppVarna.java b/src/jalview/gui/AppVarna.java index 5c3785a..9316b05 100644 --- a/src/jalview/gui/AppVarna.java +++ b/src/jalview/gui/AppVarna.java @@ -22,8 +22,10 @@ package jalview.gui; import java.awt.BorderLayout; import java.awt.Color; -import java.util.ArrayList; +import java.util.Collection; import java.util.Hashtable; +import java.util.LinkedHashMap; +import java.util.List; import java.util.Map; import java.util.regex.Matcher; import java.util.regex.Pattern; @@ -35,102 +37,207 @@ import javax.swing.event.InternalFrameEvent; import fr.orsay.lri.varna.VARNAPanel; import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax; +import fr.orsay.lri.varna.exceptions.ExceptionLoadingFailed; import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses; -import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener; import fr.orsay.lri.varna.interfaces.InterfaceVARNASelectionListener; import fr.orsay.lri.varna.models.BaseList; -import fr.orsay.lri.varna.models.VARNAConfig; +import fr.orsay.lri.varna.models.FullBackup; import fr.orsay.lri.varna.models.annotations.HighlightRegionAnnotation; import fr.orsay.lri.varna.models.rna.ModeleBase; import fr.orsay.lri.varna.models.rna.RNA; -import jalview.bin.Cache; +import jalview.analysis.AlignSeq; +import jalview.datamodel.AlignmentAnnotation; import jalview.datamodel.ColumnSelection; +import jalview.datamodel.RnaViewerModel; import jalview.datamodel.SequenceGroup; import jalview.datamodel.SequenceI; +import jalview.ext.varna.RnaModel; import jalview.structure.SecondaryStructureListener; import jalview.structure.SelectionListener; import jalview.structure.SelectionSource; import jalview.structure.StructureSelectionManager; import jalview.structure.VamsasSource; +import jalview.util.Comparison; import jalview.util.MessageManager; import jalview.util.ShiftList; -public class AppVarna extends JInternalFrame implements - InterfaceVARNAListener, SelectionListener, - SecondaryStructureListener// implements - // Runnable,SequenceStructureBinding, - // ViewSetProvider - , InterfaceVARNASelectionListener, VamsasSource - +public class AppVarna extends JInternalFrame implements SelectionListener, + SecondaryStructureListener, InterfaceVARNASelectionListener, + VamsasSource { - AppVarnaBinding vab; + private static final Pattern PAIRS_PATTERN = Pattern + .compile("[^([{<>}])]"); + + private AppVarnaBinding vab; - VARNAPanel varnaPanel; + private AlignmentPanel ap; - public String name; + private String viewId; - public StructureSelectionManager ssm; + private StructureSelectionManager ssm; /* - * public AppVarna(){ vab = new AppVarnaBinding(); initVarna(); } + * Lookup for sequence and annotation mapped to each RNA in the viewer. Using + * a linked hashmap means that order is preserved when saved to the project. */ + private Map models = new LinkedHashMap(); + + private Map offsets = new Hashtable(); + + private Map offsetsInv = new Hashtable(); + + private JSplitPane split; - AlignmentPanel ap; + private VarnaHighlighter mouseOverHighlighter = new VarnaHighlighter(); - public AppVarna(String sname, SequenceI seq, String strucseq, - String struc, String name, AlignmentPanel ap) + private VarnaHighlighter selectionHighlighter = new VarnaHighlighter(); + + private class VarnaHighlighter { + private HighlightRegionAnnotation _lastHighlight; - // System.out.println("1:"+sname); - // System.out.println("2:"+seq); - // System.out.println("3:"+strucseq); - // System.out.println("4:"+struc); - // System.out.println("5:"+name); - // System.out.println("6:"+ap); - this.ap = ap; - ArrayList rnaList = new ArrayList(); - RNA rna1 = new RNA(name); - try + private RNA _lastRNAhighlighted = null; + + public VarnaHighlighter() { - rna1.setRNA(strucseq, replaceOddGaps(struc)); - // System.out.println("The sequence is :"+rna1.getSeq()); - // System.out.println("The sequence is:"+struc); - // System.out.println("The sequence is:"+replaceOddGaps(struc).toString()); - } catch (ExceptionUnmatchedClosingParentheses e2) + } + + /** + * Constructor when restoring from Varna session, including any highlight + * state + * + * @param rna + */ + public VarnaHighlighter(RNA rna) { - e2.printStackTrace(); - } catch (ExceptionFileFormatOrSyntax e3) + // TODO nice try but doesn't work; do we need a highlighter per model? + _lastRNAhighlighted = rna; + List highlights = rna.getHighlightRegion(); + if (highlights != null && !highlights.isEmpty()) + { + _lastHighlight = highlights.get(0); + } + } + + public void highlightRegion(RNA rna, int start, int end) { - e3.printStackTrace(); + clearLastSelection(); + HighlightRegionAnnotation highlight = new HighlightRegionAnnotation( + rna.getBasesBetween(start, end)); + rna.addHighlightRegion(highlight); + _lastHighlight = highlight; + _lastRNAhighlighted = rna; } - RNA trim = trimRNA(rna1, "trimmed " + sname); - rnaList.add(trim); - rnaList.add(rna1); - rnas.put(seq, rna1); - rnas.put(seq, trim); - rna1.setName(sname + " (with gaps)"); + public HighlightRegionAnnotation getLastHighlight() + { + return _lastHighlight; + } + /** + * Clears all structure selection and refreshes the display + */ + public void clearSelection() { - seqs.put(trim, seq); - seqs.put(rna1, seq); + if (_lastRNAhighlighted != null) + { + _lastRNAhighlighted.getHighlightRegion().clear(); + vab.updateSelectedRNA(_lastRNAhighlighted); + _lastRNAhighlighted = null; + _lastHighlight = null; + } + } - /** - * if (false || seq.getStart()!=1) { for (RNA rshift:rnaList) { ShiftList - * shift=offsets.get(rshift); if (shift==null) { offsets.put(rshift, - * shift=new ShiftList());} shift.addShift(1, seq.getStart()-1); - * offsetsInv.put(rshift, shift.getInverse()); } } - **/ + /** + * Clear the last structure selection + */ + public void clearLastSelection() + { + if (_lastRNAhighlighted != null) + { + _lastRNAhighlighted.removeHighlightRegion(_lastHighlight); + _lastRNAhighlighted = null; + _lastHighlight = null; + } } - vab = new AppVarnaBinding(rnaList); - // vab = new AppVarnaBinding(seq,struc); - this.name = sname + " trimmed to " + name; + } + + /** + * Constructor + * + * @param sname + * a descriptive name + * @param seq + * the RNA sequence + * @param aa + * the annotation with the secondary structure string + * @param ap + * the AlignmentPanel creating this object + */ + public AppVarna(String sname, SequenceI seq, AlignmentAnnotation aa, + AlignmentPanel ap) + { + this(ap); + + String name = sname + " trimmed to " + seq.getName(); + String fullName = MessageManager.formatMessage("label.varna_params", + new String[] + { name }); + setTitle(fullName); + + /* + * if (!aa.isValidStruc()) { throw new + * IllegalArgumentException("Invalid RNA structure annotation"); } final + * String struc = aa.getRNAStruc(); + * + * String strucseq = seq.getSequenceAsString(); + * + * String gappedTitle = sname + " (with gaps)"; String rnaTitle = + * gappedTitle; RNA gapped = new RNA(rnaTitle); try { + * gapped.setRNA(strucseq, replaceOddGaps(struc)); } catch + * (ExceptionUnmatchedClosingParentheses e2) { e2.printStackTrace(); } catch + * (ExceptionFileFormatOrSyntax e3) { e3.printStackTrace(); } + * models.put(gapped, new RnaModel(rnaTitle, aa, seq, gapped, true, null)); + * + * String trimmedTitle = "trimmed " + sname; rnaTitle = trimmedTitle; RNA + * trimmed = trimRNA(gapped, rnaTitle); models.put(trimmed, new + * RnaModel(rnaTitle, aa, seq, trimmed, false, null)); + */ + // vab = new AppVarnaBinding(Arrays.asList(new RNA[] + // { trimmed, gapped })); + // vab = new AppVarnaBinding(); + // // String seqName = seq.getName(); + // // String name = sname + " trimmed to " + seqName; + // initVarna(name); + + String gappedTitle = sname + " (with gaps)"; + RnaModel gappedModel = new RnaModel(gappedTitle, aa, seq, null, true, + null); + addModel(gappedModel, gappedTitle); + + String trimmedTitle = "trimmed " + sname; + RnaModel trimmedModel = new RnaModel(trimmedTitle, aa, seq, null, + false, null); + addModel(trimmedModel, trimmedTitle); + vab.setSelectedIndex(0); + } + + /** + * Constructor that links the viewer to a parent panel (but has no structures + * yet - use addModel to add them) + * + * @param ap + */ + protected AppVarna(AlignmentPanel ap) + { + this.ap = ap; + this.viewId = System.currentTimeMillis() + "." + this.hashCode(); + vab = new AppVarnaBinding(); initVarna(); - ssm = ap.getStructureSelectionManager(); - // System.out.println(ssm.toString()); + this.ssm = ap.getStructureSelectionManager(); ssm.addStructureViewerListener(this); ssm.addSelectionListener(this); addInternalFrameListener(new InternalFrameAdapter() @@ -141,40 +248,59 @@ public class AppVarna extends JInternalFrame implements close(); } }); + } + /** + * Constructor given viewer data read from a saved project file + * + * @param model + * @param ap + * the (or a) parent alignment panel + */ + public AppVarna(RnaViewerModel model, AlignmentPanel ap) + { + this(ap); + setTitle(model.title); + this.viewId = model.viewId; + setBounds(model.x, model.y, model.width, model.height); + this.split.setDividerLocation(model.dividerLocation); } + /** + * Constructs a split pane with an empty selection list and display panel, and + * adds it to the desktop + */ public void initVarna() { - - // vab.setFinishedInit(false); - varnaPanel = vab.get_varnaPanel(); + VARNAPanel varnaPanel = vab.get_varnaPanel(); setBackground(Color.white); - JSplitPane split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT, true, + split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT, true, vab.getListPanel(), varnaPanel); getContentPane().setLayout(new BorderLayout()); getContentPane().add(split, BorderLayout.CENTER); - // getContentPane().add(vab.getTools(), BorderLayout.NORTH); - varnaPanel.addVARNAListener(this); + varnaPanel.addSelectionListener(this); - jalview.gui.Desktop.addInternalFrame(this, - MessageManager.formatMessage("label.varna_params", new String[] - { name }), getBounds().width, getBounds().height); + jalview.gui.Desktop.addInternalFrame(this, "", getBounds().width, + getBounds().height); this.pack(); showPanel(true); - } public String replaceOddGaps(String oldStr) { - String patternStr = "[^([{<>}])]"; - String replacementStr = "."; - Pattern pattern = Pattern.compile(patternStr); - Matcher matcher = pattern.matcher(oldStr); - String newStr = matcher.replaceAll(replacementStr); + Matcher matcher = PAIRS_PATTERN.matcher(oldStr); + String newStr = matcher.replaceAll("."); return newStr; } + /** + * Constructs a new RNA model from the given one, without gaps. Also + * calculates and saves a 'shift list' + * + * @param rna + * @param name + * @return + */ public RNA trimRNA(RNA rna, String name) { ShiftList offset = new ShiftList(); @@ -191,19 +317,23 @@ public class AppVarna extends JInternalFrame implements e3.printStackTrace(); } - StringBuffer seq = new StringBuffer(rnaTrim.getSeq()); - StringBuffer struc = new StringBuffer(rnaTrim.getStructDBN()); - int ofstart = -1, sleng = rnaTrim.getSeq().length(); + String seq = rnaTrim.getSeq(); + StringBuilder struc = new StringBuilder(256); + struc.append(rnaTrim.getStructDBN()); + int ofstart = -1; + int sleng = seq.length(); + for (int i = 0; i < sleng; i++) { - // TODO: Jalview utility for gap detection java.utils.isGap() - // TODO: Switch to jalview rna datamodel - if (jalview.util.Comparison.isGap(seq.charAt(i))) + if (Comparison.isGap(seq.charAt(i))) { if (ofstart == -1) { ofstart = i; } + /* + * mark base or base pair in the structure with * + */ if (!rnaTrim.findPair(i).isEmpty()) { int m = rnaTrim.findPair(i).get(1); @@ -232,35 +362,37 @@ public class AppVarna extends JInternalFrame implements offset.addShift(offset.shift(ofstart), ofstart - sleng); ofstart = -1; } - String newSeq = rnaTrim.getSeq().replace("-", ""); - rnaTrim.getSeq().replace(".", ""); + + /* + * remove the marked gaps from the structure + */ String newStruc = struc.toString().replace("*", ""); + /* + * remove gaps from the sequence + */ + String newSeq = AlignSeq.extractGaps(Comparison.GapChars, seq); + try { rnaTrim.setRNA(newSeq, newStruc); registerOffset(rnaTrim, offset); } catch (ExceptionUnmatchedClosingParentheses e) { - // TODO Auto-generated catch block e.printStackTrace(); } catch (ExceptionFileFormatOrSyntax e) { - // TODO Auto-generated catch block e.printStackTrace(); } return rnaTrim; } - // needs to be many-many - Map seqs = new Hashtable(); - - Map rnas = new Hashtable(); - - Map offsets = new Hashtable(); - - Map offsetsInv = new Hashtable(); - + /** + * Save the sequence to structure mapping, and also its inverse. + * + * @param rnaTrim + * @param offset + */ private void registerOffset(RNA rnaTrim, ShiftList offset) { offsets.put(rnaTrim, offset); @@ -272,83 +404,6 @@ public class AppVarna extends JInternalFrame implements this.setVisible(show); } - private boolean _started = false; - - public void run() - { - _started = true; - - try - { - initVarna(); - } catch (OutOfMemoryError oomerror) - { - new OOMWarning("When trying to open the Varna viewer!", oomerror); - } catch (Exception ex) - { - Cache.log.error("Couldn't open Varna viewer!", ex); - } - } - - @Override - public void onUINewStructure(VARNAConfig v, RNA r) - { - - } - - @Override - public void onWarningEmitted(String s) - { - // TODO Auto-generated method stub - - } - - private class VarnaHighlighter - { - private HighlightRegionAnnotation _lastHighlight; - - private RNA _lastRNAhighlighted = null; - - public void highlightRegion(RNA rna, int start, int end) - { - clearSelection(null); - HighlightRegionAnnotation highlight = new HighlightRegionAnnotation( - rna.getBasesBetween(start, end)); - rna.addHighlightRegion(highlight); - _lastHighlight = highlight; - _lastRNAhighlighted = rna; - - } - - public HighlightRegionAnnotation getLastHighlight() - { - return _lastHighlight; - } - - public RNA getLastRNA() - { - return _lastRNAhighlighted; - } - - public void clearSelection(AppVarnaBinding vab) - { - if (_lastRNAhighlighted != null) - { - _lastRNAhighlighted.removeHighlightRegion(_lastHighlight); - if (vab != null) - { - vab.updateSelectedRNA(_lastRNAhighlighted); - } - _lastRNAhighlighted = null; - _lastHighlight = null; - - } - } - } - - VarnaHighlighter mouseOverHighlighter = new VarnaHighlighter(), - selectionHighlighter = new VarnaHighlighter(); - /** * If a mouseOver event from the AlignmentPanel is noticed the currently * selected RNA in the VARNA window is highlighted at the specific position. @@ -359,7 +414,11 @@ public class AppVarna extends JInternalFrame implements public void mouseOverSequence(SequenceI sequence, int index) { RNA rna = vab.getSelectedRNA(); - if (seqs.get(rna) == sequence) + if (rna == null) + { + return; + } + if (models.get(rna).seq == sequence) { ShiftList shift = offsets.get(rna); if (shift != null) @@ -374,13 +433,6 @@ public class AppVarna extends JInternalFrame implements } @Override - public void onStructureRedrawn() - { - // TODO Auto-generated method stub - - } - - @Override public void selection(SequenceGroup seqsel, ColumnSelection colsel, SelectionSource source) { @@ -390,10 +442,14 @@ public class AppVarna extends JInternalFrame implements // TODO - reuse many-one panel-view system in jmol viewer return; } + RNA rna = vab.getSelectedRNA(); + if (rna == null) + { + return; + } if (seqsel != null && seqsel.getSize() > 0) { int start = seqsel.getStartRes(), end = seqsel.getEndRes(); - RNA rna = vab.getSelectedRNA(); ShiftList shift = offsets.get(rna); if (shift != null) { @@ -408,27 +464,30 @@ public class AppVarna extends JInternalFrame implements } else { - selectionHighlighter.clearSelection(vab); + selectionHighlighter.clearSelection(); } } + /** + * Respond to a change of the base hovered over in the Varna viewer + */ @Override - public void onHoverChanged(ModeleBase arg0, ModeleBase arg1) + public void onHoverChanged(ModeleBase previousBase, ModeleBase newBase) { RNA rna = vab.getSelectedRNA(); ShiftList shift = offsetsInv.get(rna); - SequenceI seq = seqs.get(rna); - if (arg1 != null && seq != null) + SequenceI seq = models.get(rna).seq; + if (newBase != null && seq != null) { if (shift != null) { - int i = shift.shift(arg1.getIndex()); + int i = shift.shift(newBase.getIndex()); // System.err.println("shifted "+(arg1.getIndex())+" to "+i); ssm.mouseOverVamsasSequence(seq, i, this); } else { - ssm.mouseOverVamsasSequence(seq, arg1.getIndex(), this); + ssm.mouseOverVamsasSequence(seq, newBase.getIndex(), this); } } } @@ -441,18 +500,56 @@ public class AppVarna extends JInternalFrame implements } - @Override - public void onTranslationChanged() + /** + * Returns the path to a temporary file containing a representation of the + * state of one Varna display + * + * @param rna + * + * @return + */ + public String getStateInfo(RNA rna) + { + return vab.getStateInfo(rna); + } + + public AlignmentPanel getAlignmentPanel() { - // TODO Auto-generated method stub + return ap; + } + public String getViewId() + { + return viewId; } - @Override - public void onZoomLevelChanged() + /** + * Returns true if any of the viewer's models (not necessarily the one + * currently displayed) is for the given sequence + * + * @param seq + * @return + */ + public boolean isListeningFor(SequenceI seq) { - // TODO Auto-generated method stub + for (RnaModel model : models.values()) + { + if (model.seq == seq) + { + return true; + } + } + return false; + } + /** + * Returns a value representing the horizontal split divider location + * + * @return + */ + public int getDividerLocation() + { + return split == null ? 0 : split.getDividerLocation(); } /** @@ -461,7 +558,7 @@ public class AppVarna extends JInternalFrame implements protected void close() { /* - * Deregister as a listener, to free references to this object + * Deregister as a listener, to release references to this object */ if (ssm != null) { @@ -470,4 +567,158 @@ public class AppVarna extends JInternalFrame implements } } + /** + * Returns the secondary structure annotation that this viewer displays for + * the given sequence + * + * @return + */ + public AlignmentAnnotation getAnnotation(SequenceI seq) + { + for (RnaModel model : models.values()) + { + if (model.seq == seq) + { + return model.ann; + } + } + return null; + } + + public int getSelectedIndex() + { + return this.vab.getSelectedIndex(); + } + + /** + * Returns the set of models shown by the viewer + * + * @return + */ + public Collection getModels() + { + return models.values(); + } + + /** + * Add a model (e.g. loaded from project file) + * + * @param rna + * @param modelName + */ + public RNA addModel(RnaModel model, String modelName) + { + if (!model.ann.isValidStruc()) + { + throw new IllegalArgumentException("Invalid RNA structure annotation"); + } + + /* + * loaded from project file with Varna session data + */ + if (model.varnaSession != null) + { + try + { + FullBackup fromSession = vab.vp.loadSession(model.varnaSession); + vab.addStructure(fromSession.rna, fromSession.config); + RNA rna = fromSession.rna; + // copy the model, but now including the RNA object + RnaModel newModel = new RnaModel(model.title, model.ann, model.seq, + rna, model.gapped, model.varnaSession); + if (!model.gapped) + { + registerOffset(rna, buildOffset(model.seq)); + } + // TODO and add mapping (offsets) + models.put(rna, newModel); + // capture rna selection state when saved + selectionHighlighter = new VarnaHighlighter(rna); + return fromSession.rna; + } catch (ExceptionLoadingFailed e) + { + e.printStackTrace(); + return null; + } + } + + /* + * opened on request in Jalview session + */ + RNA rna = new RNA(modelName); + String struc = model.ann.getRNAStruc(); + struc = replaceOddGaps(struc); + + String strucseq = model.seq.getSequenceAsString(); + try + { + rna.setRNA(strucseq, struc); + } catch (ExceptionUnmatchedClosingParentheses e2) + { + e2.printStackTrace(); + } catch (ExceptionFileFormatOrSyntax e3) + { + e3.printStackTrace(); + } + + if (!model.gapped) + { + rna = trimRNA(rna, modelName); + } + models.put(rna, new RnaModel(modelName, model.ann, model.seq, rna, + model.gapped, null)); + vab.addStructure(rna); + return rna; + } + + /** + * Constructs a shift list that describes the gaps in the sequence + * + * @param seq + * @return + */ + protected ShiftList buildOffset(SequenceI seq) + { + // TODO refactor to avoid duplication with trimRNA() + ShiftList offset = new ShiftList(); + int ofstart = -1; + int sleng = seq.getLength(); + char[] seqChars = seq.getSequence(); + + for (int i = 0; i < sleng; i++) + { + if (Comparison.isGap(seqChars[i])) + { + if (ofstart == -1) + { + ofstart = i; + } + } + else + { + if (ofstart > -1) + { + offset.addShift(offset.shift(ofstart), ofstart - i); + ofstart = -1; + } + } + } + // final gap + if (ofstart > -1) + { + offset.addShift(offset.shift(ofstart), ofstart - sleng); + ofstart = -1; + } + return offset; + } + + /** + * Set the selected index in the model selection list + * + * @param selectedRna + */ + public void setSelectedIndex(int selectedRna) + { + vab.setSelectedIndex(selectedRna); + } } diff --git a/src/jalview/gui/AppVarnaBinding.java b/src/jalview/gui/AppVarnaBinding.java index 38385f0..3ea8e4d 100644 --- a/src/jalview/gui/AppVarnaBinding.java +++ b/src/jalview/gui/AppVarnaBinding.java @@ -25,33 +25,27 @@ import java.awt.Color; import java.awt.Component; import java.awt.Dimension; import java.awt.Font; -import java.awt.GridLayout; import java.awt.datatransfer.DataFlavor; import java.awt.datatransfer.Transferable; import java.awt.dnd.DnDConstants; import java.awt.dnd.DropTarget; -import java.awt.dnd.DropTargetDragEvent; +import java.awt.dnd.DropTargetAdapter; import java.awt.dnd.DropTargetDropEvent; -import java.awt.dnd.DropTargetEvent; -import java.awt.dnd.DropTargetListener; -import java.awt.event.ActionEvent; -import java.awt.event.ActionListener; import java.awt.event.ComponentEvent; +import java.awt.event.MouseAdapter; import java.awt.event.MouseEvent; -import java.awt.event.MouseListener; import java.io.File; +import java.io.IOException; import java.util.ArrayList; import java.util.Collection; import java.util.List; import javax.swing.DefaultListModel; import javax.swing.DefaultListSelectionModel; -import javax.swing.JButton; import javax.swing.JLabel; import javax.swing.JList; import javax.swing.JPanel; import javax.swing.JScrollPane; -import javax.swing.JTextField; import javax.swing.ListModel; import javax.swing.ListSelectionModel; import javax.swing.event.ListSelectionEvent; @@ -59,70 +53,44 @@ import javax.swing.event.ListSelectionListener; import fr.orsay.lri.varna.VARNAPanel; import fr.orsay.lri.varna.components.ReorderableJList; -import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax; import fr.orsay.lri.varna.exceptions.ExceptionLoadingFailed; import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength; -import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses; -import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener; import fr.orsay.lri.varna.models.FullBackup; import fr.orsay.lri.varna.models.VARNAConfig; -import fr.orsay.lri.varna.models.rna.Mapping; import fr.orsay.lri.varna.models.rna.RNA; import jalview.datamodel.SequenceI; +import jalview.ext.varna.JalviewVarnaBinding; import jalview.structure.AtomSpec; import jalview.util.MessageManager; -public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding - implements DropTargetListener, InterfaceVARNAListener, - MouseListener +public class AppVarnaBinding extends JalviewVarnaBinding { - - /** - * - */ - // private static final long serialVersionUID = -790155708306987257L; - - private String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA"; - - private String DEFAULT_STRUCTURE1 = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...))))).."; - - private String DEFAULT_STRUCTURE2 = "..(((((...(((((...(((((........(((((...(((((.....)))))...)))))..................))))).....)))))...))))).."; - public VARNAPanel vp; - protected JPanel _tools = new JPanel(); - - private JPanel _input = new JPanel(); - - private JPanel _seqPanel = new JPanel(); - - private JPanel _strPanel = new JPanel(); - - private JLabel _info = new JLabel(); - - private JTextField _str = new JTextField(); - - private JTextField _seq = new JTextField(); - - private JLabel _strLabel = new JLabel( - MessageManager.getString("label.str")); - - private JLabel _seqLabel = new JLabel( - MessageManager.getString("label.seq")); - - private JButton _createButton = new JButton( - MessageManager.getString("action.create")); - - private JButton _updateButton = new JButton( - MessageManager.getString("action.update")); - - private JButton _deleteButton = new JButton( - MessageManager.getString("action.delete")); - - private JButton _duplicateButton = new JButton( - MessageManager.getString("action.snapshot")); - + // remove unused (commented out) fields? + // protected JPanel _tools = new JPanel(); + // + // private JPanel _input = new JPanel(); + // + // private JPanel _strPanel = new JPanel(); + // + // private JTextField _str = new JTextField(); + // + // private JTextField _seq = new JTextField(); + // + // private JLabel _strLabel = new JLabel( + // MessageManager.getString("label.str")); + // + // private JButton _updateButton = new JButton( + // MessageManager.getString("action.update")); + // + // private JButton _deleteButton = new JButton( + // MessageManager.getString("action.delete")); + // + // private JButton _duplicateButton = new JButton( + // MessageManager.getString("action.snapshot")); + // protected JPanel _listPanel = new JPanel(); private ReorderableJList _sideList = null; @@ -141,32 +109,23 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding private BackupHolder _rnaList; - /* - * public AppVarnaBinding() { //super("VARNA in Jalview"); - * //this.set_seq("ATGC"); //this.set_str(".()."); //RNAPanelDemoInit(); - * - * //initVarna("ATGCATGATATATATATAT","....((((...))))...."); - * initVarna(this.DEFAULT_SEQUENCE,this.DEFAULT_STRUCTURE1); } + /** + * Constructor */ - - public AppVarnaBinding(String seq, String struc) - { - // super("VARNA in Jalview"); - initVarna(seq, struc); - - } - - public AppVarnaBinding(ArrayList rnaList) + public AppVarnaBinding() { - - // super("VARNA in Jalview"); - initVarnaEdit(rnaList); + init(); } - private void initVarna(String seq, String str) + /** + * Constructs the VARNAPanel and an (empty) selection list of structures to + * show in it + */ + private void init() { + DefaultListModel dlm = new DefaultListModel(); - DefaultListModel dlm = new DefaultListModel(); + int marginTools = 40; DefaultListSelectionModel m = new DefaultListSelectionModel(); m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); @@ -174,124 +133,32 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding _sideList = new ReorderableJList(); _sideList.setModel(dlm); - _sideList.addMouseListener(this); - _sideList.setSelectionModel(m); - _sideList.setPreferredSize(new Dimension(100, 0)); - _sideList.addListSelectionListener(new ListSelectionListener() + _sideList.addMouseListener(new MouseAdapter() { - public void valueChanged(ListSelectionEvent arg0) - { - if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting()) - { - FullBackup sel = (FullBackup) _sideList.getSelectedValue(); - Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA() - .getSize(), sel.rna.getSize()); - vp.showRNAInterpolated(sel.rna, sel.config, map); - _seq.setText(sel.rna.getSeq()); - _str.setText(sel.rna.getStructDBN()); - } + @Override + public void mouseClicked(MouseEvent e) { + AppVarnaBinding.this.mouseClicked(e); } }); - - _rnaList = new BackupHolder(dlm, _sideList); - RNA _RNA1 = new RNA("User defined 1"); - - try - { - - vp = new VARNAPanel("0", "."); - _RNA1.setRNA(seq, str); - _RNA1.drawRNARadiate(vp.getConfig()); - } catch (ExceptionNonEqualLength e) - { - vp.errorDialog(e); - } catch (ExceptionUnmatchedClosingParentheses e2) - { - e2.printStackTrace(); - } catch (ExceptionFileFormatOrSyntax e3) - { - e3.printStackTrace(); - } - vp.setPreferredSize(new Dimension(400, 400)); - _rnaList.add(vp.getConfig().clone(), _RNA1, generateDefaultName(), true); - - // TODO setBackground(_backgroundColor); - vp.setBackground(_backgroundColor); - - // TODO getContentPane().setLayout(new BorderLayout()); - // TODO getContentPane().add(vp, BorderLayout.CENTER); - - // setVisible(true); - vp.addVARNAListener(this); - } - - private void initVarnaEdit(ArrayList rnaInList) - { - - DefaultListModel dlm = new DefaultListModel(); - - int marginTools = 40; - - DefaultListSelectionModel m = new DefaultListSelectionModel(); - m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); - m.setLeadAnchorNotificationEnabled(false); - - _sideList = new ReorderableJList(); - _sideList.setModel(dlm); - _sideList.addMouseListener(this); _sideList.setSelectionModel(m); _sideList.setPreferredSize(new Dimension(100, 0)); _sideList.addListSelectionListener(new ListSelectionListener() { - public void valueChanged(ListSelectionEvent arg0) + public void valueChanged(ListSelectionEvent evt) { - // System.out.println(arg0); - if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting()) - { - FullBackup sel = (FullBackup) _sideList.getSelectedValue(); - Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA() - .getSize(), sel.rna.getSize()); - // vp.showRNAInterpolated(sel.rna, sel.config, map); - vp.showRNA(sel.rna, sel.config); - // _seq.setText(sel.rna.getSeq()); - _str.setText(sel.rna.getStructDBN()); - } + changeSelectedStructure_actionPerformed(evt); } }); _rnaList = new BackupHolder(dlm, _sideList); try { - vp = new VARNAPanel("0", "."); - for (int i = 0; i < rnaInList.size(); i++) - { - rnaInList.get(i).drawRNARadiate(vp.getConfig()); - - } } catch (ExceptionNonEqualLength e) { vp.errorDialog(e); } vp.setPreferredSize(new Dimension(400, 400)); - for (int i = 0; i < rnaInList.size(); i++) - { - if (i < rnaInList.size() - 1) - { - _rnaList.add(vp.getConfig().clone(), rnaInList.get(i), rnaInList - .get(i).getName()); - } - else - { - _rnaList.add(vp.getConfig().clone(), rnaInList.get(i), rnaInList - .get(i).getName(), true); - } - } - - /* - * _rnaList.add(vp.getConfig().clone(),_RNA2,generateDefaultName()); - * _rnaList.add(vp.getConfig().clone(),_RNA1,generateDefaultName(),true); - */ JScrollPane listScroller = new JScrollPane(_sideList); listScroller.setPreferredSize(new Dimension(150, 0)); @@ -300,86 +167,61 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12"); - // _seqLabel.setHorizontalTextPosition(JLabel.LEFT); - // _seqLabel.setPreferredSize(new Dimension(marginTools, 15)); - _seq.setFont(textFieldsFont); - _seq.setText(rnaInList.get(0).getSeq()); - - _updateButton.addActionListener(new ActionListener() - { - public void actionPerformed(ActionEvent e) - { - FullBackup sel = (FullBackup) _sideList.getSelectedValue(); - sel.rna.setSequence("A"); - } - }); - - // _seqPanel.setLayout(new BorderLayout()); - // _seqPanel.add(_seqLabel, BorderLayout.WEST); - // _seqPanel.add(_seq, BorderLayout.CENTER); - - _strLabel.setPreferredSize(new Dimension(marginTools, 15)); - _strLabel.setHorizontalTextPosition(JLabel.LEFT); - _str.setFont(textFieldsFont); - _strPanel.setLayout(new BorderLayout()); - _strPanel.add(_strLabel, BorderLayout.WEST); - _strPanel.add(_str, BorderLayout.CENTER); - - _input.setLayout(new GridLayout(1, 0)); - // _input.add(_seqPanel); - _input.add(_strPanel); - - JPanel goPanel = new JPanel(); - goPanel.setLayout(new BorderLayout()); - - _tools.setLayout(new BorderLayout()); - _tools.add(_input, BorderLayout.CENTER); - // _tools.add(_info, BorderLayout.SOUTH); - _tools.add(goPanel, BorderLayout.EAST); - - /* - * _deleteButton.addActionListener(new ActionListener() { public void - * actionPerformed(ActionEvent e) { _rnaList.removeSelected(); } }); - * _duplicateButton.addActionListener(new ActionListener() { public void - * actionPerformed(ActionEvent e) { - * _rnaList.add((VARNAConfig)vp.getConfig(). - * clone(),vp.getRNA().clone(),vp.getRNA - * ().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new - * Date()),true); }}); - */ - goPanel.add(_updateButton, BorderLayout.CENTER); - - JPanel ops = new JPanel(); - ops.setLayout(new GridLayout(1, 2)); - ops.add(_deleteButton); - ops.add(_duplicateButton); + // MC commented out stuff not added to panel - remove? + // _seq.setFont(textFieldsFont); + // if (!rnaList.isEmpty()) + // { + // _seq.setText(rnaList.get(0).getSeq()); + // } + + // _updateButton.addActionListener(new ActionListener() + // { + // public void actionPerformed(ActionEvent e) + // { + // FullBackup sel = (FullBackup) _sideList.getSelectedValue(); + // sel.rna.setSequence("A"); + // } + // }); + // + // _strLabel.setPreferredSize(new Dimension(marginTools, 15)); + // _strLabel.setHorizontalTextPosition(JLabel.LEFT); + // _str.setFont(textFieldsFont); + // _strPanel.setLayout(new BorderLayout()); + // _strPanel.add(_strLabel, BorderLayout.WEST); + // _strPanel.add(_str, BorderLayout.CENTER); + // + // _input.setLayout(new GridLayout(1, 0)); + // _input.add(_strPanel); + // + // JPanel goPanel = new JPanel(); + // goPanel.setLayout(new BorderLayout()); + // + // _tools.setLayout(new BorderLayout()); + // _tools.add(_input, BorderLayout.CENTER); + // _tools.add(goPanel, BorderLayout.EAST); + // + // goPanel.add(_updateButton, BorderLayout.CENTER); + // + // JPanel ops = new JPanel(); + // ops.setLayout(new GridLayout(1, 2)); + // ops.add(_deleteButton); + // ops.add(_duplicateButton); JLabel j = new JLabel( MessageManager.getString("label.structures_manager"), JLabel.CENTER); _listPanel.setLayout(new BorderLayout()); - // _listPanel.add(ops, BorderLayout.SOUTH); _listPanel.add(j, BorderLayout.NORTH); _listPanel.add(listScroller, BorderLayout.CENTER); - // JSplitPane split = new - // JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,vp); - /** - * TODO getContentPane().setLayout(new BorderLayout()); - * getContentPane().add(split, BorderLayout.CENTER); - * getContentPane().add(_tools, BorderLayout.NORTH); - */ - - // TODO setVisible(true); - DropTarget dt = new DropTarget(vp, this); - - vp.addVARNAListener(this); - } - - public JPanel getTools() - { - return _tools; + new DropTarget(vp, new DropTargetAdapter() { + @Override + public void drop(DropTargetDropEvent dtde) + { + AppVarnaBinding.this.drop(dtde); + } + }); } public JPanel getListPanel() @@ -388,13 +230,19 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding } /** - * TODO: Is it effective to transfer the whole RNA? + * Returns the currently selected RNA, or null if none selected * - * @return Currently selected RNA + * @return */ public RNA getSelectedRNA() { - return _rnaList.getElementAt(_sideList.getSelectedIndex()).rna; + int selectedIndex = _sideList.getSelectedIndex(); + if (selectedIndex < 0) + { + return null; + } + FullBackup selected = _rnaList.getElementAt(selectedIndex); + return selected.rna; } /** @@ -408,123 +256,11 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding vp.showRNA(rnaEdit); } - /* - * private void RNAPanelDemoInit() { DefaultListModel dlm = new - * DefaultListModel(); - * - * - * int marginTools = 40; - * - * DefaultListSelectionModel m = new DefaultListSelectionModel(); - * m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); - * m.setLeadAnchorNotificationEnabled(false); - * - * - * _sideList = new ReorderableJList(); _sideList.setModel(dlm); - * _sideList.addMouseListener(this); _sideList.setSelectionModel(m); - * _sideList.setPreferredSize(new Dimension(100, 0)); - * _sideList.addListSelectionListener( new ListSelectionListener(){ public - * void valueChanged(ListSelectionEvent arg0) { //System.out.println(arg0); if - * (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting()) { FullBackup - * sel = (FullBackup) _sideList.getSelectedValue(); Mapping map = - * Mapping.DefaultOutermostMapping(vp.getRNA().getSize(), sel.rna.getSize()); - * vp.showRNAInterpolated(sel.rna,sel.config,map); - * _seq.setText(sel.rna.getSeq()); _str.setText(sel.rna.getStructDBN()); } } - * }); - * - * _rnaList = new BackupHolder(dlm,_sideList); RNA _RNA1 = new - * RNA("User defined 1"); RNA _RNA2 = new RNA("User defined 2"); try { vp = - * new VARNAPanel("0","."); _RNA1.setRNA(DEFAULT_SEQUENCE, - * DEFAULT_STRUCTURE1); _RNA1.drawRNARadiate(vp.getConfig()); - * _RNA2.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE2); - * _RNA2.drawRNARadiate(vp.getConfig()); } catch (ExceptionNonEqualLength e) { - * vp.errorDialog(e); } catch (ExceptionUnmatchedClosingParentheses e2) { - * e2.printStackTrace(); } catch (ExceptionFileFormatOrSyntax e3) { - * e3.printStackTrace(); } vp.setPreferredSize(new Dimension(400, 400)); - * _rnaList.add(vp.getConfig().clone(),_RNA2,generateDefaultName()); - * _rnaList.add(vp.getConfig().clone(),_RNA1,generateDefaultName(),true); - * - * JScrollPane listScroller = new JScrollPane(_sideList); - * listScroller.setPreferredSize(new Dimension(150, 0)); - * - * setBackground(_backgroundColor); vp.setBackground(_backgroundColor); - * - * - * Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12"); - * - * _seqLabel.setHorizontalTextPosition(JLabel.LEFT); - * _seqLabel.setPreferredSize(new Dimension(marginTools, 15)); - * _seq.setFont(textFieldsFont); _seq.setText(DEFAULT_SEQUENCE); - * - * _createButton.addActionListener(new ActionListener() { public void - * actionPerformed(ActionEvent e) { try { RNA nRNA = new - * RNA(generateDefaultName()); nRNA.setRNA(_seq.getText(), _str.getText()); - * nRNA.drawRNARadiate(vp.getConfig()); _rnaList.add(new - * VARNAConfig(),nRNA,true); } catch (ExceptionUnmatchedClosingParentheses e1) - * { JOptionPane.showMessageDialog(vp, e1.getMessage(),"Error", - * JOptionPane.ERROR_MESSAGE); } catch (ExceptionFileFormatOrSyntax e1) { - * JOptionPane.showMessageDialog(vp, e1.getMessage(),"Error", - * JOptionPane.ERROR_MESSAGE); } } }); - * - * - * _seqPanel.setLayout(new BorderLayout()); _seqPanel.add(_seqLabel, - * BorderLayout.WEST); _seqPanel.add(_seq, BorderLayout.CENTER); - * - * _strLabel.setPreferredSize(new Dimension(marginTools, 15)); - * _strLabel.setHorizontalTextPosition(JLabel.LEFT); - * _str.setFont(textFieldsFont); _strPanel.setLayout(new BorderLayout()); - * _strPanel.add(_strLabel, BorderLayout.WEST); _strPanel.add(_str, - * BorderLayout.CENTER); - * - * _input.setLayout(new GridLayout(2, 0)); _input.add(_seqPanel); - * _input.add(_strPanel); - * - * JPanel goPanel = new JPanel(); goPanel.setLayout(new BorderLayout()); - * - * _tools.setLayout(new BorderLayout()); _tools.add(_input, - * BorderLayout.CENTER); _tools.add(_info, BorderLayout.SOUTH); - * _tools.add(goPanel, BorderLayout.EAST); - * - * _deleteButton.addActionListener(new ActionListener() { public void - * actionPerformed(ActionEvent e) { _rnaList.removeSelected(); } }); - * _duplicateButton.addActionListener(new ActionListener() { public void - * actionPerformed(ActionEvent e) { - * _rnaList.add((VARNAConfig)vp.getConfig().clone - * (),vp.getRNA().clone(),vp.getRNA - * ().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new - * Date()),true); }}); - * - * JPanel ops = new JPanel(); ops.setLayout(new GridLayout(1,2)); - * ops.add(_deleteButton); ops.add(_duplicateButton); - * - * JLabel j = new JLabel("Structures Manager",JLabel.CENTER); - * _listPanel.setLayout(new BorderLayout()); - * - * _listPanel.add(ops,BorderLayout.SOUTH); - * _listPanel.add(j,BorderLayout.NORTH); - * _listPanel.add(listScroller,BorderLayout.CENTER); - * - * goPanel.add(_createButton, BorderLayout.CENTER); - * - * JSplitPane split = new - * JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,vp); - * getContentPane().setLayout(new BorderLayout()); getContentPane().add(split, - * BorderLayout.CENTER); getContentPane().add(_tools, BorderLayout.NORTH); - * - * setVisible(true); DropTarget dt = new DropTarget(vp, this); - * - * vp.addVARNAListener(this); } - */ public static String generateDefaultName() { return "User file #" + _nextID++; } - public RNA getRNA() - { - return (RNA) _sideList.getSelectedValue(); - } - public String[][] getParameterInfo() { String[][] info = @@ -537,12 +273,6 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding return info; } - public void init() - { - vp.setBackground(_backgroundColor); - _error = true; - } - @SuppressWarnings("unused") private Color getSafeColor(String col, Color def) { @@ -573,60 +303,6 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding vp = surface; } - public String get_seq() - { - return _seq.getText(); - } - - public void set_seq(String _seq) - { - this._seq.setText(_seq); - } - - public String get_str() - { - return _str.getText(); - } - - public void set_str(String _str) - { - this._str.setText(_str); - } - - public JLabel get_info() - { - return _info; - } - - public void set_info(JLabel _info) - { - this._info = _info; - } - - /* - * public static void main(String[] args) { AppVarnaBinding d = new - * AppVarnaBinding(); d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); - * d.pack(); d.setVisible(true); } - */ - - public void dragEnter(DropTargetDragEvent arg0) - { - // TODO Auto-generated method stub - - } - - public void dragExit(DropTargetEvent arg0) - { - // TODO Auto-generated method stub - - } - - public void dragOver(DropTargetDragEvent arg0) - { - // TODO Auto-generated method stub - - } - public void drop(DropTargetDropEvent dtde) { try @@ -653,7 +329,7 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding if (c instanceof VARNAPanel) { String path = o.toString(); - VARNAPanel vp = (VARNAPanel) c; + VARNAPanel varnaPanel = (VARNAPanel) c; try { FullBackup bck = VARNAPanel.importSession(path); @@ -665,7 +341,7 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding .loadSecStr(path); for (RNA r : mdls) { - r.drawRNA(vp.getConfig()); + r.drawRNA(varnaPanel.getConfig()); String name = r.getName(); if (name.equals("")) { @@ -676,7 +352,7 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding { name += " (Model " + mn++ + ")"; } - _rnaList.add(vp.getConfig().clone(), r, name, true); + _rnaList.add(varnaPanel.getConfig().clone(), r, name, true); } } } @@ -698,147 +374,67 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding } - public void dropActionChanged(DropTargetDragEvent arg0) - { - } - private class BackupHolder { - private DefaultListModel _rnaList; + private DefaultListModel _rnalist; - private ArrayList _rnas = new ArrayList(); + private List _rnas = new ArrayList(); JList _l; - public BackupHolder(DefaultListModel rnaList, JList l) + public BackupHolder(DefaultListModel rnaList, JList l) { - _rnaList = rnaList; + _rnalist = rnaList; _l = l; } - public void add(VARNAConfig c, RNA r) - { - add(c, r, r.getName(), false); - } - - public void add(VARNAConfig c, RNA r, boolean select) - { - add(c, r, r.getName(), select); - } - public void add(VARNAConfig c, RNA r, String name) { add(c, r, name, false); } + /** + * Adds an entry to the end of the selection list and (optionally) sets it + * as selected + * + * @param c + * @param r + * @param name + * @param select + */ public void add(VARNAConfig c, RNA r, String name, boolean select) { if (select) { - _l.removeSelectionInterval(0, _rnaList.size()); + _l.removeSelectionInterval(0, _rnalist.size()); } if (name.equals("")) { name = generateDefaultName(); } FullBackup bck = new FullBackup(c, r, name); - _rnas.add(0, r); - _rnaList.add(0, bck); + _rnas.add(r); + _rnalist.addElement(bck); if (select) { _l.setSelectedIndex(0); } } - public void remove(int i) - { - _rnas.remove(i); - _rnaList.remove(i); - - } - - public DefaultListModel getModel() - { - return _rnaList; - } - - public boolean contains(RNA r) - { - return _rnas.contains(r); - } - - /* - * public int getSize() { return _rnaList.getSize(); } - */ public FullBackup getElementAt(int i) { - return (FullBackup) _rnaList.getElementAt(i); - } - - public void removeSelected() - { - int i = _l.getSelectedIndex(); - if (i != -1) - { - if (_rnaList.getSize() == 1) - { - RNA r = new RNA(); - try - { - r.setRNA(" ", "."); - } catch (ExceptionUnmatchedClosingParentheses e1) - { - } catch (ExceptionFileFormatOrSyntax e1) - { - } - vp.showRNA(r); - vp.repaint(); - } - else - { - int newi = i + 1; - if (newi == _rnaList.getSize()) - { - newi = _rnaList.getSize() - 2; - } - FullBackup bck = (FullBackup) _rnaList.getElementAt(newi); - _l.setSelectedValue(bck, true); - } - _rnaList.remove(i); - } - + return _rnalist.getElementAt(i); } } - public void onLayoutChanged() - { - // TODO Auto-generated method stub - - } - - public void onUINewStructure(VARNAConfig v, RNA r) - { - // patch to fix infinite loop - // The problem is that onUINewStructure is called when user clicks - // check with Yann about whether Jalview should do anything with this event. - // e.g. if user has used VARNA's menu to import a structure .. Jalview may - // need to be told which structure is displayed. - - // _rnaList.add(v, r, "", true); - } - - public void onWarningEmitted(String s) - { - } - public void mouseClicked(MouseEvent e) { if (e.getClickCount() == 2) { int index = _sideList.locationToIndex(e.getPoint()); - ListModel dlm = _sideList.getModel(); - FullBackup item = (FullBackup) dlm.getElementAt(index); - ; + ListModel dlm = _sideList.getModel(); + // FullBackup item = dlm.getElementAt(index); + _sideList.ensureIndexIsVisible(index); /* * TODO Object newName = JOptionPane.showInputDialog( this, @@ -850,22 +446,6 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding } } - public void mouseEntered(MouseEvent arg0) - { - } - - public void mouseExited(MouseEvent arg0) - { - } - - public void mousePressed(MouseEvent arg0) - { - } - - public void mouseReleased(MouseEvent arg0) - { - } - @Override public String[] getPdbFile() { @@ -903,28 +483,148 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding } @Override - public void onStructureRedrawn() + public void highlightAtoms(List atoms) { } @Override - public void onZoomLevelChanged() + public boolean isListeningFor(SequenceI seq) { + return true; } - @Override - public void onTranslationChanged() + /** + * Returns the path to a temporary file containing a representation of the + * state of the Varna display, or null on any error + * + * @param rna + * @param jds + * + * @return + */ + public String getStateInfo(RNA rna) { + if (vp == null) + { + return null; + } + + /* + * we have to show the RNA we want to save in the viewer; get the currently + * displayed model first so we can restore it + */ + FullBackup sel = (FullBackup) _sideList.getSelectedValue(); + + FullBackup model = null; + ListModel models = _sideList.getModel(); + for (int i = 0; i < models.getSize(); i++) + { + model = (FullBackup) models.getElementAt(i); + if (model.rna == rna) + { + break; + } + } + if (model == null) + { + return null; + } + + /* + * switch display if not already shown + */ + if (sel.rna != rna) + { + vp.showRNA(model.rna, model.config); + } + + try + { + File temp; + temp = File.createTempFile("varna", null); + temp.deleteOnExit(); + String filePath = temp.getAbsolutePath(); + vp.toXML(filePath); + + /* + * restore the previous display if needed + */ + if (sel.rna != rna) + { + vp.showRNA(sel.rna, sel.config); + } + + return filePath; + } catch (IOException e) + { + return null; + } } - @Override - public void highlightAtoms(List atoms) + public int getSelectedIndex() { + return _sideList.getSelectedIndex(); } - @Override - public boolean isListeningFor(SequenceI seq) + /** + * Switch the Varna display to the structure selected in the left hand panel + * + * @param evt + */ + protected void changeSelectedStructure_actionPerformed(ListSelectionEvent evt) { - return true; + if (!evt.getValueIsAdjusting()) + { + showSelectedStructure(); + } + } + + /** + * + */ + protected void showSelectedStructure() + { + FullBackup sel = (FullBackup) _sideList.getSelectedValue(); + if (sel != null) + { + vp.showRNA(sel.rna, sel.config); + } + } + + /** + * Set and display the selected item in the list of structures + * + * @param selectedRna + */ + public void setSelectedIndex(int selectedRna) + { + /* + * note this does nothing if, say, selecting item 3 when only 1 has been + * added on load + */ + _sideList.setSelectedIndex(selectedRna); + // TODO ? need a worker thread to get this to happen properly + showSelectedStructure(); + } + + /** + * Add an RNA structure to the selection list + * + * @param rna + */ + public void addStructure(RNA rna) + { + VARNAConfig config = vp.getConfig().clone(); + addStructure(rna, config); + } + + /** + * @param rna + * @param config + */ + protected void addStructure(RNA rna, VARNAConfig config) + { + rna.drawRNARadiate(config); + _rnaList.add(config, rna, rna.getName()); } } diff --git a/src/jalview/gui/Jalview2XML.java b/src/jalview/gui/Jalview2XML.java index da9c6a9..8dfe839 100644 --- a/src/jalview/gui/Jalview2XML.java +++ b/src/jalview/gui/Jalview2XML.java @@ -66,9 +66,12 @@ import jalview.datamodel.Alignment; import jalview.datamodel.AlignmentAnnotation; import jalview.datamodel.AlignmentI; import jalview.datamodel.PDBEntry; +import jalview.datamodel.RnaViewerModel; +import jalview.datamodel.SequenceGroup; import jalview.datamodel.SequenceI; import jalview.datamodel.StructureViewerModel; import jalview.datamodel.StructureViewerModel.StructureData; +import jalview.ext.varna.RnaModel; import jalview.gui.StructureViewer.ViewerType; import jalview.schemabinding.version2.AlcodMap; import jalview.schemabinding.version2.AlcodonFrame; @@ -92,6 +95,8 @@ import jalview.schemabinding.version2.OtherData; import jalview.schemabinding.version2.PdbentryItem; import jalview.schemabinding.version2.Pdbids; import jalview.schemabinding.version2.Property; +import jalview.schemabinding.version2.RnaViewer; +import jalview.schemabinding.version2.SecondaryStructure; import jalview.schemabinding.version2.Sequence; import jalview.schemabinding.version2.SequenceSet; import jalview.schemabinding.version2.SequenceSetProperties; @@ -135,8 +140,15 @@ import jalview.ws.params.WsParamSetI; */ public class Jalview2XML { + private static final String VIEWER_PREFIX = "viewer_"; + + private static final String RNA_PREFIX = "rna_"; + private static final String UTF_8 = "UTF-8"; + // use this with nextCounter() to make unique names for entities + private int counter = 0; + /* * SequenceI reference -> XML ID string in jalview XML. Populated as XML reps * of sequence objects are created. @@ -160,6 +172,12 @@ public class Jalview2XML */ private Map splitFrameCandidates = new HashMap(); + /* + * Map from displayed rna structure models to their saved session state jar + * entry names + */ + private Map rnaSessions = new HashMap(); + /** * create/return unique hash string for sq * @@ -369,7 +387,7 @@ public class Jalview2XML */ public void saveState(JarOutputStream jout) { - AlignFrame[] frames = Desktop.getAlignFrames(); // Desktop.desktop.getAllFrames(); + AlignFrame[] frames = Desktop.getAlignFrames(); if (frames == null) { @@ -378,6 +396,13 @@ public class Jalview2XML Hashtable dsses = new Hashtable(); + /* + * ensure cached data is clear before starting + */ + // todo tidy up seqRefIds, seqsToIds initialisation / reset + rnaSessions.clear(); + splitFrameCandidates.clear(); + try { @@ -385,6 +410,7 @@ public class Jalview2XML // ////////////////////////////////////////////////// List shortNames = new ArrayList(); + List viewIds = new ArrayList(); // REVERSE ORDER for (int i = frames.length - 1; i > -1; i--) @@ -411,7 +437,7 @@ public class Jalview2XML fileName = fileName + ".xml"; } - saveState(apanel, fileName, jout); + saveState(apanel, fileName, jout, viewIds); String dssid = getDatasetIdRef(af.getViewport().getAlignment() .getDataset()); @@ -497,6 +523,8 @@ public class Jalview2XML FileOutputStream fos = new FileOutputStream(jarFile); JarOutputStream jout = new JarOutputStream(fos); Hashtable dsses = new Hashtable(); + List viewIds = new ArrayList(); + for (AlignmentPanel apanel : af.alignPanels) { String jfileName = apSize == 1 ? fileName : fileName + ap; @@ -505,7 +533,7 @@ public class Jalview2XML { jfileName = jfileName + ".xml"; } - saveState(apanel, jfileName, jout); + saveState(apanel, jfileName, jout, viewIds); String dssid = getDatasetIdRef(af.getViewport().getAlignment() .getDataset()); if (!dsses.containsKey(dssid)) @@ -543,7 +571,7 @@ public class Jalview2XML { jfileName = jfileName + ".xml"; } - saveState(_af.alignPanel, jfileName, true, jout); + saveState(_af.alignPanel, jfileName, true, jout, null); } } @@ -557,13 +585,14 @@ public class Jalview2XML * name of alignment panel written to output stream * @param jout * jar output stream + * @param viewIds * @param out * jar entry name */ public JalviewModel saveState(AlignmentPanel ap, String fileName, - JarOutputStream jout) + JarOutputStream jout, List viewIds) { - return saveState(ap, fileName, false, jout); + return saveState(ap, fileName, false, jout, viewIds); } /** @@ -583,10 +612,15 @@ public class Jalview2XML * jar entry name */ public JalviewModel saveState(AlignmentPanel ap, String fileName, - boolean storeDS, JarOutputStream jout) + boolean storeDS, JarOutputStream jout, List viewIds) { + if (viewIds == null) + { + viewIds = new ArrayList(); + } + initSeqRefs(); - List viewIds = new ArrayList(); + List userColours = new ArrayList(); AlignViewport av = ap.av; @@ -638,14 +672,13 @@ public class Jalview2XML Set calcIdSet = new HashSet(); // SAVE SEQUENCES - String id = ""; - jalview.datamodel.SequenceI jds, jdatasq; for (int i = 0; i < jal.getHeight(); i++) { - jds = jal.getSequenceAt(i); - jdatasq = jds.getDatasetSequence() == null ? jds : jds + final SequenceI jds = jal.getSequenceAt(i); + final SequenceI jdatasq = jds.getDatasetSequence() == null ? jds + : jds .getDatasetSequence(); - id = seqHash(jds); + String id = seqHash(jds); if (seqRefIds.get(id) != null) { @@ -774,8 +807,8 @@ public class Jalview2XML matchedFile = saveStructureState(ap, jds, pdb, entry, viewIds, matchedFile, viewFrame); /* - * Only store each structure viewer's state once in each XML - * document. First time through only (storeDS==false) + * Only store each structure viewer's state once in the project + * jar. First time through only (storeDS==false) */ String viewId = viewFrame.getViewId(); if (!storeDS && !viewIds.contains(viewId)) @@ -783,8 +816,9 @@ public class Jalview2XML viewIds.add(viewId); try { + String viewerState = viewFrame.getStateInfo(); writeJarEntry(jout, getViewerJarEntryName(viewId), - viewFrame.getStateInfo().getBytes()); + viewerState.getBytes()); } catch (IOException e) { System.err.println("Error saving viewer state: " @@ -834,6 +868,8 @@ public class Jalview2XML } } + saveRnaViewers(jout, jseq, jds, viewIds, storeDS); + jms.addJSeq(jseq); } @@ -942,35 +978,17 @@ public class Jalview2XML } } - /* - * Save associated Varna panels - */ - if (Desktop.desktop != null) - { - for (JInternalFrame frame : Desktop.desktop.getAllFrames()) - { - if (frame instanceof AppVarna) - { - AppVarna vp = (AppVarna) frame; - if (vp.ap == ap) - { - // save Varna state - } - } - } - } - // SAVE ANNOTATIONS /** * store forward refs from an annotationRow to any groups */ - IdentityHashMap groupRefs = new IdentityHashMap(); + IdentityHashMap groupRefs = new IdentityHashMap(); if (storeDS) { for (SequenceI sq : jal.getSequences()) { // Store annotation on dataset sequences only - jalview.datamodel.AlignmentAnnotation[] aa = sq.getAnnotation(); + AlignmentAnnotation[] aa = sq.getAnnotation(); if (aa != null && aa.length > 0) { storeAlignmentAnnotation(aa, groupRefs, av, calcIdSet, storeDS, @@ -983,8 +1001,7 @@ public class Jalview2XML if (jal.getAlignmentAnnotation() != null) { // Store the annotation shown on the alignment. - jalview.datamodel.AlignmentAnnotation[] aa = jal - .getAlignmentAnnotation(); + AlignmentAnnotation[] aa = jal.getAlignmentAnnotation(); storeAlignmentAnnotation(aa, groupRefs, av, calcIdSet, storeDS, vamsasSet); } @@ -996,70 +1013,69 @@ public class Jalview2XML int i = -1; for (jalview.datamodel.SequenceGroup sg : jal.getGroups()) { - groups[++i] = new JGroup(); + JGroup jGroup = new JGroup(); + groups[++i] = jGroup; - groups[i].setStart(sg.getStartRes()); - groups[i].setEnd(sg.getEndRes()); - groups[i].setName(sg.getName()); + jGroup.setStart(sg.getStartRes()); + jGroup.setEnd(sg.getEndRes()); + jGroup.setName(sg.getName()); if (groupRefs.containsKey(sg)) { - // group has references so set it's ID field - groups[i].setId(groupRefs.get(sg).toString()); + // group has references so set its ID field + jGroup.setId(groupRefs.get(sg)); } if (sg.cs != null) { if (sg.cs.conservationApplied()) { - groups[i].setConsThreshold(sg.cs.getConservationInc()); + jGroup.setConsThreshold(sg.cs.getConservationInc()); if (sg.cs instanceof jalview.schemes.UserColourScheme) { - groups[i].setColour(setUserColourScheme(sg.cs, userColours, + jGroup.setColour(setUserColourScheme(sg.cs, userColours, jms)); } else { - groups[i] + jGroup .setColour(ColourSchemeProperty.getColourName(sg.cs)); } } else if (sg.cs instanceof jalview.schemes.AnnotationColourGradient) { - groups[i].setColour("AnnotationColourGradient"); - groups[i].setAnnotationColours(constructAnnotationColours( + jGroup.setColour("AnnotationColourGradient"); + jGroup.setAnnotationColours(constructAnnotationColours( (jalview.schemes.AnnotationColourGradient) sg.cs, userColours, jms)); } else if (sg.cs instanceof jalview.schemes.UserColourScheme) { - groups[i] + jGroup .setColour(setUserColourScheme(sg.cs, userColours, jms)); } else { - groups[i].setColour(ColourSchemeProperty.getColourName(sg.cs)); + jGroup.setColour(ColourSchemeProperty.getColourName(sg.cs)); } - groups[i].setPidThreshold(sg.cs.getThreshold()); + jGroup.setPidThreshold(sg.cs.getThreshold()); } - groups[i].setOutlineColour(sg.getOutlineColour().getRGB()); - groups[i].setDisplayBoxes(sg.getDisplayBoxes()); - groups[i].setDisplayText(sg.getDisplayText()); - groups[i].setColourText(sg.getColourText()); - groups[i].setTextCol1(sg.textColour.getRGB()); - groups[i].setTextCol2(sg.textColour2.getRGB()); - groups[i].setTextColThreshold(sg.thresholdTextColour); - groups[i].setShowUnconserved(sg.getShowNonconserved()); - groups[i].setIgnoreGapsinConsensus(sg.getIgnoreGapsConsensus()); - groups[i].setShowConsensusHistogram(sg.isShowConsensusHistogram()); - groups[i].setShowSequenceLogo(sg.isShowSequenceLogo()); - groups[i].setNormaliseSequenceLogo(sg.isNormaliseSequenceLogo()); - for (int s = 0; s < sg.getSize(); s++) - { - jalview.datamodel.Sequence seq = (jalview.datamodel.Sequence) sg - .getSequenceAt(s); - groups[i].addSeq(seqHash(seq)); + jGroup.setOutlineColour(sg.getOutlineColour().getRGB()); + jGroup.setDisplayBoxes(sg.getDisplayBoxes()); + jGroup.setDisplayText(sg.getDisplayText()); + jGroup.setColourText(sg.getColourText()); + jGroup.setTextCol1(sg.textColour.getRGB()); + jGroup.setTextCol2(sg.textColour2.getRGB()); + jGroup.setTextColThreshold(sg.thresholdTextColour); + jGroup.setShowUnconserved(sg.getShowNonconserved()); + jGroup.setIgnoreGapsinConsensus(sg.getIgnoreGapsConsensus()); + jGroup.setShowConsensusHistogram(sg.isShowConsensusHistogram()); + jGroup.setShowSequenceLogo(sg.isShowSequenceLogo()); + jGroup.setNormaliseSequenceLogo(sg.isNormaliseSequenceLogo()); + for (SequenceI seq : sg.getSequences()) + { + jGroup.addSeq(seqHash(seq)); } } @@ -1310,6 +1326,7 @@ public class Jalview2XML // using save and then load try { + System.out.println("Writing jar entry " + fileName); JarEntry entry = new JarEntry(fileName); jout.putNextEntry(entry); PrintWriter pout = new PrintWriter(new OutputStreamWriter(jout, @@ -1328,14 +1345,106 @@ public class Jalview2XML } /** - * Copy the contents of a file to a new file added to the output jar + * Save any Varna viewers linked to this sequence. Writes an rnaViewer element + * for each viewer, with + *
    + *
  • viewer geometry (position, size, split pane divider location)
  • + *
  • index of the selected structure in the viewer (currently shows gapped + * or ungapped)
  • + *
  • the id of the annotation holding RNA secondary structure
  • + *
  • (currently only one SS is shown per viewer, may be more in future)
  • + *
+ * Varna viewer state is also written out (in native Varna XML) to separate + * project jar entries. A separate entry is written for each RNA structure + * displayed, with the naming convention + *
    + *
  • rna_viewId_sequenceId_annotationId_[gapped|trimmed]
  • + *
+ * + * @param jout + * @param jseq + * @param jds + * @param viewIds + * @param storeDataset + */ + protected void saveRnaViewers(JarOutputStream jout, JSeq jseq, + final SequenceI jds, List viewIds, boolean storeDataset) + { + JInternalFrame[] frames = Desktop.desktop.getAllFrames(); + for (int f = frames.length - 1; f > -1; f--) + { + if (frames[f] instanceof AppVarna) + { + AppVarna varna = (AppVarna) frames[f]; + if (varna.isListeningFor(jds)) + { + /* + * link the sequence to every viewer that is showing it + */ + String viewId = varna.getViewId(); + RnaViewer rna = new RnaViewer(); + rna.setViewId(viewId); + rna.setTitle(varna.getTitle()); + rna.setXpos(varna.getX()); + rna.setYpos(varna.getY()); + rna.setWidth(varna.getWidth()); + rna.setHeight(varna.getHeight()); + rna.setDividerLocation(varna.getDividerLocation()); + rna.setSelectedRna(varna.getSelectedIndex()); + jseq.addRnaViewer(rna); + + /* + * Store each Varna panel's state once in the project per sequence. + * First time through only (storeDataset==false) + */ + // boolean storeSessions = false; + // String sequenceViewId = viewId + seqsToIds.get(jds); + // if (!storeDataset && !viewIds.contains(sequenceViewId)) + // { + // viewIds.add(sequenceViewId); + // storeSessions = true; + // } + for (RnaModel model : varna.getModels()) + { + if (model.seq == jds) + { + /* + * VARNA saves each view (sequence or alignment secondary + * structure, gapped or trimmed) as a separate XML file + */ + String jarEntryName = rnaSessions.get(model); + if (jarEntryName == null) + { + + String varnaStateFile = varna.getStateInfo(model.rna); + jarEntryName = RNA_PREFIX + viewId + "_" + + nextCounter(); + copyFileToJar(jout, varnaStateFile, jarEntryName); + rnaSessions.put(model, jarEntryName); + } + SecondaryStructure ss = new SecondaryStructure(); + String annotationId = varna.getAnnotation(jds).annotationId; + ss.setAnnotationId(annotationId); + ss.setViewerState(jarEntryName); + ss.setGapped(model.gapped); + ss.setTitle(model.title); + rna.addSecondaryStructure(ss); + } + } + } + } + } + } + + /** + * Copy the contents of a file to a new entry added to the output jar * * @param jout * @param infilePath - * @param jarfileName + * @param jarEntryName */ protected void copyFileToJar(JarOutputStream jout, String infilePath, - String jarfileName) + String jarEntryName) { DataInputStream dis = null; try @@ -1346,7 +1455,7 @@ public class Jalview2XML dis = new DataInputStream(new FileInputStream(file)); byte[] data = new byte[(int) file.length()]; dis.readFully(data); - writeJarEntry(jout, jarfileName, data); + writeJarEntry(jout, jarEntryName, data); } } catch (Exception ex) { @@ -1370,16 +1479,17 @@ public class Jalview2XML * Write the data to a new entry of given name in the output jar file * * @param jout - * @param jarfileName + * @param jarEntryName * @param data * @throws IOException */ - protected void writeJarEntry(JarOutputStream jout, String jarfileName, + protected void writeJarEntry(JarOutputStream jout, String jarEntryName, byte[] data) throws IOException { if (jout != null) { - jout.putNextEntry(new JarEntry(jarfileName)); + System.out.println("Writing jar entry " + jarEntryName); + jout.putNextEntry(new JarEntry(jarEntryName)); DataOutputStream dout = new DataOutputStream(jout); dout.write(data, 0, data.length); dout.flush(); @@ -1490,7 +1600,8 @@ public class Jalview2XML } private void storeAlignmentAnnotation(AlignmentAnnotation[] aa, - IdentityHashMap groupRefs, AlignmentViewport av, + IdentityHashMap groupRefs, + AlignmentViewport av, Set calcIdSet, boolean storeDS, SequenceSet vamsasSet) { @@ -1498,53 +1609,54 @@ public class Jalview2XML { Annotation an = new Annotation(); - if (aa[i].annotationId != null) + AlignmentAnnotation annotation = aa[i]; + if (annotation.annotationId != null) { - annotationIds.put(aa[i].annotationId, aa[i]); + annotationIds.put(annotation.annotationId, annotation); } - an.setId(aa[i].annotationId); + an.setId(annotation.annotationId); - an.setVisible(aa[i].visible); + an.setVisible(annotation.visible); - an.setDescription(aa[i].description); + an.setDescription(annotation.description); - if (aa[i].sequenceRef != null) + if (annotation.sequenceRef != null) { // 2.9 JAL-1781 xref on sequence id rather than name - an.setSequenceRef(seqsToIds.get(aa[i].sequenceRef)); + an.setSequenceRef(seqsToIds.get(annotation.sequenceRef)); } - if (aa[i].groupRef != null) + if (annotation.groupRef != null) { - Object groupIdr = groupRefs.get(aa[i].groupRef); + String groupIdr = groupRefs.get(annotation.groupRef); if (groupIdr == null) { // make a locally unique String - groupRefs.put(aa[i].groupRef, + groupRefs.put(annotation.groupRef, groupIdr = ("" + System.currentTimeMillis() - + aa[i].groupRef.getName() + groupRefs.size())); + + annotation.groupRef.getName() + groupRefs.size())); } an.setGroupRef(groupIdr.toString()); } // store all visualization attributes for annotation - an.setGraphHeight(aa[i].graphHeight); - an.setCentreColLabels(aa[i].centreColLabels); - an.setScaleColLabels(aa[i].scaleColLabel); - an.setShowAllColLabels(aa[i].showAllColLabels); - an.setBelowAlignment(aa[i].belowAlignment); + an.setGraphHeight(annotation.graphHeight); + an.setCentreColLabels(annotation.centreColLabels); + an.setScaleColLabels(annotation.scaleColLabel); + an.setShowAllColLabels(annotation.showAllColLabels); + an.setBelowAlignment(annotation.belowAlignment); - if (aa[i].graph > 0) + if (annotation.graph > 0) { an.setGraph(true); - an.setGraphType(aa[i].graph); - an.setGraphGroup(aa[i].graphGroup); - if (aa[i].getThreshold() != null) + an.setGraphType(annotation.graph); + an.setGraphGroup(annotation.graphGroup); + if (annotation.getThreshold() != null) { ThresholdLine line = new ThresholdLine(); - line.setLabel(aa[i].getThreshold().label); - line.setValue(aa[i].getThreshold().value); - line.setColour(aa[i].getThreshold().colour.getRGB()); + line.setLabel(annotation.getThreshold().label); + line.setValue(annotation.getThreshold().value); + line.setColour(annotation.getThreshold().colour.getRGB()); an.setThresholdLine(line); } } @@ -1553,78 +1665,78 @@ public class Jalview2XML an.setGraph(false); } - an.setLabel(aa[i].label); + an.setLabel(annotation.label); - if (aa[i] == av.getAlignmentQualityAnnot() - || aa[i] == av.getAlignmentConservationAnnotation() - || aa[i] == av.getAlignmentConsensusAnnotation() - || aa[i].autoCalculated) + if (annotation == av.getAlignmentQualityAnnot() + || annotation == av.getAlignmentConservationAnnotation() + || annotation == av.getAlignmentConsensusAnnotation() + || annotation.autoCalculated) { // new way of indicating autocalculated annotation - - an.setAutoCalculated(aa[i].autoCalculated); + an.setAutoCalculated(annotation.autoCalculated); } - if (aa[i].hasScore()) + if (annotation.hasScore()) { - an.setScore(aa[i].getScore()); + an.setScore(annotation.getScore()); } - if (aa[i].getCalcId() != null) + if (annotation.getCalcId() != null) { - calcIdSet.add(aa[i].getCalcId()); - an.setCalcId(aa[i].getCalcId()); + calcIdSet.add(annotation.getCalcId()); + an.setCalcId(annotation.getCalcId()); } - if (aa[i].hasProperties()) + if (annotation.hasProperties()) { - for (String pr : aa[i].getProperties()) + for (String pr : annotation.getProperties()) { Property prop = new Property(); prop.setName(pr); - prop.setValue(aa[i].getProperty(pr)); + prop.setValue(annotation.getProperty(pr)); an.addProperty(prop); } } AnnotationElement ae; - if (aa[i].annotations != null) + if (annotation.annotations != null) { an.setScoreOnly(false); - for (int a = 0; a < aa[i].annotations.length; a++) + for (int a = 0; a < annotation.annotations.length; a++) { - if ((aa[i] == null) || (aa[i].annotations[a] == null)) + if ((annotation == null) || (annotation.annotations[a] == null)) { continue; } ae = new AnnotationElement(); - if (aa[i].annotations[a].description != null) + if (annotation.annotations[a].description != null) { - ae.setDescription(aa[i].annotations[a].description); + ae.setDescription(annotation.annotations[a].description); } - if (aa[i].annotations[a].displayCharacter != null) + if (annotation.annotations[a].displayCharacter != null) { - ae.setDisplayCharacter(aa[i].annotations[a].displayCharacter); + ae.setDisplayCharacter(annotation.annotations[a].displayCharacter); } - if (!Float.isNaN(aa[i].annotations[a].value)) + if (!Float.isNaN(annotation.annotations[a].value)) { - ae.setValue(aa[i].annotations[a].value); + ae.setValue(annotation.annotations[a].value); } ae.setPosition(a); - if (aa[i].annotations[a].secondaryStructure > ' ') + if (annotation.annotations[a].secondaryStructure > ' ') { - ae.setSecondaryStructure(aa[i].annotations[a].secondaryStructure + ae.setSecondaryStructure(annotation.annotations[a].secondaryStructure + ""); } - if (aa[i].annotations[a].colour != null - && aa[i].annotations[a].colour != java.awt.Color.black) + if (annotation.annotations[a].colour != null + && annotation.annotations[a].colour != java.awt.Color.black) { - ae.setColour(aa[i].annotations[a].colour.getRGB()); + ae.setColour(annotation.annotations[a].colour.getRGB()); } an.addAnnotationElement(ae); - if (aa[i].autoCalculated) + if (annotation.autoCalculated) { // only write one non-null entry into the annotation row - // sufficient to get the visualization attributes necessary to @@ -1637,7 +1749,7 @@ public class Jalview2XML { an.setScoreOnly(true); } - if (!storeDS || (storeDS && !aa[i].autoCalculated)) + if (!storeDS || (storeDS && !annotation.autoCalculated)) { // skip autocalculated annotation - these are only provided for // alignments @@ -2173,13 +2285,7 @@ public class Jalview2XML } } while (jarentry != null); resolveFrefedSequences(); - } catch (java.io.FileNotFoundException ex) - { - ex.printStackTrace(); - errorMessage = "Couldn't locate Jalview XML file : " + file; - System.err.println("Exception whilst loading jalview XML file : " - + ex + "\n"); - } catch (java.net.UnknownHostException ex) + } catch (IOException ex) { ex.printStackTrace(); errorMessage = "Couldn't locate Jalview XML file : " + file; @@ -2739,10 +2845,11 @@ public class Jalview2XML // //////////////////////////////// // LOAD ANNOTATIONS List autoAlan = new ArrayList(); - /** + + /* * store any annotations which forward reference a group's ID */ - Hashtable> groupAnnotRefs = new Hashtable>(); + Map> groupAnnotRefs = new Hashtable>(); if (vamsasSet.getAnnotationCount() > 0) { @@ -2750,39 +2857,43 @@ public class Jalview2XML for (int i = 0; i < an.length; i++) { + Annotation annotation = an[i]; + /** * test if annotation is automatically calculated for this view only */ boolean autoForView = false; - if (an[i].getLabel().equals("Quality") - || an[i].getLabel().equals("Conservation") - || an[i].getLabel().equals("Consensus")) + if (annotation.getLabel().equals("Quality") + || annotation.getLabel().equals("Conservation") + || annotation.getLabel().equals("Consensus")) { // Kludge for pre 2.5 projects which lacked the autocalculated flag autoForView = true; - if (!an[i].hasAutoCalculated()) + if (!annotation.hasAutoCalculated()) { - an[i].setAutoCalculated(true); + annotation.setAutoCalculated(true); } } if (autoForView - || (an[i].hasAutoCalculated() && an[i].isAutoCalculated())) + || (annotation.hasAutoCalculated() && annotation + .isAutoCalculated())) { // remove ID - we don't recover annotation from other views for // view-specific annotation - an[i].setId(null); + annotation.setId(null); } // set visiblity for other annotation in this view - if (an[i].getId() != null - && annotationIds.containsKey(an[i].getId())) + String annotationId = annotation.getId(); + if (annotationId != null + && annotationIds.containsKey(annotationId)) { - AlignmentAnnotation jda = annotationIds.get(an[i].getId()); + AlignmentAnnotation jda = annotationIds.get(annotationId); // in principle Visible should always be true for annotation displayed // in multiple views - if (an[i].hasVisible()) + if (annotation.hasVisible()) { - jda.visible = an[i].getVisible(); + jda.visible = annotation.getVisible(); } al.addAnnotation(jda); @@ -2790,11 +2901,11 @@ public class Jalview2XML continue; } // Construct new annotation from model. - AnnotationElement[] ae = an[i].getAnnotationElement(); + AnnotationElement[] ae = annotation.getAnnotationElement(); jalview.datamodel.Annotation[] anot = null; java.awt.Color firstColour = null; int anpos; - if (!an[i].getScoreOnly()) + if (!annotation.getScoreOnly()) { anot = new jalview.datamodel.Annotation[al.getWidth()]; for (int aa = 0; aa < ae.length && aa < anot.length; aa++) @@ -2831,27 +2942,27 @@ public class Jalview2XML } jalview.datamodel.AlignmentAnnotation jaa = null; - if (an[i].getGraph()) + if (annotation.getGraph()) { float llim = 0, hlim = 0; // if (autoForView || an[i].isAutoCalculated()) { // hlim=11f; // } - jaa = new jalview.datamodel.AlignmentAnnotation(an[i].getLabel(), - an[i].getDescription(), anot, llim, hlim, - an[i].getGraphType()); + jaa = new jalview.datamodel.AlignmentAnnotation( + annotation.getLabel(), annotation.getDescription(), anot, + llim, hlim, annotation.getGraphType()); - jaa.graphGroup = an[i].getGraphGroup(); + jaa.graphGroup = annotation.getGraphGroup(); jaa._linecolour = firstColour; - if (an[i].getThresholdLine() != null) + if (annotation.getThresholdLine() != null) { - jaa.setThreshold(new jalview.datamodel.GraphLine(an[i] - .getThresholdLine().getValue(), an[i] + jaa.setThreshold(new jalview.datamodel.GraphLine(annotation + .getThresholdLine().getValue(), annotation .getThresholdLine().getLabel(), new java.awt.Color( - an[i].getThresholdLine().getColour()))); + annotation.getThresholdLine().getColour()))); } - if (autoForView || an[i].isAutoCalculated()) + if (autoForView || annotation.isAutoCalculated()) { // Hardwire the symbol display line to ensure that labels for // histograms are displayed @@ -2890,7 +3001,7 @@ public class Jalview2XML // and make a note of any group association if (an[i].getGroupRef() != null && an[i].getGroupRef().length() > 0) { - ArrayList aal = groupAnnotRefs + List aal = groupAnnotRefs .get(an[i].getGroupRef()); if (aal == null) { @@ -2964,37 +3075,37 @@ public class Jalview2XML boolean addAnnotSchemeGroup = false; for (int i = 0; i < groups.length; i++) { + JGroup jGroup = groups[i]; ColourSchemeI cs = null; - - if (groups[i].getColour() != null) + if (jGroup.getColour() != null) { - if (groups[i].getColour().startsWith("ucs")) + if (jGroup.getColour().startsWith("ucs")) { - cs = getUserColourScheme(jms, groups[i].getColour()); + cs = getUserColourScheme(jms, jGroup.getColour()); } - else if (groups[i].getColour().equals("AnnotationColourGradient") - && groups[i].getAnnotationColours() != null) + else if (jGroup.getColour().equals("AnnotationColourGradient") + && jGroup.getAnnotationColours() != null) { addAnnotSchemeGroup = true; cs = null; } else { - cs = ColourSchemeProperty.getColour(al, groups[i].getColour()); + cs = ColourSchemeProperty.getColour(al, jGroup.getColour()); } if (cs != null) { - cs.setThreshold(groups[i].getPidThreshold(), true); + cs.setThreshold(jGroup.getPidThreshold(), true); } } - Vector seqs = new Vector(); + Vector seqs = new Vector(); - for (int s = 0; s < groups[i].getSeqCount(); s++) + for (int s = 0; s < jGroup.getSeqCount(); s++) { - String seqId = groups[i].getSeq(s) + ""; - jalview.datamodel.SequenceI ts = seqRefIds.get(seqId); + String seqId = jGroup.getSeq(s) + ""; + SequenceI ts = seqRefIds.get(seqId); if (ts != null) { @@ -3007,36 +3118,36 @@ public class Jalview2XML continue; } - jalview.datamodel.SequenceGroup sg = new jalview.datamodel.SequenceGroup( - seqs, groups[i].getName(), cs, groups[i].getDisplayBoxes(), - groups[i].getDisplayText(), groups[i].getColourText(), - groups[i].getStart(), groups[i].getEnd()); + SequenceGroup sg = new SequenceGroup(seqs, jGroup.getName(), cs, + jGroup.getDisplayBoxes(), jGroup.getDisplayText(), + jGroup.getColourText(), jGroup.getStart(), + jGroup.getEnd()); - sg.setOutlineColour(new java.awt.Color(groups[i].getOutlineColour())); + sg.setOutlineColour(new java.awt.Color(jGroup.getOutlineColour())); - sg.textColour = new java.awt.Color(groups[i].getTextCol1()); - sg.textColour2 = new java.awt.Color(groups[i].getTextCol2()); - sg.setShowNonconserved(groups[i].hasShowUnconserved() ? groups[i] + sg.textColour = new java.awt.Color(jGroup.getTextCol1()); + sg.textColour2 = new java.awt.Color(jGroup.getTextCol2()); + sg.setShowNonconserved(jGroup.hasShowUnconserved() ? jGroup .isShowUnconserved() : false); - sg.thresholdTextColour = groups[i].getTextColThreshold(); - if (groups[i].hasShowConsensusHistogram()) + sg.thresholdTextColour = jGroup.getTextColThreshold(); + if (jGroup.hasShowConsensusHistogram()) { - sg.setShowConsensusHistogram(groups[i].isShowConsensusHistogram()); + sg.setShowConsensusHistogram(jGroup.isShowConsensusHistogram()); } ; - if (groups[i].hasShowSequenceLogo()) + if (jGroup.hasShowSequenceLogo()) { - sg.setshowSequenceLogo(groups[i].isShowSequenceLogo()); + sg.setshowSequenceLogo(jGroup.isShowSequenceLogo()); } - if (groups[i].hasNormaliseSequenceLogo()) + if (jGroup.hasNormaliseSequenceLogo()) { - sg.setNormaliseSequenceLogo(groups[i].isNormaliseSequenceLogo()); + sg.setNormaliseSequenceLogo(jGroup.isNormaliseSequenceLogo()); } - if (groups[i].hasIgnoreGapsinConsensus()) + if (jGroup.hasIgnoreGapsinConsensus()) { - sg.setIgnoreGapsConsensus(groups[i].getIgnoreGapsinConsensus()); + sg.setIgnoreGapsConsensus(jGroup.getIgnoreGapsinConsensus()); } - if (groups[i].getConsThreshold() != 0) + if (jGroup.getConsThreshold() != 0) { jalview.analysis.Conservation c = new jalview.analysis.Conservation( "All", ResidueProperties.propHash, 3, @@ -3046,14 +3157,14 @@ public class Jalview2XML sg.cs.setConservation(c); } - if (groups[i].getId() != null && groupAnnotRefs.size() > 0) + if (jGroup.getId() != null && groupAnnotRefs.size() > 0) { // re-instate unique group/annotation row reference - ArrayList jaal = groupAnnotRefs - .get(groups[i].getId()); + List jaal = groupAnnotRefs + .get(jGroup.getId()); if (jaal != null) { - for (jalview.datamodel.AlignmentAnnotation jaa : jaal) + for (AlignmentAnnotation jaa : jaal) { jaa.groupRef = sg; if (jaa.autoCalculated) @@ -3079,7 +3190,7 @@ public class Jalview2XML { // reconstruct the annotation colourscheme sg.cs = constructAnnotationColour( - groups[i].getAnnotationColours(), null, al, jms, false); + jGroup.getAnnotationColours(), null, al, jms, false); } } } @@ -3170,90 +3281,203 @@ public class Jalview2XML av = af.viewport; ap = af.alignPanel; } - // LOAD TREES - // ///////////////////////////////////// - if (loadTreesAndStructures && jms.getTreeCount() > 0) + + /* + * Load any trees, PDB structures and viewers + * + * Not done if flag is false (when this method is used for New View) + */ + if (loadTreesAndStructures) { - try + loadTrees(jms, view, af, av, ap); + loadPDBStructures(jprovider, jseqs, af, ap); + loadRnaViewers(jprovider, jseqs, ap); + } + // and finally return. + return af; + } + + /** + * Instantiate and link any saved RNA (Varna) viewers. The state of the Varna + * panel is restored from separate jar entries, two (gapped and trimmed) per + * sequence and secondary structure. + * + * Currently each viewer shows just one sequence and structure (gapped and + * trimmed), however this method is designed to support multiple sequences or + * structures in viewers if wanted in future. + * + * @param jprovider + * @param jseqs + * @param ap + */ + private void loadRnaViewers(jarInputStreamProvider jprovider, + JSeq[] jseqs, AlignmentPanel ap) + { + /* + * scan the sequences for references to viewers; create each one the first + * time it is referenced, add Rna models to existing viewers + */ + for (JSeq jseq : jseqs) + { + for (int i = 0; i < jseq.getRnaViewerCount(); i++) { - for (int t = 0; t < jms.getTreeCount(); t++) + RnaViewer viewer = jseq.getRnaViewer(i); + AppVarna appVarna = findOrCreateVarnaViewer(viewer, uniqueSetSuffix, + ap); + + for (int j = 0; j < viewer.getSecondaryStructureCount(); j++) { + SecondaryStructure ss = viewer.getSecondaryStructure(j); + SequenceI seq = seqRefIds.get(jseq.getId()); + AlignmentAnnotation ann = this.annotationIds.get(ss + .getAnnotationId()); - Tree tree = jms.getTree(t); + /* + * add the structure to the Varna display (with session state copied + * from the jar to a temporary file) + */ + boolean gapped = ss.isGapped(); + String rnaTitle = ss.getTitle(); + String sessionState = ss.getViewerState(); + String tempStateFile = copyJarEntry(jprovider, sessionState, + "varna"); + RnaModel rna = new RnaModel(rnaTitle, ann, seq, null, gapped, + tempStateFile); + appVarna.addModel(rna, rnaTitle); + } + appVarna.setSelectedIndex(viewer.getSelectedRna()); + } + } + } - TreePanel tp = (TreePanel) retrieveExistingObj(tree.getId()); - if (tp == null) - { - tp = af.ShowNewickTree( - new jalview.io.NewickFile(tree.getNewick()), - tree.getTitle(), tree.getWidth(), tree.getHeight(), - tree.getXpos(), tree.getYpos()); - if (tree.getId() != null) - { - // perhaps bind the tree id to something ? - } - } - else - { - // update local tree attributes ? - // TODO: should check if tp has been manipulated by user - if so its - // settings shouldn't be modified - tp.setTitle(tree.getTitle()); - tp.setBounds(new Rectangle(tree.getXpos(), tree.getYpos(), tree - .getWidth(), tree.getHeight())); - tp.av = av; // af.viewport; // TODO: verify 'associate with all - // views' - // works still - tp.treeCanvas.av = av; // af.viewport; - tp.treeCanvas.ap = ap; // af.alignPanel; + /** + * Locate and return an already instantiated matching AppVarna, or create one + * if not found + * + * @param viewer + * @param viewIdSuffix + * @param ap + * @return + */ + protected AppVarna findOrCreateVarnaViewer(RnaViewer viewer, + String viewIdSuffix, AlignmentPanel ap) + { + /* + * on each load a suffix is appended to the saved viewId, to avoid conflicts + * if load is repeated + */ + String postLoadId = viewer.getViewId() + viewIdSuffix; + for (JInternalFrame frame : getAllFrames()) + { + if (frame instanceof AppVarna) + { + AppVarna varna = (AppVarna) frame; + if (postLoadId.equals(varna.getViewId())) + { + // this viewer is already instantiated + // could in future here add ap as another 'parent' of the + // AppVarna window; currently just 1-to-many + return varna; + } + } + } - } - if (tp == null) - { - warn("There was a problem recovering stored Newick tree: \n" - + tree.getNewick()); - continue; - } + /* + * viewer not found - make it + */ + RnaViewerModel model = new RnaViewerModel(postLoadId, + viewer.getTitle(), viewer.getXpos(), + viewer.getYpos(), viewer.getWidth(), viewer.getHeight(), + viewer.getDividerLocation()); + AppVarna varna = new AppVarna(model, ap); - tp.fitToWindow.setState(tree.getFitToWindow()); - tp.fitToWindow_actionPerformed(null); + return varna; + } - if (tree.getFontName() != null) - { - tp.setTreeFont(new java.awt.Font(tree.getFontName(), tree - .getFontStyle(), tree.getFontSize())); - } - else + /** + * Load any saved trees + * + * @param jms + * @param view + * @param af + * @param av + * @param ap + */ + protected void loadTrees(JalviewModelSequence jms, Viewport view, + AlignFrame af, AlignViewport av, AlignmentPanel ap) + { + // TODO result of automated refactoring - are all these parameters needed? + try + { + for (int t = 0; t < jms.getTreeCount(); t++) + { + + Tree tree = jms.getTree(t); + + TreePanel tp = (TreePanel) retrieveExistingObj(tree.getId()); + if (tp == null) + { + tp = af.ShowNewickTree( + new jalview.io.NewickFile(tree.getNewick()), + tree.getTitle(), tree.getWidth(), tree.getHeight(), + tree.getXpos(), tree.getYpos()); + if (tree.getId() != null) { - tp.setTreeFont(new java.awt.Font(view.getFontName(), view - .getFontStyle(), tree.getFontSize())); + // perhaps bind the tree id to something ? } + } + else + { + // update local tree attributes ? + // TODO: should check if tp has been manipulated by user - if so its + // settings shouldn't be modified + tp.setTitle(tree.getTitle()); + tp.setBounds(new Rectangle(tree.getXpos(), tree.getYpos(), tree + .getWidth(), tree.getHeight())); + tp.av = av; // af.viewport; // TODO: verify 'associate with all + // views' + // works still + tp.treeCanvas.av = av; // af.viewport; + tp.treeCanvas.ap = ap; // af.alignPanel; - tp.showPlaceholders(tree.getMarkUnlinked()); - tp.showBootstrap(tree.getShowBootstrap()); - tp.showDistances(tree.getShowDistances()); + } + if (tp == null) + { + warn("There was a problem recovering stored Newick tree: \n" + + tree.getNewick()); + continue; + } - tp.treeCanvas.threshold = tree.getThreshold(); + tp.fitToWindow.setState(tree.getFitToWindow()); + tp.fitToWindow_actionPerformed(null); - if (tree.getCurrentTree()) - { - af.viewport.setCurrentTree(tp.getTree()); - } + if (tree.getFontName() != null) + { + tp.setTreeFont(new java.awt.Font(tree.getFontName(), tree + .getFontStyle(), tree.getFontSize())); + } + else + { + tp.setTreeFont(new java.awt.Font(view.getFontName(), view + .getFontStyle(), tree.getFontSize())); } - } catch (Exception ex) - { - ex.printStackTrace(); + tp.showPlaceholders(tree.getMarkUnlinked()); + tp.showBootstrap(tree.getShowBootstrap()); + tp.showDistances(tree.getShowDistances()); + + tp.treeCanvas.threshold = tree.getThreshold(); + + if (tree.getCurrentTree()) + { + af.viewport.setCurrentTree(tp.getTree()); + } } - } - // //LOAD STRUCTURES - if (loadTreesAndStructures) + } catch (Exception ex) { - loadStructures(jprovider, jseqs, af, ap); + ex.printStackTrace(); } - // and finally return. - return af; } /** @@ -3264,7 +3488,7 @@ public class Jalview2XML * @param af * @param ap */ - protected void loadStructures(jarInputStreamProvider jprovider, + protected void loadPDBStructures(jarInputStreamProvider jprovider, JSeq[] jseqs, AlignFrame af, AlignmentPanel ap) { /* @@ -3458,11 +3682,12 @@ public class Jalview2XML /* * Copy Chimera session from jar entry "viewer_"+viewId to a temporary file * - * Note this is the 'saved' viewId as in the project file XML, _not_ the + * NB this is the 'saved' viewId as in the project file XML, _not_ the * 'uniquified' sviewid used to reconstruct the viewer here */ - chimeraSessionFile = copyJarEntry(jprovider, - getViewerJarEntryName(data.getViewId()), "chimera"); + String viewerJarEntryName = getViewerJarEntryName(data.getViewId()); + chimeraSessionFile = copyJarEntry(jprovider, viewerJarEntryName, + "chimera"); Set> fileData = data.getFileData() .entrySet(); @@ -3487,6 +3712,7 @@ public class Jalview2XML final SequenceI[][] seqsArray = allseqs.toArray(new SequenceI[allseqs .size()][]); String newViewId = viewerData.getKey(); + ChimeraViewFrame cvf = new ChimeraViewFrame(chimeraSessionFile, af.alignPanel, pdbArray, seqsArray, colourByChimera, colourBySequence, newViewId); @@ -3659,7 +3885,7 @@ public class Jalview2XML */ protected String getViewerJarEntryName(String viewId) { - return "viewer_" + viewId; + return VIEWER_PREFIX + viewId; } /** @@ -3800,7 +4026,8 @@ public class Jalview2XML * @return true if version is development/null or evaluates to the same or * later X.Y.Z (where X,Y,Z are like [0-9]+b?[0-9]*) */ - private boolean isVersionStringLaterThan(String supported, String version) + protected boolean isVersionStringLaterThan(String supported, + String version) { if (version == null || version.equalsIgnoreCase("DEVELOPMENT BUILD") || version.equalsIgnoreCase("Test") @@ -4636,20 +4863,24 @@ public class Jalview2XML } } - java.util.Hashtable datasetIds = null; + /* + * TODO use AlignmentI here and in related methods - needs + * AlignmentI.getDataset() changed to return AlignmentI instead of Alignment + */ + Hashtable datasetIds = null; - java.util.IdentityHashMap dataset2Ids = null; + IdentityHashMap dataset2Ids = null; private Alignment getDatasetFor(String datasetId) { if (datasetIds == null) { - datasetIds = new Hashtable(); + datasetIds = new Hashtable(); return null; } if (datasetIds.containsKey(datasetId)) { - return (Alignment) datasetIds.get(datasetId); + return datasetIds.get(datasetId); } return null; } @@ -4658,7 +4889,7 @@ public class Jalview2XML { if (datasetIds == null) { - datasetIds = new Hashtable(); + datasetIds = new Hashtable(); } datasetIds.put(datasetId, dataset); } @@ -4669,7 +4900,7 @@ public class Jalview2XML * @param dataset * @return */ - private String getDatasetIdRef(jalview.datamodel.Alignment dataset) + private String getDatasetIdRef(Alignment dataset) { if (dataset.getDataset() != null) { @@ -4681,11 +4912,11 @@ public class Jalview2XML // make a new datasetId and record it if (dataset2Ids == null) { - dataset2Ids = new IdentityHashMap(); + dataset2Ids = new IdentityHashMap(); } else { - datasetId = (String) dataset2Ids.get(dataset); + datasetId = dataset2Ids.get(dataset); } if (datasetId == null) { @@ -4804,8 +5035,7 @@ public class Jalview2XML boolean keepSeqRefs) { initSeqRefs(); - jalview.schemabinding.version2.JalviewModel jm = saveState(ap, null, - null); + JalviewModel jm = saveState(ap, null, null, null); if (!keepSeqRefs) { @@ -5088,4 +5318,14 @@ public class Jalview2XML return result; } + + /** + * Returns an incrementing counter (0, 1, 2...) + * + * @return + */ + private synchronized int nextCounter() + { + return counter++; + } } diff --git a/src/jalview/gui/PopupMenu.java b/src/jalview/gui/PopupMenu.java index 0d28a70..2ba4427 100644 --- a/src/jalview/gui/PopupMenu.java +++ b/src/jalview/gui/PopupMenu.java @@ -20,6 +20,27 @@ */ package jalview.gui; +import java.awt.Color; +import java.awt.event.ActionEvent; +import java.awt.event.ActionListener; +import java.util.Arrays; +import java.util.Collections; +import java.util.Hashtable; +import java.util.LinkedHashMap; +import java.util.List; +import java.util.Map; +import java.util.TreeMap; +import java.util.Vector; + +import javax.swing.ButtonGroup; +import javax.swing.JCheckBoxMenuItem; +import javax.swing.JColorChooser; +import javax.swing.JMenu; +import javax.swing.JMenuItem; +import javax.swing.JOptionPane; +import javax.swing.JPopupMenu; +import javax.swing.JRadioButtonMenuItem; + import jalview.analysis.AAFrequency; import jalview.analysis.AlignmentAnnotationUtils; import jalview.analysis.AlignmentUtils; @@ -59,27 +80,6 @@ import jalview.util.GroupUrlLink.UrlStringTooLongException; import jalview.util.MessageManager; import jalview.util.UrlLink; -import java.awt.Color; -import java.awt.event.ActionEvent; -import java.awt.event.ActionListener; -import java.util.Arrays; -import java.util.Collections; -import java.util.Hashtable; -import java.util.LinkedHashMap; -import java.util.List; -import java.util.Map; -import java.util.TreeMap; -import java.util.Vector; - -import javax.swing.ButtonGroup; -import javax.swing.JCheckBoxMenuItem; -import javax.swing.JColorChooser; -import javax.swing.JMenu; -import javax.swing.JMenuItem; -import javax.swing.JOptionPane; -import javax.swing.JPopupMenu; -import javax.swing.JRadioButtonMenuItem; - /** * DOCUMENT ME! * @@ -322,49 +322,56 @@ public class PopupMenu extends JPopupMenu makeReferenceSeq.setText("Mark as representative"); } - if (ap.av.getAlignment().isNucleotide() == false) + if (!ap.av.getAlignment().isNucleotide()) { remove(rnaStructureMenu); } - - if (ap.av.getAlignment().isNucleotide() == true) + else { - AlignmentAnnotation[] aa = ap.av.getAlignment() + /* + * add menu items to 2D-render any alignment or sequence secondary + * structure annotation + */ + AlignmentAnnotation[] aas = ap.av.getAlignment() .getAlignmentAnnotation(); - for (int i = 0; aa != null && i < aa.length; i++) + if (aas != null) { - if (aa[i].isValidStruc() && aa[i].sequenceRef == null) + for (final AlignmentAnnotation aa : aas) { - final String rnastruc = aa[i].getRNAStruc(); - final String structureLine = aa[i].label + " (alignment)"; - menuItem = new JMenuItem(); - menuItem.setText(MessageManager.formatMessage( - "label.2d_rna_structure_line", new Object[] - { structureLine })); - menuItem.addActionListener(new java.awt.event.ActionListener() + if (aa.isValidStruc() && aa.sequenceRef == null) { - @Override - public void actionPerformed(ActionEvent e) + /* + * valid alignment RNA secondary structure annotation + */ + final String structureLine = aa.label + " (alignment)"; + menuItem = new JMenuItem(); + menuItem.setText(MessageManager.formatMessage( + "label.2d_rna_structure_line", new Object[] + { structureLine })); + menuItem.addActionListener(new java.awt.event.ActionListener() { - new AppVarna(structureLine, seq, seq.getSequenceAsString(), - rnastruc, seq.getName(), ap); - System.out.println("end"); - } - }); - rnaStructureMenu.add(menuItem); + @Override + public void actionPerformed(ActionEvent e) + { + new AppVarna(structureLine, seq, aa, ap); + } + }); + rnaStructureMenu.add(menuItem); + } } } if (seq.getAnnotation() != null) { - AlignmentAnnotation seqAnno[] = seq.getAnnotation(); - for (int i = 0; i < seqAnno.length; i++) + AlignmentAnnotation seqAnns[] = seq.getAnnotation(); + for (final AlignmentAnnotation aa : seqAnns) { - if (seqAnno[i].isValidStruc()) + if (aa.isValidStruc()) { - final String rnastruc = seqAnno[i].getRNAStruc(); - + /* + * valid sequence RNA secondary structure annotation + */ // TODO: make rnastrucF a bit more nice menuItem = new JMenuItem(); menuItem.setText(MessageManager.formatMessage( @@ -377,8 +384,7 @@ public class PopupMenu extends JPopupMenu { // TODO: VARNA does'nt print gaps in the sequence - new AppVarna(seq.getName() + " structure", seq, seq - .getSequenceAsString(), rnastruc, seq.getName(), + new AppVarna(seq.getName() + " structure", seq, aa, ap); } });