From: hansonr <hansonr@STO24954W.ad.stolaf.edu>
Date: Thu, 16 May 2019 01:17:42 +0000 (-0500)
Subject: Jalview-JS/JAL-3253, JAL-3266 Varna preliminary upgrade
X-Git-Url: http://source.jalview.org/gitweb/?a=commitdiff_plain;h=9be873b0493ec554c64e6ece3d7d659bc223d127;p=jalview.git

Jalview-JS/JAL-3253, JAL-3266 Varna preliminary upgrade
---

diff --git a/libjs/VARNA-site.zip b/libjs/VARNA-site.zip
index 9ff173e..b8d60d6 100644
Binary files a/libjs/VARNA-site.zip and b/libjs/VARNA-site.zip differ
diff --git a/srcjar/fr/README_SWINGJS.txt b/srcjar/fr/README_SWINGJS.txt
new file mode 100644
index 0000000..95b1753
--- /dev/null
+++ b/srcjar/fr/README_SWINGJS.txt
@@ -0,0 +1,3 @@
+BH 2019.05.15
+
+Note that this version of VARNA is from VARNA-BH
diff --git a/srcjar/fr/orsay/lri/varna/VARNAPanel.java b/srcjar/fr/orsay/lri/varna/VARNAPanel.java
index e60ceb2..2a88044 100644
--- a/srcjar/fr/orsay/lri/varna/VARNAPanel.java
+++ b/srcjar/fr/orsay/lri/varna/VARNAPanel.java
@@ -735,10 +735,14 @@ import fr.orsay.lri.varna.views.VueUI;
 
 /**
  * 
- * BH j2s SwingJS Added PropertyChangeListener for returns from VueUI.  
+ * BH (early) j2s SwingJS Added PropertyChangeListener for returns from VueUI.
+ * 
+ * BH 2019.05.15 flashes white background solution: replaced during-paint
+ * setBackground() with g.setColor();g.fill();
+ * 
+ * BH 2019.05.15 initialization shows popup menu raw creation objects solution:
+ * moved menu creation out of paintComponent()
  * 
- *  
- *  
  * 
  * The RNA 2D Panel is a lightweight component that allows for an automatic
  * basic drawing of an RNA secondary structures. The drawing algorithms do not
@@ -755,3774 +759,4325 @@ import fr.orsay.lri.varna.views.VueUI;
  * 
  */
 
-public class VARNAPanel extends JPanel implements PropertyChangeListener {
-	
-	/**
-	 * SwingJS uses a PropertyChangeEvent to signal that a pseudo-modal dialog has been closed.
-	 *   
-	 * @param event
-	 */
-	@Override
-	public void propertyChange(PropertyChangeEvent event) {
-		Object val = event.getNewValue();
-		switch (event.getPropertyName()) {
-		case "value":
-			_UI.onDialogReturn(val == null ? JOptionPane.CLOSED_OPTION : ((Integer) val).intValue());
-			return;
-		case "SelectedFile":
-		case "SelectedColor":
-		case "inputValue":
-			_UI.onDialogReturn(val);
-			break;
-		}
-	}
-
- 
-	
-	private static final long serialVersionUID = 8194421570308956001L;
-
-	private RNA _RNA = new RNA();
-
-	private boolean _debug = false;
-
-	private VARNAConfig _conf = new VARNAConfig();
-
-	private ArrayList<InterfaceVARNAListener> _VARNAListeners = new ArrayList<InterfaceVARNAListener>();
-	private ArrayList<InterfaceVARNASelectionListener> _selectionListeners = new ArrayList<InterfaceVARNASelectionListener>();
-	private ArrayList<InterfaceVARNARNAListener> _RNAListeners = new ArrayList<InterfaceVARNARNAListener>();
-	private ArrayList<InterfaceVARNABasesListener> _basesListeners = new ArrayList<InterfaceVARNABasesListener>();
-
-	UndoManager _manager;
-
-	// private boolean _foldMode = true;
-
-	private Point2D.Double[] _realCoords = new Point2D.Double[0];
-	private Point2D.Double[] _realCenters = new Point2D.Double[0];
-	private double _scaleFactor = 1.0;
-	private Point2D.Double _offsetPanel = new Point2D.Double();
-	private Point2D.Double _offsetRNA = new Point2D.Double();
-
-	private double _offX;
-	private double _offY;
-
-	private ControleurBlinkingThread _blink;
-	private BaseList _selectedBases = new BaseList("selection");
-	private ArrayList<ModeleBase> _backupSelection = new ArrayList<ModeleBase>();
-	private Integer _nearestBase = null;
-	private Point2D.Double _lastSelectedCoord = new Point2D.Double(0.0, 0.0);
-
-	private Point2D.Double _linkOrigin = null;
-	private Point2D.Double _linkDestination = null;
-
-	private Rectangle _selectionRectangle = null;
-
-	private boolean _highlightAnnotation = false;
-
-	private int _titleHeight;
-	private Dimension _border = new Dimension(0, 0);
-
-	private boolean _drawBBox = false;
-	private boolean _drawBorder = false;
-
-	// private Point _positionRelativeSouris;
-	private Point _translation;
-	private boolean _horsCadre;
-	private boolean _premierAffichage;
-
-	private ControleurInterpolator _interpolator;
-	/**
-	 * If comparison mode is TRUE (ON), then the application will be used to
-	 * display a super-structure resulting on an RNA secondary structure
-	 * comparison. Else, the application is used by default.
-	 */
-
-	private VueMenu _popup = new VueMenu(this);
-
-	private VueUI _UI = new VueUI(this);
-
-	private TextAnnotation _selectedAnnotation;
-
-	/**
-	 * Creates an RNA 2D panel with initially displays the empty structure.
-	 * 
-	 * @throws ExceptionNonEqualLength
-	 * 
-	 */
-	public VARNAPanel() {
-		init();
-		drawRNA();
-	}
-
-	/**
-	 * Creates an RNA 2D panel, and creates and displays an RNA coupled with its
-	 * secondary structure formatted as a well-balanced parenthesis with dots
-	 * word (DBN format).
-	 * 
-	 * @param seq
-	 *            The raw nucleotide sequence
-	 * @param str
-	 *            The secondary structure in DBN format
-	 * @throws ExceptionNonEqualLength
-	 */
-
-	public VARNAPanel(String seq, String str) throws ExceptionNonEqualLength {
-		this(seq, str, RNA.DRAW_MODE_RADIATE);
-	}
-
-	/**
-	 * Creates a VARNAPanel instance, and creates and displays an RNA coupled
-	 * with its secondary structure formatted as a well-balanced parenthesis
-	 * with dots word (DBN format). Allows the user to choose the drawing
-	 * algorithm to be used.
-	 * 
-	 * @param seq
-	 *            The raw nucleotide sequence
-	 * @param str
-	 *            The secondary structure in DBN format
-	 * @param drawMode
-	 *            The drawing mode
-	 * @throws ExceptionNonEqualLength
-	 * @see RNA#DRAW_MODE_RADIATE
-	 * @see RNA#DRAW_MODE_CIRCULAR
-	 * @see RNA#DRAW_MODE_NAVIEW
-	 */
-	public VARNAPanel(String seq, String str, int drawMode)
-			throws ExceptionNonEqualLength {
-		this(seq, str, drawMode, "");
-	}
-
-	public VARNAPanel(Reader r) throws ExceptionNonEqualLength,
-			ExceptionFileFormatOrSyntax {
-		this(r, RNA.DRAW_MODE_RADIATE);
-	}
-
-	public VARNAPanel(Reader r, int drawMode) throws ExceptionNonEqualLength,
-			ExceptionFileFormatOrSyntax {
-		this(r, drawMode, "");
-	}
-
-	public VARNAPanel(Reader r, int drawMode, String title)
-			throws ExceptionNonEqualLength, ExceptionFileFormatOrSyntax {
-		init();
-		drawRNA(r, drawMode);
-		setTitle(title);
-	}
-
-	public void setOriginLink(Point2D.Double p) {
-		_linkOrigin = (p);
-	}
-
-	public void setDestinationLink(Point2D.Double p) {
-		_linkDestination = (p);
-	}
-
-	public void removeLink() {
-		_linkOrigin = null;
-		_linkDestination = null;
-	}
-
-	/**
-	 * Creates a VARNAPanel instance, and displays an RNA.
-	 * 
-	 * @param r
-	 *            The RNA to be displayed within this panel
-	 */
-
-	public VARNAPanel(RNA r) {
-		showRNA(r);
-		init();
-	}
-
-	/**
-	 * Creates a VARNAPanel instance, and creates and displays an RNA coupled
-	 * with its secondary structure formatted as a well-balanced parenthesis
-	 * with dots word (DBN format). Allows the user to choose the drawing
-	 * algorithm to be used. Additionally, sets the panel's title.
-	 * 
-	 * @param seq
-	 *            The raw nucleotide sequence
-	 * @param str
-	 *            The secondary structure in DBN format
-	 * @param drawMode
-	 *            The drawing mode
-	 * @param title
-	 *            The panel title
-	 * @throws ExceptionNonEqualLength
-	 * @see RNA#DRAW_MODE_CIRCULAR
-	 * @see RNA#DRAW_MODE_RADIATE
-	 * @see RNA#DRAW_MODE_NAVIEW
-	 */
-
-	public VARNAPanel(String seq, String str, int drawMode, String title)
-			throws ExceptionNonEqualLength {
-		drawRNA(seq, str, drawMode);
-		init();
-		setTitle(title);
-		// VARNASecDraw._vp = this;
-	}
-
-	public VARNAPanel(String seq1, String struct1, String seq2, String struct2,
-			int drawMode, String title) {
-		_conf._comparisonMode = true;
-		drawRNA(seq1, struct1, seq2, struct2, drawMode);
-		init();
-		setTitle(title);
-	}
-
-	private void init() {
-		setBackground(VARNAConfig.DEFAULT_BACKGROUND_COLOR);
-		_manager = new UndoManager();
-		_manager.setLimit(10000);
-		_UI.addUndoableEditListener(_manager);
-
-		_blink = new ControleurBlinkingThread(this,
-				ControleurBlinkingThread.DEFAULT_FREQUENCY, 0, 1.0, 0.0, 0.2);
-		_blink.start();
-
-		_premierAffichage = true;
-		_translation = new Point(0, 0);
-
-		_horsCadre = false;
-		this.setFont(_conf._fontBasesGeneral);
-
-		// ajout des controleurs au VARNAPanel
-		ControleurClicMovement controleurClicMovement = new ControleurClicMovement(
-				this);
-		this.addMouseListener(controleurClicMovement);
-		this.addMouseMotionListener(controleurClicMovement);
-		this.addMouseWheelListener(new ControleurMolette(this));
-
-		ControleurDraggedMolette ctrlDraggedMolette = new ControleurDraggedMolette(
-				this);
-		this.addMouseMotionListener(ctrlDraggedMolette);
-		this.addMouseListener(ctrlDraggedMolette);
-
-		ControleurVARNAPanelKeys ctrlKey = new ControleurVARNAPanelKeys(this);
-		this.addKeyListener(ctrlKey);
-		this.addFocusListener(ctrlKey);
-
-		_interpolator = new ControleurInterpolator(this);
-		/**
-		 * 
-		 * BH SwingJS do not start this thread
-		 * 
-		 * @j2sNative 
-		 */
-		{
-		_interpolator.start();
-		}
-
-	}
-
-	public void undo() {
-		if (_manager.canUndo())
-			_manager.undo();
-	}
-
-	public void redo() {
-		if (_manager.canRedo())
-			_manager.redo();
-	}
-
-	/**
-	 * Sets the new style of the title font.
-	 * 
-	 * @param newStyle
-	 *            An int that describes the new font style ("PLAIN","BOLD",
-	 *            "BOLDITALIC", or "ITALIC")
-	 */
-	public void setTitleFontStyle(int newStyle) {
-		_conf._titleFont = _conf._titleFont.deriveFont(newStyle);
-		updateTitleHeight();
-	}
-
-	/**
-	 * Sets the new size of the title font.
-	 * 
-	 * @param newSize
-	 *            The new size of the title font
-	 */
-	public void setTitleFontSize(float newSize) {
-		//System.err.println("Applying title size "+newSize);
-		_conf._titleFont = _conf._titleFont.deriveFont(newSize);
-		updateTitleHeight();
-	}
-
-	/**
-	 * Sets the new font family to be used for the title. Available fonts are
-	 * system-specific, yet it seems that "Arial", "Dialog", and "MonoSpaced"
-	 * are almost always available.
-	 * 
-	 * @param newFamily
-	 *            New font family used for the title
-	 */
-	public void setTitleFontFamily(String newFamily) {
-		_conf._titleFont = new Font(newFamily, _conf._titleFont.getStyle(),
-				_conf._titleFont.getSize());
-		updateTitleHeight();
-	}
-
-	/**
-	 * Sets the color to be used for the title.
-	 * 
-	 * @param newColor
-	 *            A color used to draw the title
-	 */
-	public void setTitleFontColor(Color newColor) {
-		_conf._titleColor = newColor;
-		updateTitleHeight();
-	}
-
-	/**
-	 * Sets the font size for displaying bases
-	 * 
-	 * @param size
-	 *            Font size for base caption
-	 */
-
-	public void setBaseFontSize(Float size) {
-		_conf._fontBasesGeneral = _conf._fontBasesGeneral.deriveFont(size);
-	}
-
-	/**
-	 * Sets the font size for displaying base numbers
-	 * 
-	 * @param size
-	 *            Font size for base numbers
-	 */
-
-	public void setNumbersFontSize(Float size) {
-		_conf._numbersFont = _conf._numbersFont.deriveFont(size);
-	}
-
-	/**
-	 * Sets the font style for displaying bases
-	 * 
-	 * @param style
-	 *            An int that describes the new font style ("PLAIN","BOLD",
-	 *            "BOLDITALIC", or "ITALIC")
-	 */
-
-	public void setBaseFontStyle(int style) {
-		_conf._fontBasesGeneral = _conf._fontBasesGeneral.deriveFont(style);
-	}
-
-	private void updateTitleHeight() {
-		if (!getTitle().equals("")) {
-			_titleHeight = (int) (_conf._titleFont.getSize() * 1.5);
-		} else {
-			_titleHeight = 0;
-		}
-		if (Math.abs(this.getZoom() - 1) < .02) {
-			_translation.y = (int) (-getTitleHeight() / 2.0);
-		}
-	}
-
-	/**
-	 * Sets the panel's title, giving a short description of the RNA secondary
-	 * structure.
-	 * 
-	 * @param title
-	 *            The new title
-	 */
-	public void setTitle(String title) {
-		_RNA.setName(title);
-		updateTitleHeight();
-	}
-
-	/**
-	 * Sets the distance between consecutive base numbers. Please notice that :
-	 * <ul>
-	 * <li>The first and last base are always numbered</li>
-	 * <li>The numbering is based on the base numbers, not on the indices. So
-	 * base numbers may appear more frequently than expected if bases are
-	 * skipped</li>
-	 * <li>The periodicity is measured starting from 0. This means that for a
-	 * period of 10 and bases numbered from 1 to 52, the base numbers
-	 * [1,10,20,30,40,50,52] will be drawn.</li>
-	 * </ul>
-	 * 
-	 * @param n
-	 *            New numbering period
-	 */
-	public void setNumPeriod(int n) {
-		_conf._numPeriod = n;
-	}
-
-	/**
-	 * Returns the current numbering period. Please notice that :
-	 * <ul>
-	 * <li>The first and last base are always numbered</li>
-	 * <li>The numbering is based on the base numbers, not on the indices. So
-	 * base numbers may appear more frequently than expected if bases are
-	 * skipped</li>
-	 * <li>The periodicity is measured starting from 0. This means that for a
-	 * period of 10 and bases numbered from 1 to 52, the base numbers
-	 * [1,10,20,30,40,50,52] will be drawn.</li>
-	 * </ul>
-	 * 
-	 * @return Current numbering period
-	 */
-	public int getNumPeriod() {
-		return _conf._numPeriod;
-	}
-
-	private void setScaleFactor(double d) {
-		_scaleFactor = d;
-	}
-
-	private double getScaleFactor() {
-		return _scaleFactor;
-	}
-
-	private void setAutoFit(boolean fit) {
-		_conf._autoFit = fit;
-		repaint();
-	}
-
-	public void lockScrolling() {
-		setAutoFit(false);
-		setAutoCenter(false);
-	}
-
-	public void unlockScrolling() {
-		setAutoFit(true);
-		setAutoCenter(true);
-	}
-
-	private void drawStringOutline(VueVARNAGraphics g2D, String res, double x,
-			double y, double margin) {
-		Dimension d = g2D.getStringDimension(res);
-		x -= (double) d.width / 2.0;
-		y += (double) d.height / 2.0;
-		g2D.setColor(Color.GRAY);
-		g2D.setSelectionStroke();
-		g2D.drawRect((x - margin), (y - d.height - margin),
-				(d.width + 2.0 * margin), (d.height + 2.0 * margin));
-	}
-
-	private void drawSymbol(VueVARNAGraphics g2D, double posx, double posy,
-			double normx, double normy, double radius, boolean isCIS,
-			ModeleBP.Edge e) {
-		Color bck = g2D.getColor();
-		switch (e) {
-		case WC:
-			if (isCIS) {
-				g2D.setColor(bck);
-				g2D.fillCircle((posx - (radius) / 2.0),
-						(posy - (radius) / 2.0), radius);
-				g2D.drawCircle((posx - (radius) / 2.0),
-						(posy - (radius) / 2.0), radius);
-			} else {
-				g2D.setColor(Color.white);
-				g2D.fillCircle(posx - (radius) / 2.0, (posy - (radius) / 2.0),
-						(radius));
-				g2D.setColor(bck);
-				g2D.drawCircle((posx - (radius) / 2.0),
-						(posy - (radius) / 2.0), (radius));
-			}
-			break;
-		case HOOGSTEEN: {
-			GeneralPath p2 = new GeneralPath();
-			radius /= 1.05;
-			p2.moveTo((float) (posx - radius * normx / 2.0 - radius * normy
-					/ 2.0), (float) (posy - radius * normy / 2.0 + radius
-					* normx / 2.0));
-			p2.lineTo((float) (posx + radius * normx / 2.0 - radius * normy
-					/ 2.0), (float) (posy + radius * normy / 2.0 + radius
-					* normx / 2.0));
-			p2.lineTo((float) (posx + radius * normx / 2.0 + radius * normy
-					/ 2.0), (float) (posy + radius * normy / 2.0 - radius
-					* normx / 2.0));
-			p2.lineTo((float) (posx - radius * normx / 2.0 + radius * normy
-					/ 2.0), (float) (posy - radius * normy / 2.0 - radius
-					* normx / 2.0));
-			p2.closePath();
-
-			if (isCIS) {
-				g2D.setColor(bck);
-				g2D.fill(p2);
-				g2D.draw(p2);
-			} else {
-				g2D.setColor(Color.white);
-				g2D.fill(p2);
-				g2D.setColor(bck);
-				g2D.draw(p2);
-			}
-		}
-			break;
-		case SUGAR: {
-			double ix = radius * normx / 2.0;
-			double iy = radius * normy / 2.0;
-			double jx = radius * normy / 2.0;
-			double jy = -radius * normx / 2.0;
-
-			GeneralPath p2 = new GeneralPath();
-			p2.moveTo((float) (posx - ix + jx), (float) (posy - iy + jy));
-			p2.lineTo((float) (posx + ix + jx), (float) (posy + iy + jy));
-			p2.lineTo((float) (posx - jx), (float) (posy - jy));
-			p2.closePath();
-
-			if (isCIS) {
-				g2D.setColor(bck);
-				g2D.fill(p2);
-				g2D.draw(p2);
-			} else {
-				g2D.setColor(Color.white);
-				g2D.fill(p2);
-				g2D.setColor(bck);
-				g2D.draw(p2);
-			}
-		}
-			break;
-		}
-		g2D.setColor(bck);
-	}
-
-	private void drawBasePairArc(VueVARNAGraphics g2D, int i, int j,
-			Point2D.Double orig, Point2D.Double dest, double scaleFactor,
-			ModeleBP style, double newRadius) {
-		double distance, coef;
-		if (j - i == 1)
-			coef = getBPHeightIncrement() * 1.75;
-		else
-			coef = getBPHeightIncrement();
-		distance = dest.x - orig.x;
-		switch (_conf._mainBPStyle) {
-		case LW: {
-			double radiusCircle = ((RNA.BASE_PAIR_DISTANCE - _RNA.BASE_RADIUS) / 5.0)
-					* scaleFactor;
-			if (style.isCanonical()) {
-				if (style.isCanonicalGC()) {
-					if ((orig.x != dest.x) || (orig.y != dest.y)) {
-						g2D.drawArc((dest.x + orig.x) / 2., dest.y
-								- scaleFactor * _RNA.BASE_RADIUS / 2.0,
-								(distance - scaleFactor * _RNA.BASE_RADIUS
-										/ 3.0), (distance * coef - scaleFactor
-										* _RNA.BASE_RADIUS / 3.0), 0, 180);
-						g2D.drawArc((dest.x + orig.x) / 2., dest.y
-								- scaleFactor * _RNA.BASE_RADIUS / 2.0,
-								(distance + scaleFactor * _RNA.BASE_RADIUS
-										/ 3.0), (distance * coef + scaleFactor
-										* _RNA.BASE_RADIUS / 3.0), 0, 180);
-					}
-				} else if (style.isCanonicalAU()) {
-					g2D.drawArc((dest.x + orig.x) / 2., dest.y - scaleFactor
-							* _RNA.BASE_RADIUS / 2.0, (distance),
-							(distance * coef), 0, 180);
-				} else if (style.isWobbleUG()) {
-					Point2D.Double midtop = new Point2D.Double(
-							(dest.x + orig.x) / 2., dest.y - distance * coef
-									/ 2. - scaleFactor * _RNA.BASE_RADIUS / 2.0);
-					g2D.drawArc(midtop.x, dest.y - scaleFactor
-							* _RNA.BASE_RADIUS / 2.0, (distance),
-							(distance * coef), 0, 180);
-					drawSymbol(g2D, midtop.x, midtop.y, 1., 0., radiusCircle,
-							false, ModeleBP.Edge.WC);
-				} else {
-					Point2D.Double midtop = new Point2D.Double(
-							(dest.x + orig.x) / 2., dest.y - distance * coef
-									/ 2. - scaleFactor * _RNA.BASE_RADIUS / 2.0);
-					g2D.drawArc(midtop.x, dest.y - scaleFactor
-							* _RNA.BASE_RADIUS / 2.0, (distance),
-							(distance * coef), 0, 180);
-					drawSymbol(g2D, midtop.x, midtop.y, 1., 0., radiusCircle,
-							style.isCIS(), style.getEdgePartner5());
-				}
-			} else {
-				ModeleBP.Edge p1 = style.getEdgePartner5();
-				ModeleBP.Edge p2 = style.getEdgePartner3();
-				Point2D.Double midtop = new Point2D.Double(
-						(dest.x + orig.x) / 2., dest.y - distance * coef / 2.
-								- scaleFactor * _RNA.BASE_RADIUS / 2.0);
-				g2D.drawArc(midtop.x, dest.y - scaleFactor * _RNA.BASE_RADIUS
-						/ 2.0, (distance), (distance * coef), 0, 180);
-				if (p1 == p2) {
-					drawSymbol(g2D, midtop.x, midtop.y, 1., 0., radiusCircle,
-							false, style.getEdgePartner5());
-				} else {
-					drawSymbol(g2D, midtop.x - scaleFactor * _RNA.BASE_RADIUS,
-							midtop.y, 1., 0., radiusCircle, style.isCIS(), p1);
-					drawSymbol(g2D, midtop.x + scaleFactor * _RNA.BASE_RADIUS,
-							midtop.y, -1., 0., radiusCircle, style.isCIS(), p2);
-				}
-			}
-		}
-			break;
-		case LW_ALT: {
-			double radiusCircle = ((RNA.BASE_PAIR_DISTANCE - _RNA.BASE_RADIUS) / 5.0)
-					* scaleFactor;
-			double distFromBaseCenter = DISTANCE_FACT*scaleFactor;
-			orig = new Point2D.Double(orig.x,orig.y-(distFromBaseCenter+newRadius));
-			dest = new Point2D.Double(dest.x,dest.y-(distFromBaseCenter+newRadius));
-			if (style.isCanonical()) {
-				if (style.isCanonicalGC()) {
-					if ((orig.x != dest.x) || (orig.y != dest.y)) {
-						g2D.drawArc((dest.x + orig.x) / 2., dest.y
-								- scaleFactor * _RNA.BASE_RADIUS / 2.0,
-								(distance - scaleFactor * _RNA.BASE_RADIUS
-										/ 3.0), (distance * coef - scaleFactor
-										* _RNA.BASE_RADIUS / 3.0), 0, 180);
-						g2D.drawArc((dest.x + orig.x) / 2., dest.y
-								- scaleFactor * _RNA.BASE_RADIUS / 2.0,
-								(distance + scaleFactor * _RNA.BASE_RADIUS
-										/ 3.0), (distance * coef + scaleFactor
-										* _RNA.BASE_RADIUS / 3.0), 0, 180);
-					}
-				} else if (style.isCanonicalAU()) {
-					g2D.drawArc((dest.x + orig.x) / 2., dest.y - scaleFactor
-							* _RNA.BASE_RADIUS / 2.0, (distance),
-							(distance * coef), 0, 180);
-				}
-			} else {
-				ModeleBP.Edge p1 = style.getEdgePartner5();
-				ModeleBP.Edge p2 = style.getEdgePartner3();
-				Point2D.Double midtop = new Point2D.Double(
-						(dest.x + orig.x) / 2., dest.y - distance * coef / 2.
-								- scaleFactor * _RNA.BASE_RADIUS / 2.0);
-				g2D.drawArc(midtop.x, dest.y - scaleFactor * _RNA.BASE_RADIUS
-						/ 2.0, (distance), (distance * coef), 0, 180);
-				drawSymbol(g2D, orig.x,
-							orig.y-radiusCircle*.95, 1., 0., radiusCircle, style.isCIS(), p1);
-				drawSymbol(g2D, dest.x,
-							dest.y-radiusCircle*.95, -1., 0., radiusCircle, style.isCIS(), p2);
-			}
-		}
-			break;
-		default:
-			g2D.drawArc((dest.x + orig.x) / 2., dest.y - scaleFactor
-					* _RNA.BASE_RADIUS / 2.0, (distance), (distance * coef), 0,
-					180);
-			break;
-		}
-
-	}
-
-	public static double DISTANCE_FACT = 2.;
-
-	
-	private void drawBasePair(VueVARNAGraphics g2D, Point2D.Double orig,
-			Point2D.Double dest, ModeleBP style, double newRadius,
-			double scaleFactor) {
-
-		double dx = dest.x - orig.x;
-		double dy = dest.y - orig.y;
-		double dist = Math.sqrt((dest.x - orig.x) * (dest.x - orig.x)
-				+ (dest.y - orig.y) * (dest.y - orig.y));
-		dx /= dist;
-		dy /= dist;
-		double nx = -dy;
-		double ny = dx;
-		orig = new Point2D.Double(orig.x + newRadius * dx, orig.y + newRadius
-				* dy);
-		dest = new Point2D.Double(dest.x - newRadius * dx, dest.y - newRadius
-				* dy);
-		switch (_conf._mainBPStyle) {
-		case LW: {
-			double radiusCircle = ((RNA.BASE_PAIR_DISTANCE - _RNA.BASE_RADIUS) / 5.0)
-					* scaleFactor;
-			if (style.isCanonical()) {
-				if (style.isCanonicalGC()) {
-					if ((orig.x != dest.x) || (orig.y != dest.y)) {
-						nx *= scaleFactor * _RNA.BASE_RADIUS / 4.0;
-						ny *= scaleFactor * _RNA.BASE_RADIUS / 4.0;
-						g2D.drawLine((orig.x + nx), (orig.y + ny),
-								(dest.x + nx), (dest.y + ny));
-						g2D.drawLine((orig.x - nx), (orig.y - ny),
-								(dest.x - nx), (dest.y - ny));
-					}
-				} else if (style.isCanonicalAU()) {
-					g2D.drawLine(orig.x, orig.y, dest.x, dest.y);
-				} else if (style.isWobbleUG()) {
-					double cx = (dest.x + orig.x) / 2.0;
-					double cy = (dest.y + orig.y) / 2.0;
-					g2D.drawLine(orig.x, orig.y, dest.x, dest.y);
-					drawSymbol(g2D, cx, cy, nx, ny, radiusCircle, false,
-							ModeleBP.Edge.WC);
-				} else {
-					double cx = (dest.x + orig.x) / 2.0;
-					double cy = (dest.y + orig.y) / 2.0;
-					g2D.drawLine(orig.x, orig.y, dest.x, dest.y);
-					drawSymbol(g2D, cx, cy, nx, ny, radiusCircle,
-							style.isCIS(), style.getEdgePartner5());
-				}
-			} else {
-				ModeleBP.Edge p1 = style.getEdgePartner5();
-				ModeleBP.Edge p2 = style.getEdgePartner3();
-				double cx = (dest.x + orig.x) / 2.0;
-				double cy = (dest.y + orig.y) / 2.0;
-				g2D.drawLine(orig.x, orig.y, dest.x, dest.y);
-				if (p1 == p2) {
-					drawSymbol(g2D, cx, cy, nx, ny, radiusCircle,
-							style.isCIS(), p1);
-
-				} else {
-					double vdx = (dest.x - orig.x);
-					double vdy = (dest.y - orig.y);
-					vdx /= 6.0;
-					vdy /= 6.0;
-					drawSymbol(g2D, cx + vdx, cy + vdy, -nx, -ny, radiusCircle,
-							style.isCIS(), p2);
-					drawSymbol(g2D, cx - vdx, cy - vdy, nx, ny, radiusCircle,
-							style.isCIS(), p1);
-				}
-			}
-		}
-			break;
-		case LW_ALT: {
-			double radiusCircle = ((RNA.BASE_PAIR_DISTANCE - _RNA.BASE_RADIUS) / 5.0)
-					* scaleFactor;
-			double distFromBaseCenter = DISTANCE_FACT*scaleFactor;
-			Point2D.Double norig = new Point2D.Double(orig.x+(distFromBaseCenter+.5*newRadius)*dx,orig.y+(distFromBaseCenter+.5*newRadius)*dy);
-			Point2D.Double ndest = new Point2D.Double(dest.x-(distFromBaseCenter+.5*newRadius)*dx,dest.y-(distFromBaseCenter+.5*newRadius)*dy);
-			if (style.isCanonical()) {
-				if (style.isCanonicalGC()) {
-					if ((norig.x != ndest.x) || (norig.y != ndest.y)) {
-						nx *= scaleFactor * _RNA.BASE_RADIUS / 4.0;
-						ny *= scaleFactor * _RNA.BASE_RADIUS / 4.0;
-						g2D.drawLine((norig.x + nx), (norig.y + ny),
-								(ndest.x + nx), (ndest.y + ny));
-						g2D.drawLine((norig.x - nx), (norig.y - ny),
-								(ndest.x - nx), (ndest.y - ny));
-					}
-				} else if (style.isCanonicalAU()) {
-					g2D.drawLine(norig.x, norig.y, ndest.x, ndest.y);
-				} else if (style.isWobbleUG()) {
-					double cx = (ndest.x + norig.x) / 2.0;
-					double cy = (ndest.y + norig.y) / 2.0;
-					g2D.drawLine(norig.x, norig.y, ndest.x, ndest.y);
-					drawSymbol(g2D, cx, cy, nx, ny, radiusCircle, false,
-							ModeleBP.Edge.WC);
-				} else {
-					double cx = (ndest.x + norig.x) / 2.0;
-					double cy = (ndest.y + norig.y) / 2.0;
-					g2D.drawLine(norig.x, norig.y, ndest.x, ndest.y);
-					drawSymbol(g2D, cx, cy, nx, ny, radiusCircle,
-							style.isCIS(), style.getEdgePartner5());
-				}
-			} else {
-				ModeleBP.Edge p1 = style.getEdgePartner5();
-				ModeleBP.Edge p2 = style.getEdgePartner3();
-				double cx = (ndest.x + norig.x) / 2.0;
-				double cy = (ndest.y + norig.y) / 2.0;
-				g2D.drawLine(norig.x, norig.y, ndest.x, ndest.y);
-				if (p1 == p2) {
-					drawSymbol(g2D, cx, cy, nx, ny, radiusCircle,
-							style.isCIS(), p1);
-
-				} else {
-					double fac = .4;
-					drawSymbol(g2D, ndest.x - fac*radiusCircle*dx, ndest.y - fac*radiusCircle*dy, -nx, -ny, radiusCircle,
-							style.isCIS(), p2);
-					drawSymbol(g2D, norig.x + fac*radiusCircle*dx, norig.y + fac*radiusCircle*dy, nx, ny, radiusCircle,
-							style.isCIS(), p1);
-				}
-			}
-		}
-			break;
-		case SIMPLE:
-			g2D.drawLine(orig.x, orig.y, dest.x, dest.y);
-			break;
-		case RNAVIZ:
-			double xcenter = (orig.x + dest.x) / 2.0;
-			double ycenter = (orig.y + dest.y) / 2.0;
-			double radius = Math.max(4.0 * scaleFactor, 1.0);
-			g2D.fillCircle((xcenter - radius), (ycenter - radius),
-					(2.0 * radius));
-			break;
-		case NONE:
-			break;
-		}
-	}
-
-	private Color getHighlightedVersion(Color c1, Color c2) {
-		int r1 = c1.getRed();
-		int g1 = c1.getGreen();
-		int b1 = c1.getBlue();
-		int r2 = c2.getRed();
-		int g2 = c2.getGreen();
-		int b2 = c2.getBlue();
-		double val = _blink.getVal();
-		int nr = Math.max(0,
-				Math.min((int) ((r1 * val + r2 * (1.0 - val))), 255));
-		int ng = Math.max(0,
-				Math.min((int) ((g1 * val + g2 * (1.0 - val))), 255));
-		int nb = Math.max(0,
-				Math.min((int) ((b1 * val + b2 * (1.0 - val))), 255));
-		return new Color(nr, ng, nb);
-	}
-
-	private Color highlightFilter(int index, Color initialColor, Color c1,
-			Color c2, boolean localView) {
-		if (_selectedBases.contains(_RNA.getBaseAt(index)) && localView) {
-			return getHighlightedVersion(c1, c2);
-		} else
-			return initialColor;
-	}
-
-	public static Point2D.Double computeExcentricUnitVector(int i,
-			Point2D.Double[] points, Point2D.Double[] centers) {
-		double dist = points[i].distance(centers[i]);
-		Point2D.Double byCenter = new Point2D.Double(
-				(points[i].x - centers[i].x) / dist,
-				(points[i].y - centers[i].y) / dist);
-		if ((i > 0) && (i < points.length - 1)) {
-			Point2D.Double p0 = points[i - 1];
-			Point2D.Double p1 = points[i];
-			Point2D.Double p2 = points[i + 1];
-			double dist1 = p2.distance(p1);
-			Point2D.Double v1 = new Point2D.Double((p2.x - p1.x) / dist1,
-					(p2.y - p1.y) / dist1);
-			Point2D.Double vn1 = new Point2D.Double(v1.y, -v1.x);
-			double dist2 = p1.distance(p0);
-			Point2D.Double v2 = new Point2D.Double((p1.x - p0.x) / dist2,
-					(p1.y - p0.y) / dist2);
-			Point2D.Double vn2 = new Point2D.Double(v2.y, -v2.x);
-			Point2D.Double vn = new Point2D.Double((vn1.x + vn2.x) / 2.0,
-					(vn1.y + vn2.y) / 2.0);
-			double D = vn.distance(new Point2D.Double(0.0, 0.0));
-			vn.x /= D;
-			vn.y /= D;
-			if (byCenter.x * vn.x + byCenter.y * vn.y < 0) {
-				vn.x = -vn.x;
-				vn.y = -vn.y;
-			}
-			return vn;
-		} 
-		else if (((i==0) || (i==points.length-1)) && (points.length>1)) {
-			int a = (i==0)?0:points.length-1;
-			int b = (i==0)?1:points.length-2;
-			double D = points[a].distance(points[b]);
-			return new Point2D.Double(
-					(points[a].x - points[b].x) / D,
-					(points[a].y - points[b].y) / D);
-		}
-		else {
-			return byCenter;
-		}
-	}
-
-	private void drawBase(VueVARNAGraphics g2D, int i, Point2D.Double[] points,
-			Point2D.Double[] centers, double newRadius, double _scaleFactor,
-			boolean localView) {
-		Point2D.Double p = points[i];
-		ModeleBase mb = _RNA.get_listeBases().get(i);
-		g2D.setFont(_conf._fontBasesGeneral);
-		Color baseInnerColor = highlightFilter(i,
-				_RNA.getBaseInnerColor(i, _conf), Color.white,
-				_RNA.getBaseInnerColor(i, _conf), localView);
-		Color baseOuterColor = highlightFilter(i,
-				_RNA.getBaseOuterColor(i, _conf),
-				_RNA.getBaseOuterColor(i, _conf), Color.white, localView);
-		Color baseNameColor = highlightFilter(i,
-				_RNA.getBaseNameColor(i, _conf),
-				_RNA.getBaseNameColor(i, _conf), Color.white, localView);
-		if ( RNA.whiteLabelPreferrable(baseInnerColor))
-		{
-			baseNameColor=Color.white;
-		}
-
-		if (mb instanceof ModeleBaseNucleotide) {
-			ModeleBaseNucleotide mbn = (ModeleBaseNucleotide) mb;
-			String res = mbn.getBase();
-			if (_hoveredBase == mb && localView && isModifiable()) {
-				g2D.setColor(_conf._hoverColor);
-				g2D.fillCircle(p.getX() - 1.5 * newRadius, p.getY() - 1.5
-						* newRadius, 3.0 * newRadius);
-				g2D.setColor(_conf._hoverColor.darker());
-				g2D.drawCircle(p.getX() - 1.5 * newRadius, p.getY() - 1.5
-						* newRadius, 3.0 * newRadius);
-				g2D.setPlainStroke();
-			}
-			if (_conf._fillBases) {
-				// Filling inner circle
-				g2D.setColor(baseInnerColor);
-				g2D.fillCircle(p.getX() - newRadius, p.getY() - newRadius,
-						2.0 * newRadius);
-			}
-
-			if (_conf._drawOutlineBases) {
-				// Drawing outline
-				g2D.setColor(baseOuterColor);
-				g2D.setStrokeThickness(_conf._baseThickness * _scaleFactor);
-				g2D.drawCircle(p.getX() - newRadius, p.getY() - newRadius,
-						2.0 * newRadius);
-			}
-			// Drawing label
-			g2D.setColor(baseNameColor);
-			g2D.drawStringCentered(String.valueOf(res), p.getX(), p.getY());
-		} else if (mb instanceof ModeleBasesComparison) {
-
-			ModeleBasesComparison mbc = (ModeleBasesComparison) mb;
-
-			// On lui donne l'aspect voulue (on a un trait droit)
-			g2D.setPlainStroke(); // On doit avoir un trait droit, sans arrondit
-			g2D.setStrokeThickness(_conf._baseThickness * _scaleFactor);
-
-			// On dessine l'étiquette, rectangle aux bords arrondies.
-			g2D.setColor(baseInnerColor);
-			g2D.fillRoundRect((p.getX() - 1.5 * newRadius),
-					(p.getY() - newRadius), (3.0 * newRadius),
-					(2.0 * newRadius), 10 * _scaleFactor, 10 * _scaleFactor);
-
-			/* Dessin du rectangle exterieur (bords) */
-			g2D.setColor(baseOuterColor);
-			g2D.drawRoundRect((p.getX() - 1.5 * newRadius),
-					(p.getY() - newRadius), (3 * newRadius), (2 * newRadius),
-					10 * _scaleFactor, 10 * _scaleFactor);
-
-			// On le dessine au centre de l'étiquette.
-			g2D.drawLine((p.getX()), (p.getY() + newRadius) - 1, (p.getX()),
-					(p.getY() - newRadius) + 1);
-
-			/* Dessin du nom de la base (A,C,G,U,etc...) */
-			// On créer le texte des étiquettes
-			String label1 = String.valueOf(mbc.getBase1());
-			String label2 = String.valueOf(mbc.getBase2());
-
-			// On leur donne une couleur
-			g2D.setColor(getRNA().get_listeBases().get(i).getStyleBase()
-					.getBaseNameColor());
-
-			// Et on les dessine.
-			g2D.drawStringCentered(label1, p.getX() - (.75 * newRadius),
-					p.getY());
-			g2D.drawStringCentered(label2, p.getX() + (.75 * newRadius),
-					p.getY());
-		}
-
-		// Drawing base number
-		if (_RNA.isNumberDrawn(mb, getNumPeriod())) {
-
-			Point2D.Double vn = computeExcentricUnitVector(i, points, centers);
-			g2D.setColor(mb.getStyleBase().getBaseNumberColor());
-			g2D.setFont(_conf._numbersFont);
-			double factorMin = Math.min(.5, _conf._distNumbers);
-			double factorMax = Math.min(_conf._distNumbers - 1.5,
-					_conf._distNumbers);
-			g2D.drawLine(p.x + vn.x * ((1 + factorMin) * newRadius), p.y + vn.y
-					* ((1 + factorMin) * newRadius), p.x + vn.x
-					* ((1 + factorMax) * newRadius), p.y + vn.y
-					* ((1 + factorMax) * newRadius));
-			g2D.drawStringCentered(mb.getLabel(), p.x + vn.x
-					* ((1 + _conf._distNumbers) * newRadius), p.y + vn.y
-					* ((1 + _conf._distNumbers) * newRadius));
-
-		}
-	}
-
-	void drawChemProbAnnotation(VueVARNAGraphics g2D, ChemProbAnnotation cpa,
-			Point2D.Double anchor, double scaleFactor) {
-		g2D.setColor(cpa.getColor());
-		g2D.setStrokeThickness(RNA.CHEM_PROB_ARROW_THICKNESS * scaleFactor
-				* cpa.getIntensity());
-		g2D.setPlainStroke();
-		Point2D.Double v = cpa.getDirVector();
-		Point2D.Double vn = cpa.getNormalVector();
-		Point2D.Double base = new Point2D.Double(
-				(anchor.x + _RNA.CHEM_PROB_DIST * scaleFactor * v.x),
-				(anchor.y + _RNA.CHEM_PROB_DIST * scaleFactor * v.y));
-		Point2D.Double edge = new Point2D.Double(
-				(base.x + _RNA.CHEM_PROB_BASE_LENGTH * cpa.getIntensity()
-						* scaleFactor * v.x),
-				(base.y + _RNA.CHEM_PROB_BASE_LENGTH * cpa.getIntensity()
-						* scaleFactor * v.y));
-		switch (cpa.getType()) {
-		case ARROW: {
-			Point2D.Double arrowTip1 = new Point2D.Double(
-					(base.x + cpa.getIntensity()
-							* scaleFactor
-							* (_RNA.CHEM_PROB_ARROW_WIDTH * vn.x + _RNA.CHEM_PROB_ARROW_HEIGHT
-									* v.x)),
-					(base.y + cpa.getIntensity()
-							* scaleFactor
-							* (_RNA.CHEM_PROB_ARROW_WIDTH * vn.y + _RNA.CHEM_PROB_ARROW_HEIGHT
-									* v.y)));
-			Point2D.Double arrowTip2 = new Point2D.Double(
-					(base.x + cpa.getIntensity()
-							* scaleFactor
-							* (-_RNA.CHEM_PROB_ARROW_WIDTH * vn.x + _RNA.CHEM_PROB_ARROW_HEIGHT
-									* v.x)),
-					(base.y + cpa.getIntensity()
-							* scaleFactor
-							* (-_RNA.CHEM_PROB_ARROW_WIDTH * vn.y + _RNA.CHEM_PROB_ARROW_HEIGHT
-									* v.y)));
-			g2D.drawLine(base.x, base.y, edge.x, edge.y);
-			g2D.drawLine(base.x, base.y, arrowTip1.x, arrowTip1.y);
-			g2D.drawLine(base.x, base.y, arrowTip2.x, arrowTip2.y);
-		}
-			break;
-		case PIN: {
-			Point2D.Double side1 = new Point2D.Double(
-					(edge.x - cpa.getIntensity() * scaleFactor
-							* (_RNA.CHEM_PROB_PIN_SEMIDIAG * v.x)),
-					(edge.y - cpa.getIntensity() * scaleFactor
-							* (_RNA.CHEM_PROB_PIN_SEMIDIAG * v.y)));
-			Point2D.Double side2 = new Point2D.Double(
-					(edge.x - cpa.getIntensity() * scaleFactor
-							* (_RNA.CHEM_PROB_PIN_SEMIDIAG * vn.x)),
-					(edge.y - cpa.getIntensity() * scaleFactor
-							* (_RNA.CHEM_PROB_PIN_SEMIDIAG * vn.y)));
-			Point2D.Double side3 = new Point2D.Double(
-					(edge.x + cpa.getIntensity() * scaleFactor
-							* (_RNA.CHEM_PROB_PIN_SEMIDIAG * v.x)),
-					(edge.y + cpa.getIntensity() * scaleFactor
-							* (_RNA.CHEM_PROB_PIN_SEMIDIAG * v.y)));
-			Point2D.Double side4 = new Point2D.Double(
-					(edge.x + cpa.getIntensity() * scaleFactor
-							* (_RNA.CHEM_PROB_PIN_SEMIDIAG * vn.x)),
-					(edge.y + cpa.getIntensity() * scaleFactor
-							* (_RNA.CHEM_PROB_PIN_SEMIDIAG * vn.y)));
-			GeneralPath p2 = new GeneralPath();
-			p2.moveTo((float) side1.x, (float) side1.y);
-			p2.lineTo((float) side2.x, (float) side2.y);
-			p2.lineTo((float) side3.x, (float) side3.y);
-			p2.lineTo((float) side4.x, (float) side4.y);
-			p2.closePath();
-			g2D.fill(p2);
-			g2D.drawLine(base.x, base.y, edge.x, edge.y);
-		}
-			break;
-		case TRIANGLE: {
-			Point2D.Double arrowTip1 = new Point2D.Double(
-					(edge.x + cpa.getIntensity() * scaleFactor
-							* (_RNA.CHEM_PROB_TRIANGLE_WIDTH * vn.x)),
-					(edge.y + cpa.getIntensity() * scaleFactor
-							* (_RNA.CHEM_PROB_TRIANGLE_WIDTH * vn.y)));
-			Point2D.Double arrowTip2 = new Point2D.Double(
-					(edge.x + cpa.getIntensity() * scaleFactor
-							* (-_RNA.CHEM_PROB_TRIANGLE_WIDTH * vn.x)),
-					(edge.y + cpa.getIntensity() * scaleFactor
-							* (-_RNA.CHEM_PROB_TRIANGLE_WIDTH * vn.y)));
-			GeneralPath p2 = new GeneralPath();
-			p2.moveTo((float) base.x, (float) base.y);
-			p2.lineTo((float) arrowTip1.x, (float) arrowTip1.y);
-			p2.lineTo((float) arrowTip2.x, (float) arrowTip2.y);
-			p2.closePath();
-			g2D.fill(p2);
-		}
-			break;
-		case DOT: {
-			Double radius = scaleFactor * _RNA.CHEM_PROB_DOT_RADIUS
-					* cpa.getIntensity();
-			Point2D.Double center = new Point2D.Double((base.x + radius * v.x),
-					(base.y + radius * v.y));
-			g2D.fillCircle((center.x - radius), (center.y - radius),
-					(2 * radius));
-		}
-			break;
-		}
-	}
-
-	Point2D.Double buildCaptionPosition(ModeleBase mb, double scaleFactor,
-			double heightEstimate) {
-		double radius = 2.0;
-		if (_RNA.isNumberDrawn(mb, getNumPeriod())) {
-			radius += _conf._distNumbers;
-		}
-		Point2D.Double center = mb.getCenter();
-		Point2D.Double p = mb.getCoords();
-		double realDistance = _RNA.BASE_RADIUS * radius + heightEstimate;
-		return new Point2D.Double(center.getX() + (p.getX() - center.getX())
-				* ((p.distance(center) + realDistance) / p.distance(center)),
-				center.getY()
-						+ (p.getY() - center.getY())
-						* ((p.distance(center) + realDistance) / p
-								.distance(center)));
-	}
-
-	private void renderAnnotations(VueVARNAGraphics g2D, double offX,
-			double offY, double rnaBBoxX, double rnaBBoxY, double scaleFactor) {
-		for (TextAnnotation textAnnotation : _RNA.getAnnotations()) {
-			g2D.setColor(textAnnotation.getColor());
-			g2D.setFont(textAnnotation
-					.getFont()
-					.deriveFont(
-							(float) (2.0 * textAnnotation.getFont().getSize() * scaleFactor)));
-			Point2D.Double position = textAnnotation.getCenterPosition();
-			if (textAnnotation.getType() == TextAnnotation.AnchorType.BASE) {
-				ModeleBase mb = (ModeleBase) textAnnotation.getAncrage();
-				double fontHeight = Math.ceil(textAnnotation.getFont()
-						.getSize());
-				position = buildCaptionPosition(mb, scaleFactor, fontHeight);
-			}
-			position = transformCoord(position, offX, offY, rnaBBoxX, rnaBBoxY,
-					scaleFactor);
-			g2D.drawStringCentered(textAnnotation.getTexte(), position.x,
-					position.y);
-			if ((_selectedAnnotation == textAnnotation)
-					&& (_highlightAnnotation)) {
-				drawStringOutline(g2D, textAnnotation.getTexte(), position.x,
-						position.y, 5);
-			}
-		}
-		for (ChemProbAnnotation cpa : _RNA.getChemProbAnnotations()) {
-			Point2D.Double anchor = transformCoord(cpa.getAnchorPosition(),
-					offX, offY, rnaBBoxX, rnaBBoxY, scaleFactor);
-			drawChemProbAnnotation(g2D, cpa, anchor, scaleFactor);
-		}
-
-	}
-
-	public Rectangle2D.Double getExtendedRNABBox() {
-		// We get the logical bounding box
-		Rectangle2D.Double rnabbox = _RNA.getBBox();
-		rnabbox.y -= _conf._distNumbers * _RNA.BASE_RADIUS;
-		rnabbox.height += 2.0 * _conf._distNumbers * _RNA.BASE_RADIUS;
-		rnabbox.x -= _conf._distNumbers * _RNA.BASE_RADIUS;
-		rnabbox.width += 2.0 * _conf._distNumbers * _RNA.BASE_RADIUS;
-		if (_RNA.hasVirtualLoops()) {
-			rnabbox.y -= RNA.VIRTUAL_LOOP_RADIUS;
-			rnabbox.height += 2.0 * RNA.VIRTUAL_LOOP_RADIUS;
-			rnabbox.x -= RNA.VIRTUAL_LOOP_RADIUS;
-			rnabbox.width += 2.0 * RNA.VIRTUAL_LOOP_RADIUS;
-		}
-		return rnabbox;
-	}
-
-	public void drawBackbone(VueVARNAGraphics g2D, Point2D.Double[] newCoords,
-			double newRadius, double _scaleFactor) {
-		// Drawing backbone
-		if (getDrawBackbone()) {
-			g2D.setStrokeThickness(1.5 * _scaleFactor);
-			g2D.setColor(_conf._backboneColor);
-			
-			ModeleBackbone bck = _RNA.getBackbone();
-
-
-			for (int i = 1; i < _RNA.get_listeBases().size(); i++) {
-				Point2D.Double p1 = newCoords[i - 1];
-				Point2D.Double p2 = newCoords[i];
-				double dist = p1.distance(p2);
-				int a = _RNA.getBaseAt(i - 1).getElementStructure();
-				int b = _RNA.getBaseAt(i).getElementStructure();
-				boolean consecutivePair = (a == i) && (b == i - 1);
-
-				if ((dist > 0)) {
-					Point2D.Double vbp = new Point2D.Double();
-					vbp.x = (p2.x - p1.x) / dist;
-					vbp.y = (p2.y - p1.y) / dist;
-					
-					BackboneType bt = bck.getTypeBefore(i);
-					if (bt!=BackboneType.DISCONTINUOUS_TYPE)
-					{
-						if (bt==BackboneType.MISSING_PART_TYPE) {
-							g2D.setSelectionStroke();
-						} else {
-							g2D.setPlainStroke();
-						}
-						g2D.setColor(bck.getColorBefore(i, _conf._backboneColor));
-						
-						if (consecutivePair
-								&& (_RNA.getDrawMode() != RNA.DRAW_MODE_LINEAR)
-								&& (_RNA.getDrawMode() != RNA.DRAW_MODE_CIRCULAR)) {
-							int dir = 0;
-							if (i + 1 < newCoords.length) {
-								dir = (_RNA.testDirectionality(i - 1, i, i + 1) ? -1
-										: 1);
-							} else if (i - 2 >= 0) {
-								dir = (_RNA.testDirectionality(i - 2, i - 1, i) ? -1
-										: 1);
-							}
-							Point2D.Double vn = new Point2D.Double(dir * vbp.y,
-									-dir * vbp.x);
-							Point2D.Double centerSeg = new Point2D.Double(
-									(p1.x + p2.x) / 2.0, (p1.y + p2.y) / 2.0);
-							double distp1CenterSeq = p1.distance(centerSeg);
-							double centerDist = Math
-									.sqrt((RNA.VIRTUAL_LOOP_RADIUS * _scaleFactor
-											* RNA.VIRTUAL_LOOP_RADIUS * _scaleFactor)
-											- distp1CenterSeq * distp1CenterSeq);
-							Point2D.Double centerLoop = new Point2D.Double(
-									centerSeg.x + centerDist * vn.x, centerSeg.y
-											+ centerDist * vn.y);
-							double radius = centerLoop.distance(p1);
-							double a1 = 360.
-									* (Math.atan2(-(p1.y - centerLoop.y),
-											(p1.x - centerLoop.x)))
-									/ (2. * Math.PI);
-							double a2 = 360.
-									* (Math.atan2(-(p2.y - centerLoop.y),
-											(p2.x - centerLoop.x)))
-									/ (2. * Math.PI);
-							double angle = (a2 - a1);
-							if (-dir * angle < 0) {
-								angle += -dir * 360.;
-							}
-							// if (angle<0.) angle += 360.;
-							// angle = -dir*(360-dir*angle);
-							g2D.drawArc(centerLoop.x + .8 * newRadius * vn.x,
-									centerLoop.y + .8 * newRadius * vn.y,
-									2 * radius, 2 * radius, a1, angle);
-						} else {
-							g2D.drawLine((newCoords[i - 1].x + newRadius * vbp.x),
-									(newCoords[i - 1].y + newRadius * vbp.y),
-									(newCoords[i].x - newRadius * vbp.x),
-									(newCoords[i].y - newRadius * vbp.y));
-						}
-					}
-				}
-			}
-		}
-	}
-
-	public Point2D.Double logicToPanel(Point2D.Double logicPoint) {
-		return new Point2D.Double(_offX
-				+ (getScaleFactor() * (logicPoint.x - _offsetRNA.x)), _offY
-				+ (getScaleFactor() * (logicPoint.y - _offsetRNA.y)));
-
-	}
-
-	public Rectangle2D.Double renderRNA(VueVARNAGraphics g2D,
-			Rectangle2D.Double bbox) {
-		return renderRNA(g2D, bbox, false, true);
-	}
-
-	private double computeScaleFactor(Rectangle2D.Double bbox,
-			boolean localView, boolean autoCenter) {
-		Rectangle2D.Double rnabbox = getExtendedRNABBox();
-		double scaleFactor = Math.min((double) bbox.width
-				/ (double) rnabbox.width, (double) bbox.height
-				/ (double) rnabbox.height);
-
-		// Use it to get an estimate of the font size for numbers ...
-		float newFontSize = Math.max(1,
-				(int) ((1.7 * _RNA.BASE_RADIUS) * scaleFactor));
-		// ... and increase bounding box accordingly
-		rnabbox.y -= newFontSize;
-		rnabbox.height += newFontSize;
-		if (_conf._drawColorMap) {
-			rnabbox.height += getColorMapHeight();
-		}
-		rnabbox.x -= newFontSize;
-		rnabbox.width += newFontSize;
-
-		// Now, compute the final scaling factor and corresponding font size
-		scaleFactor = Math.min((double) bbox.width / (double) rnabbox.width,
-				(double) bbox.height / (double) rnabbox.height);
-		if (localView) {
-			if (_conf._autoFit)
-				setScaleFactor(scaleFactor);
-			scaleFactor = getScaleFactor();
-		}
-		return scaleFactor;
-	}
-
-	public synchronized Rectangle2D.Double renderRNA(VueVARNAGraphics g2D,
-			Rectangle2D.Double bbox, boolean localView, boolean autoCenter) {
-		Rectangle2D.Double rnaMultiBox = new Rectangle2D.Double(0, 0, 1, 1);
-		double scaleFactor = computeScaleFactor(bbox, localView, autoCenter);
-		float newFontSize = Math.max(1,
-				(int) ((1.7 * _RNA.BASE_RADIUS) * scaleFactor));
-		double newRadius = Math.max(1.0, (scaleFactor * _RNA.BASE_RADIUS));
-		setBaseFontSize(newFontSize);
-		setNumbersFontSize(newFontSize);
-		double offX = bbox.x;
-		double offY = bbox.y;
-		Rectangle2D.Double rnabbox = getExtendedRNABBox();
-
-		if (_RNA.getSize() != 0) {
-
-			Point2D.Double offsetRNA = new Point2D.Double(rnabbox.x, rnabbox.y);
-
-			if (autoCenter) {
-				offX = (bbox.x + (bbox.width - Math.round(rnabbox.width
-						* scaleFactor)) / 2.0);
-				offY = (bbox.y + (bbox.height - Math.round(rnabbox.height
-						* scaleFactor)) / 2.0);
-				if (localView) {
-					_offX = offX;
-					_offY = offY;
-					_offsetPanel = new Point2D.Double(_offX, _offY);
-					_offsetRNA = new Point2D.Double(rnabbox.x, rnabbox.y);
-				}
-			}
-
-			if (localView) {
-				offX = _offX;
-				offY = _offY;
-				offsetRNA = _offsetRNA;
-			}
-
-			// Re-scaling once and for all
-			Point2D.Double[] newCoords = new Point2D.Double[_RNA
-					.get_listeBases().size()];
-			Point2D.Double[] newCenters = new Point2D.Double[_RNA
-					.get_listeBases().size()];
-			for (int i = 0; i < _RNA.get_listeBases().size(); i++) {
-				ModeleBase mb = _RNA.getBaseAt(i);
-				newCoords[i] = new Point2D.Double(offX
-						+ (scaleFactor * (mb.getCoords().x - offsetRNA.x)),
-						offY + (scaleFactor * (mb.getCoords().y - offsetRNA.y)));
-
-				Point2D.Double centerBck = _RNA.getCenter(i);
-				// si la base est dans un angle entre une boucle et une helice
-				if (_RNA.get_drawMode() == RNA.DRAW_MODE_NAVIEW
-						|| _RNA.get_drawMode() == RNA.DRAW_MODE_RADIATE) {
-					if ((mb.getElementStructure() != -1)
-							&& i < _RNA.get_listeBases().size() - 1 && i > 1) {
-						ModeleBase b1 = _RNA.get_listeBases().get(i - 1);
-						ModeleBase b2 = _RNA.get_listeBases().get(i + 1);
-						int j1 = b1.getElementStructure();
-						int j2 = b2.getElementStructure();
-						if ((j1 == -1) ^ (j2 == -1)) {
-							// alors la position du nombre associé doit etre
-							Point2D.Double a1 = b1.getCoords();
-							Point2D.Double a2 = b2.getCoords();
-							Point2D.Double c1 = b1.getCenter();
-							Point2D.Double c2 = b2.getCenter();
-
-							centerBck.x = mb.getCoords().x + (c1.x - a1.x)
-									/ c1.distance(a1) + (c2.x - a2.x)
-									/ c2.distance(a2);
-							centerBck.y = mb.getCoords().y + (c1.y - a1.y)
-									/ c1.distance(a1) + (c2.y - a2.y)
-									/ c2.distance(a2);
-						}
-					}
-				}
-				newCenters[i] = new Point2D.Double(offX
-						+ (scaleFactor * (centerBck.x - offsetRNA.x)), offY
-						+ (scaleFactor * (centerBck.y - offsetRNA.y)));
-			}
-			// Keep track of coordinates for mouse interactions
-			if (localView) {
-				_realCoords = newCoords;
-				_realCenters = newCenters;
-			}
-
-			g2D.setStrokeThickness(1.5 * scaleFactor);
-			g2D.setPlainStroke();
-			g2D.setFont(_conf._fontBasesGeneral);
-
-			// Drawing region highlights Annotation
-			drawRegionHighlightsAnnotation(g2D, _realCoords, _realCenters,
-					scaleFactor);
-			drawBackbone(g2D, newCoords, newRadius, scaleFactor);
-
-			// Drawing base-pairs
-			// pour chaque base
-			for (int i = 0; i < _RNA.get_listeBases().size(); i++) {
-				int j = _RNA.get_listeBases().get(i).getElementStructure();
-				// si c'est une parenthese ouvrante (premiere base du
-				// couple)
-				if (j > i) {
-					ModeleBP msbp = _RNA.get_listeBases().get(i).getStyleBP();
-					// System.err.println(msbp);
-					if (msbp.isCanonical() || _conf._drawnNonCanonicalBP) {
-						if (_RNA.get_drawMode() == RNA.DRAW_MODE_LINEAR) {
-							g2D.setStrokeThickness(_RNA.getBasePairThickness(
-									msbp, _conf)
-									* 2.0
-									* scaleFactor
-									* _conf._bpThickness);
-						} else {
-							g2D.setStrokeThickness(_RNA.getBasePairThickness(
-									msbp, _conf) * 1.5 * scaleFactor);
-						}
-						g2D.setColor(_RNA.getBasePairColor(msbp, _conf));
-
-						if (_RNA.get_drawMode() == RNA.DRAW_MODE_LINEAR) {
-							drawBasePairArc(g2D, i, j, newCoords[i],
-									newCoords[j], scaleFactor, msbp, newRadius);
-						} else {
-							drawBasePair(g2D, newCoords[i], newCoords[j], msbp,
-									newRadius, scaleFactor);
-						}
-					}
-				}
-			}
-
-			// Liaisons additionelles (non planaires)
-			if (_conf._drawnNonPlanarBP) {
-				ArrayList<ModeleBP> bpaux = _RNA.getStructureAux();
-				for (int k = 0; k < bpaux.size(); k++) {
-					ModeleBP msbp = bpaux.get(k);
-					if (msbp.isCanonical() || _conf._drawnNonCanonicalBP) {
-						int i = msbp.getPartner5().getIndex();
-						int j = msbp.getPartner3().getIndex();
-						if (_RNA.get_drawMode() == RNA.DRAW_MODE_LINEAR) {
-							g2D.setStrokeThickness(_RNA.getBasePairThickness(
-									msbp, _conf)
-									* 2.5
-									* scaleFactor
-									* _conf._bpThickness);
-							g2D.setPlainStroke();
-						} else {
-							g2D.setStrokeThickness(_RNA.getBasePairThickness(
-									msbp, _conf) * 1.5 * scaleFactor);
-							g2D.setPlainStroke();
-						}
-
-						g2D.setColor(_RNA.getBasePairColor(msbp, _conf));
-						if (j > i) {
-							if (_RNA.get_drawMode() == RNA.DRAW_MODE_LINEAR) {
-								drawBasePairArc(g2D, i, j, newCoords[i],
-										newCoords[j], scaleFactor, msbp, newRadius);
-							} else {
-								drawBasePair(g2D, newCoords[i], newCoords[j],
-										msbp, newRadius, scaleFactor);
-							}
-						}
-					}
-				}
-			}
-
-			// Drawing bases
-			g2D.setPlainStroke();
-			for (int i = 0; i < Math.min(_RNA.get_listeBases().size(),
-					newCoords.length); i++) {
-				drawBase(g2D, i, newCoords, newCenters, newRadius, scaleFactor,
-						localView);
-			}
-
-			rnaMultiBox = new Rectangle2D.Double(offX, offY,
-					(scaleFactor * rnabbox.width) - 1,
-					(scaleFactor * rnabbox.height) - 1);
-
-			if (localView) {
-				// Drawing bbox
-				if (_debug || _drawBBox) {
-					g2D.setColor(Color.RED);
-					g2D.setSelectionStroke();
-					g2D.drawRect(rnaMultiBox.x, rnaMultiBox.y,
-							rnaMultiBox.width, rnaMultiBox.height);
-				}
-
-				// Draw color map
-				if (_conf._drawColorMap) {
-					drawColorMap(g2D, scaleFactor, rnabbox);
-				}
-
-				if (_debug || _drawBBox) {
-					g2D.setColor(Color.GRAY);
-					g2D.setSelectionStroke();
-					g2D.drawRect(0, 0, getWidth() - 1, getHeight()
-							- getTitleHeight() - 1);
-				}
-			}
-			// Draw annotations
-			renderAnnotations(g2D, offX, offY, offsetRNA.x, offsetRNA.y,
-					scaleFactor);
-			// Draw additional debug shape
-			if (_RNA._debugShape != null) {
-				Color c = new Color(255, 0, 0, 50);
-				g2D.setColor(c);
-				AffineTransform at = new AffineTransform();
-				at.translate(offX - scaleFactor * rnabbox.x, offY - scaleFactor
-						* rnabbox.y);
-				at.scale(scaleFactor, scaleFactor);
-				Shape s = at.createTransformedShape(_RNA._debugShape);
-				if (s instanceof GeneralPath) {
-					g2D.fill((GeneralPath) s);
-				}
-			}
-		} else {
-			g2D.setColor(VARNAConfig.DEFAULT_MESSAGE_COLOR);
-			g2D.setFont(VARNAConfig.DEFAULT_MESSAGE_FONT);
-			rnaMultiBox = new Rectangle2D.Double(0,0,10,10);
-			g2D.drawStringCentered("No RNA here", bbox.getCenterX(),bbox.getCenterY());
-		}
-		return rnaMultiBox;
-	}
-
-	public void centerViewOn(double x, double y) {
-		Rectangle2D.Double r = _RNA.getBBox();
-		_target = new Point2D.Double(x, y);
-		Point2D.Double q = logicToPanel(_target);
-		Point p = new Point((int) (-q.x), (int) (-q.y));
-		setTranslation(p);
-		repaint();
-	}
-
-	Point2D.Double _target = new Point2D.Double(0, 0);
-	Point2D.Double _target2 = new Point2D.Double(0, 0);
-
-	public ModeleBase getBaseAt(Point2D.Double po) {
-		ModeleBase mb = null;
-		Point2D.Double p = panelToLogicPoint(po);
-		double dist = Double.MAX_VALUE;
-		for (ModeleBase tmp : _RNA.get_listeBases()) {
-			double ndist = tmp.getCoords().distance(p);
-			if (dist > ndist) {
-				mb = tmp;
-				dist = ndist;
-			}
-		}
-		return mb;
-	}
-
-	public void setColorMapValues(Double[] values) {
-		_RNA.setColorMapValues(values, _conf._cm, true);
-		_conf._drawColorMap = true;
-		repaint();
-	}
-
-	public void setColorMapMaxValue(double d) {
-		_conf._cm.setMaxValue(d);
-	}
-
-	public void setColorMapMinValue(double d) {
-		_conf._cm.setMinValue(d);
-	}
-
-	public ModeleColorMap getColorMap() {
-		return _conf._cm;
-	}
-
-	public void setColorMap(ModeleColorMap cm) {
-		//_RNA.adaptColorMapToValues(cm);
-		_conf._cm = cm;
-		repaint();
-	}
-
-	public void setColorMapCaption(String caption) {
-		_conf._colorMapCaption = caption;
-		repaint();
-	}
-
-	public String getColorMapCaption() {
-		return _conf._colorMapCaption;
-	}
-
-	public void drawColorMap(boolean draw) {
-		_conf._drawColorMap = draw;
-	}
-
-	private double getColorMapHeight() {
-		double result = VARNAConfig.DEFAULT_COLOR_MAP_FONT_SIZE
-				+ _conf._colorMapHeight;
-		if (!_conf._colorMapCaption.equals(""))
-			result += VARNAConfig.DEFAULT_COLOR_MAP_FONT_SIZE;
-		return result;
-	}
-
-	private void drawColorMap(VueVARNAGraphics g2D, double scaleFactor,
-			Rectangle2D.Double rnabbox) {
-		double v1 = _conf._cm.getMinValue();
-		double v2 = _conf._cm.getMaxValue();
-		double x, y;
-		g2D.setPlainStroke();
-
-		double xSpaceAvail = 0;
-		double ySpaceAvail = Math
-				.min((getHeight() - rnabbox.height * scaleFactor - getTitleHeight()) / 2.0,
-						scaleFactor
-								* (_conf._colorMapHeight + VARNAConfig.DEFAULT_COLOR_MAP_FONT_SIZE));
-		if ((int) ySpaceAvail == 0) {
-			xSpaceAvail = Math.min(
-					(getWidth() - rnabbox.width * scaleFactor) / 2, scaleFactor
-							* (_conf._colorMapWidth)
-							+ VARNAConfig.DEFAULT_COLOR_MAP_STRIPE_WIDTH);
-		}
-		double xBase = (xSpaceAvail + _offX + scaleFactor
-				* (rnabbox.width - _conf._colorMapWidth - _conf._colorMapXOffset));
-		double hcaption = VARNAConfig.DEFAULT_COLOR_MAP_FONT_SIZE;
-		double yBase = (ySpaceAvail + _offY + scaleFactor
-				* (rnabbox.height - _conf._colorMapHeight
-						- _conf._colorMapYOffset - hcaption));
-
-		for (int i = 0; i < _conf._colorMapWidth; i++) {
-			double ratio = (((double) i) / ((double) _conf._colorMapWidth));
-			double val = v1 + (v2 - v1) * ratio;
-			g2D.setColor(_conf._cm.getColorForValue(val));
-			x = (xBase + scaleFactor * i);
-			y = yBase;
-			g2D.fillRect(x, y, scaleFactor
-					* VARNAConfig.DEFAULT_COLOR_MAP_STRIPE_WIDTH,
-					(scaleFactor * _conf._colorMapHeight));
-		}
-		g2D.setColor(VARNAConfig.DEFAULT_COLOR_MAP_OUTLINE);
-		g2D.drawRect(xBase, yBase,
-				(VARNAConfig.DEFAULT_COLOR_MAP_STRIPE_WIDTH - 1 + scaleFactor
-						* _conf._colorMapWidth),
-				((scaleFactor * _conf._colorMapHeight)));
-		g2D.setFont(getFont()
-				.deriveFont(
-						(float) (scaleFactor * VARNAConfig.DEFAULT_COLOR_MAP_FONT_SIZE)));
-		g2D.setColor(VARNAConfig.DEFAULT_COLOR_MAP_FONT_COLOR);
-		NumberFormat nf = NumberFormat.getInstance();
-		nf.setMaximumFractionDigits(2);
-		nf.setMinimumFractionDigits(0);
-		g2D.drawStringCentered(nf.format(_conf._cm.getMinValue()), xBase, 
-				yBase
-				+ scaleFactor * (_conf._colorMapHeight+(VARNAConfig.DEFAULT_COLOR_MAP_FONT_SIZE / 1.7)));
-		g2D.drawStringCentered(nf.format(_conf._cm.getMaxValue()), xBase
-				+ VARNAConfig.DEFAULT_COLOR_MAP_STRIPE_WIDTH + scaleFactor
-				* _conf._colorMapWidth, 
-				yBase
-				+ scaleFactor * (_conf._colorMapHeight+(VARNAConfig.DEFAULT_COLOR_MAP_FONT_SIZE / 1.7)));
-		if (!_conf._colorMapCaption.equals(""))
-			g2D.drawStringCentered(
-					"" + _conf._colorMapCaption,
-					xBase + scaleFactor * _conf._colorMapWidth / 2.0,
-					yBase
-							+ scaleFactor
-							* (VARNAConfig.DEFAULT_COLOR_MAP_FONT_SIZE / 1.7 + _conf._colorMapHeight));
-
-	}
-
-	public Point2D.Double panelToLogicPoint(Point2D.Double p) {
-		return new Point2D.Double(
-				((p.x - getOffsetPanel().x) / getScaleFactor())
-						+ getRNAOffset().x,
-				((p.y - getOffsetPanel().y) / getScaleFactor())
-						+ getRNAOffset().y);
-	}
-
-	public Point2D.Double transformCoord(Point2D.Double coordDebut,
-			double offX, double offY, double rnaBBoxX, double rnaBBoxY,
-			double scaleFactor) {
-		return new Point2D.Double(offX
-				+ (scaleFactor * (coordDebut.x - rnaBBoxX)), offY
-				+ (scaleFactor * (coordDebut.y - rnaBBoxY)));
-	}
-
-	public void eraseSequence() {
-		_RNA.eraseSequence();
-	}
-
-	public Point2D.Double transformCoord(Point2D.Double coordDebut) {
-		Rectangle2D.Double rnabbox = getExtendedRNABBox();
-		return new Point2D.Double(_offX
-				+ (getScaleFactor() * (coordDebut.x - rnabbox.x)), _offY
-				+ (getScaleFactor() * (coordDebut.y - rnabbox.y)));
-	}
-
-	public void paintComponent(Graphics g) {
-		paintComponent(g, false);
-	}
-
-	public void paintComponent(Graphics g, boolean transparentBackground) {
-		if (_premierAffichage) {
-			// _border = new Dimension(0, 0);
-			_translation.x = 0;
-			_translation.y = (int) (-getTitleHeight() / 2.0);
-			_popup.buildPopupMenu();
-			this.add(_popup);
-			_premierAffichage = false;
-		}
-
-		Graphics2D g2 = (Graphics2D) g;
-		Stroke dflt = g2.getStroke();
-		VueVARNAGraphics g2D = new SwingGraphics(g2);
-		g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING,
-				RenderingHints.VALUE_ANTIALIAS_ON);
-		this.removeAll();
-		super.paintComponent(g2);
-		renderComponent(g2D, transparentBackground, getScaleFactor());
-		if (isFocusOwner()) {
-			g2.setStroke(new BasicStroke(1.5f));
-			g2.setColor(Color.decode("#C0C0C0"));
-			g2.drawRect(0, 0, getWidth() - 1, getHeight() - 1);
-
-		}
-		g2.setStroke(dflt);
-		/*
-		 * PSExport e = new PSExport(); SecStrProducerGraphics export = new
-		 * SecStrProducerGraphics(e); renderRNA(export, getExtendedRNABBox());
-		 * try { export.saveToDisk("./out.ps"); } catch
-		 * (ExceptionWritingForbidden e1) { e1.printStackTrace(); }
-		 */
-	}
-
-	/**
-	 * Draws current RNA structure in a given Graphics "device".
-	 * 
-	 * @param g2D
-	 *            A graphical device
-	 * @param transparentBackground
-	 *            Whether the background should be transparent, or drawn.
-	 */
-	public synchronized void renderComponent(VueVARNAGraphics g2D,
-			boolean transparentBackground, double scaleFactor) {
-
-		updateTitleHeight();
-
-		if (_debug || _drawBorder) {
-			g2D.setColor(Color.BLACK);
-			g2D.setPlainStroke();
-			g2D.drawRect(getLeftOffset(), getTopOffset(), getInnerWidth(),
-					getInnerHeight());
-
-		}
-
-		
-		if (!transparentBackground) {
-			super.setBackground(_conf._backgroundColor);
-		} else {
-			super.setBackground(new Color(0, 0, 0, 120));
-		}
-
-		// BH 2018 was lt, not lteq here
-		// SwingJS sets the minimum panel size -- probably incorrectly -- to the size for VARNAPanel
-		if (getMinimumSize().height <= getSize().height
-				&& getMinimumSize().width <= getSize().width) {
-			// Draw Title
-			if (!getTitle().equals("")) {
-				g2D.setColor(_conf._titleColor);
-				g2D.setFont(_conf._titleFont);
-				g2D.drawStringCentered(getTitle(), this.getWidth() / 2,
-						this.getHeight() - getTitleHeight() / 2.0);
-			}
-			// Draw RNA
-			renderRNA(g2D, getClip(), true, _conf._autoCenter);
-		}
-		if (_selectionRectangle != null) {
-			g2D.setColor(Color.BLACK);
-			g2D.setSelectionStroke();
-			g2D.drawRect(_selectionRectangle.x, _selectionRectangle.y,
-					_selectionRectangle.width, _selectionRectangle.height);
-		}
-		if ((_linkOrigin != null) && (_linkDestination != null)) {
-			g2D.setColor(_conf._bondColor);
-			g2D.setPlainStroke();
-			g2D.setStrokeThickness(3.0 * scaleFactor);
-			Point2D.Double linkOrigin = (_linkOrigin);
-			Point2D.Double linkDestination = (_linkDestination);
-			g2D.drawLine(linkOrigin.x, linkOrigin.y, linkDestination.x,
-					linkDestination.y);
-			for (int i : getSelection().getIndices())
-				drawBase(g2D, i, _realCoords, _realCenters, scaleFactor
-						* _RNA.BASE_RADIUS, scaleFactor, true);
-		}
-
-		if (_debug) {
-			g2D.setStrokeThickness(3.0 * scaleFactor);
-			g2D.setColor(Color.black);
-			Point2D.Double t = this.logicToPanel(_target);
-			g2D.drawLine(t.x - 3, t.y - 3, t.x + 3, t.y + 3);
-			g2D.drawLine(t.x - 3, t.y + 3, t.x + 3, t.y - 3);
-			g2D.setColor(Color.red);
-			t = this.logicToPanel(_target2);
-			g2D.drawLine(t.x - 3, t.y - 3, t.x + 3, t.y + 3);
-			g2D.drawLine(t.x - 3, t.y + 3, t.x + 3, t.y - 3);
-		}
-	}
-
-	public void drawRegionHighlightsAnnotation(VueVARNAGraphics g2D,
-			Point2D.Double[] realCoords, Point2D.Double[] realCenters,
-			double scaleFactor) {
-		g2D.setStrokeThickness(2.0 * scaleFactor);
-		g2D.setPlainStroke();
-		for (HighlightRegionAnnotation r : _RNA.getHighlightRegion()) {
-			GeneralPath s = r.getShape(realCoords, realCenters, scaleFactor);
-			g2D.setColor(r.getFillColor());
-			g2D.fill(s);
-			g2D.setColor(r.getOutlineColor());
-			g2D.draw(s);
-		}
-	}
-
-	private Rectangle2D.Double getClip() {
-		return new Rectangle2D.Double(getLeftOffset(), getTopOffset(),
-				this.getInnerWidth(), this.getInnerHeight());
-	}
-
-	public Rectangle2D.Double getViewClip() {
-		return new Rectangle2D.Double(this.getLeftOffset(),
-				this.getTopOffset(), this.getInnerWidth(),
-				this.getInnerHeight());
-	}
-
-	/**
-	 * Returns the color used to draw backbone bounds.
-	 * 
-	 * @return The color used to draw backbone bounds
-	 */
-	public Color getBackboneColor() {
-		return _conf._backboneColor;
-	}
-
-	/**
-	 * Sets the color to be used for drawing backbone interactions.
-	 * 
-	 * @param backbone_color
-	 *            The new color for the backbone bounds
-	 */
-	public void setBackboneColor(Color backbone_color) {
-		_conf._backboneColor = backbone_color;
-	}
-
-	/**
-	 * Returns the color used to display hydrogen bonds (base pairings)
-	 * 
-	 * @return The color of hydrogen bonds
-	 */
-	public Color getBondColor() {
-		return _conf._bondColor;
-	}
-
-	/**
-	 * Returns the title of this panel
-	 * 
-	 * @return The title
-	 */
-	public String getTitle() {
-		return _RNA.getName();
-	}
-
-	/**
-	 * Sets the new color to be used for hydrogen bonds (base pairings)
-	 * 
-	 * @param bond_color
-	 *            The new color for hydrogen bonds
-	 */
-	public void setDefaultBPColor(Color bond_color) {
-		_conf._bondColor = bond_color;
-	}
-
-	/**
-	 * Sets the size of the border, i.e. the empty space between the end of the
-	 * drawing area and the actual border.
-	 * 
-	 * @param b
-	 *            The new border size
-	 */
-	public void setBorderSize(Dimension b) {
-		_border = b;
-	}
-
-	/**
-	 * Returns the size of the border, i.e. the empty space between the end of
-	 * the drawing area
-	 * 
-	 * @return The border size
-	 */
-	public Dimension getBorderSize() {
-		return _border;
-	}
-
-	/**
-	 * Sets the RNA to be displayed within this Panel. This method does not use
-	 * a drawing algorithm to reassigns base coordinates, rather assuming that
-	 * the RNA was previously drawn.
-	 * 
-	 * @param r
-	 *            An already drawn RNA to display in this panel
-	 */
-	public synchronized void showRNA(RNA r) {
-		fireUINewStructure(r);
-		_RNA = r;
-	}
-
-	/**
-	 * Sets the RNA secondary structure to be drawn in this panel, using the
-	 * default layout algorithm. In addition to the raw nucleotides sequence,
-	 * the secondary structure is given in the so-called "Dot-bracket notation"
-	 * (DBN) format. This format is a well-parenthesized word over the alphabet
-	 * '(',')','.'.<br/>
-	 * Ex:<code>((((((((....))))..(((((...))).))))))</code><br />
-	 * Returns <code>true</code> if the sequence/structure couple could be
-	 * parsed into a valid secondary structure, and <code>false</code>
-	 * otherwise.
-	 * 
-	 * @param seq
-	 *            The raw nucleotides sequence
-	 * @param str
-	 *            The secondary structure
-	 * @throws ExceptionNonEqualLength
-	 */
-	public void drawRNA(String seq, String str) throws ExceptionNonEqualLength {
-		drawRNA(seq, str, _RNA.get_drawMode());
-	}
-
-	/**
-	 * Sets the RNA secondary structure to be drawn in this panel, using a given
-	 * layout algorithm.
-	 * 
-	 * @param r
-	 *            The new secondary structure
-	 * @param drawMode
-	 *            The drawing algorithm
-	 */
-	public void drawRNA(RNA r, int drawMode) {
-		r.setDrawMode(drawMode);
-		drawRNA(r);
-	}
-
-	/**
-	 * Redraws the current RNA. This reassigns base coordinates to their default
-	 * value using the current drawing algorithm.
-	 */
-
-	public void drawRNA() {
-		try {
-			_RNA.drawRNA(_RNA.get_drawMode(), _conf);
-		} catch (ExceptionNAViewAlgorithm e) {
-			errorDialog(e);
-			e.printStackTrace();
-		}
-		repaint();
-	}
-
-	/**
-	 * Sets the RNA secondary structure to be drawn in this panel, using the
-	 * current drawing algorithm.
-	 * 
-	 * @param r
-	 *            The new secondary structure
-	 */
-	public void drawRNA(RNA r) {
-		if (r != null) {
-			_RNA = r;
-			drawRNA();
-		}
-	}
-
-	/**
-	 * Sets the RNA secondary structure to be drawn in this panel, using a given
-	 * layout algorithm. In addition to the raw nucleotides sequence, the
-	 * secondary structure is given in the so-called "Dot-bracket notation"
-	 * (DBN) format. This format is a well-parenthesized word over the alphabet
-	 * '(',')','.'.<br/>
-	 * Ex: <code>((((((((....))))..(((((...))).))))))</code><br />
-	 * Returns <code>true</code> if the sequence/structure couple could be
-	 * parsed into a valid secondary structure, and <code>false</code>
-	 * otherwise.
-	 * 
-	 * @param seq
-	 *            The raw nucleotides sequence
-	 * @param str
-	 *            The secondary structure
-	 * @param drawMode
-	 *            The drawing algorithm
-	 * @throws ExceptionNonEqualLength
-	 */
-	public void drawRNA(String seq, String str, int drawMode)
-			throws ExceptionNonEqualLength {
-		_RNA.setDrawMode(drawMode);
-		try {
-			_RNA.setRNA(seq, str);
-			drawRNA();
-		} catch (ExceptionUnmatchedClosingParentheses e) {
-			errorDialog(e);
-		} catch (ExceptionFileFormatOrSyntax e1) {
-			errorDialog(e1);
-		}
-	}
-
-	public void drawRNA(Reader r, int drawMode) throws ExceptionNonEqualLength,
-			ExceptionFileFormatOrSyntax {
-		_RNA.setDrawMode(drawMode);
-		Collection<RNA> rnas = RNAFactory.loadSecStr(r);
-		if (rnas.isEmpty()) {
-			throw new ExceptionFileFormatOrSyntax(
-					"No RNA could be parsed from that source.");
-		}
-		_RNA = rnas.iterator().next();
-		drawRNA();
-	}
-
-	/**
-	 * Draws a secondary structure of RNA using the default drawing algorithm
-	 * and displays it, using an interpolated transition between the previous
-	 * one and the new one. Extra bases, resulting from a size difference
-	 * between the two successive RNAs, are assumed to initiate from the middle
-	 * of the sequence. In other words, both prefixes and suffixes of the RNAs
-	 * are assumed to match, and what remains is an insertion.
-	 * 
-	 * @param seq
-	 *            Sequence
-	 * @param str
-	 *            Structure in dot bracket notation
-	 * @throws ExceptionNonEqualLength
-	 *             If len(seq)!=len(str)
-	 */
-	public void drawRNAInterpolated(String seq, String str)
-			throws ExceptionNonEqualLength {
-		drawRNAInterpolated(seq, str, _RNA.get_drawMode());
-	}
-
-	/**
-	 * Draws a secondary structure of RNA using a given algorithm and displays
-	 * it, using an interpolated transition between the previous one and the new
-	 * one. Extra bases, resulting from a size difference between the two
-	 * successive RNAs, are assumed to initiate from the middle of the sequence.
-	 * In other words, both prefixes and suffixes of the RNAs are assumed to
-	 * match, and what remains is an insertion.
-	 * 
-	 * @param seq
-	 *            Sequence
-	 * @param str
-	 *            Structure in dot bracket notation
-	 * @param drawMode
-	 *            The drawing algorithm to be used for the initial placement
-	 * @throws ExceptionNonEqualLength
-	 *             If len(seq)!=len(str)
-	 */
-	public void drawRNAInterpolated(String seq, String str, int drawMode) {
-		drawRNAInterpolated(seq, str, drawMode,
-				Mapping.DefaultOutermostMapping(_RNA.get_listeBases().size(),
-						str.length()));
-	}
-
-	/**
-	 * Draws a secondary structure of RNA using the default drawing algorithm
-	 * and displays it, using an interpolated transition between the previous
-	 * one and the new one. Here, a mapping between those bases of the new
-	 * structure and the previous one is explicitly provided.
-	 * 
-	 * @param seq
-	 *            Sequence
-	 * @param str
-	 *            Structure in dot bracket notation
-	 * @param m
-	 *            A mapping between the currently rendered structure and its
-	 *            successor (seq,str)
-	 * @throws ExceptionNonEqualLength
-	 *             If len(seq)!=len(str)
-	 */
-	public void drawRNAInterpolated(String seq, String str, Mapping m) {
-		drawRNAInterpolated(seq, str, _RNA.get_drawMode(), m);
-	}
-
-	/**
-	 * Draws a secondary structure of RNA using a given drawing algorithm and
-	 * displays it, using an interpolated transition between the previous one
-	 * and the new one. Here, a mapping between those bases of the new structure
-	 * and the previous one is provided.
-	 * 
-	 * @param seq
-	 *            Sequence
-	 * @param str
-	 *            Structure in dot bracket notation
-	 * @param drawMode
-	 *            The drawing algorithm to be used for the initial placement
-	 * @param m
-	 *            A mapping between the currently rendered structure and its
-	 *            successor (seq,str)
-	 */
-	public void drawRNAInterpolated(String seq, String str, int drawMode,
-			Mapping m) {
-		RNA target = new RNA();
-		try {
-			target.setRNA(seq, str);
-			drawRNAInterpolated(target, drawMode, m);
-		} catch (ExceptionUnmatchedClosingParentheses e) {
-			errorDialog(e);
-		} catch (ExceptionFileFormatOrSyntax e) {
-			errorDialog(e);
-		}
-	}
-
-	/**
-	 * Draws a secondary structure of RNA using the default drawing algorithm
-	 * and displays it, using an interpolated transition between the previous
-	 * one and the new one. Here, a mapping between those bases of the new
-	 * structure and the previous one is explicitly provided.
-	 * 
-	 * @param target
-	 *            Secondary structure
-	 */
-	public void drawRNAInterpolated(RNA target) {
-		drawRNAInterpolated(target, target.get_drawMode(),
-				Mapping.DefaultOutermostMapping(_RNA.get_listeBases().size(),
-						target.getSize()));
-	}
-
-	/**
-	 * Draws a secondary structure of RNA using the default drawing algorithm
-	 * and displays it, using an interpolated transition between the previous
-	 * one and the new one. Here, a mapping between those bases of the new
-	 * structure and the previous one is explicitly provided.
-	 * 
-	 * @param target
-	 *            Secondary structure
-	 * @param m
-	 *            A mapping between the currently rendered structure and its
-	 *            successor (seq,str)
-	 */
-	public void drawRNAInterpolated(RNA target, Mapping m) {
-		drawRNAInterpolated(target, target.get_drawMode(), m);
-	}
-
-	/**
-	 * Draws a secondary structure of RNA using a given drawing algorithm and
-	 * displays it, using an interpolated transition between the previous one
-	 * and the new one. Here, a mapping between those bases of the new structure
-	 * and the previous one is provided.
-	 * 
-	 * @param target
-	 *            Secondary structure of RNA
-	 * @param drawMode
-	 *            The drawing algorithm to be used for the initial placement
-	 * @param m
-	 *            A mapping between the currently rendered structure and its
-	 *            successor (seq,str)
-	 */
-	public void drawRNAInterpolated(RNA target, int drawMode, Mapping m) {
-		try {
-			target.drawRNA(drawMode, _conf);
-			_conf._drawColorMap = false;
-			_interpolator.addTarget(target, m);
-		} catch (ExceptionNAViewAlgorithm e) {
-			errorDialog(e);
-			e.printStackTrace();
-		}
-	}
-
-	/**
-	 * Returns the current algorithm used for drawing the structure
-	 * 
-	 * @return The current drawing algorithm
-	 */
-	public int getDrawMode() {
-		return this._RNA.getDrawMode();
-	}
-
-	public void showRNA(RNA t, VARNAConfig cfg) {
-		showRNA(t);
-		if (cfg != null) {
-			this.setConfig(cfg);
-		}
-		repaint();
-	}
-
-	/**
-	 * Checks whether an interpolated transition bewteen two RNAs is occurring.
-	 * 
-	 * @return True if an interpolated transition is occurring, false otherwise
-	 */
-
-	public boolean isInterpolationInProgress() {
-		if (_interpolator == null) {
-			return false;
-		} else
-			return _interpolator.isInterpolationInProgress();
-	}
-
-	/**
-	 * Simply displays (does not redraw) a secondary structure , using an
-	 * interpolated transition between the previous one and the new one. A
-	 * default mapping between those bases of the new structure and the previous
-	 * one is used.
-	 * 
-	 * @param target
-	 *            Secondary structure of RNA
-	 */
-	public void showRNAInterpolated(RNA target) {
-		showRNAInterpolated(target, Mapping.DefaultOutermostMapping(_RNA
-				.get_listeBases().size(), target.getSize()));
-	}
-
-	/**
-	 * Simply displays (does not redraw) a secondary structure , using an
-	 * interpolated transition between the previous one and the new one. Here, a
-	 * mapping between bases of the new structure and the previous one is given.
-	 * 
-	 * @param target
-	 *            Secondary structure of RNA
-	 * @param m
-	 *            A mapping between the currently rendered structure and its
-	 *            successor (seq,str)
-	 * @throws ExceptionNonEqualLength
-	 *             If len(seq)!=len(str)
-	 */
-	public void showRNAInterpolated(RNA target, Mapping m) {
-		showRNAInterpolated(target, null, m);
-	}
-
-	public void showRNAInterpolated(RNA target, VARNAConfig cfg, Mapping m) {
-		_interpolator.addTarget(target, cfg, m);
-	}
-
-	/**
-	 * When comparison mode is ON, sets the two RNA secondary structure to be
-	 * drawn in this panel, using a given layout algorithm. In addition to the
-	 * raw nucleotides sequence, the secondary structure is given in the
-	 * so-called "Dot-bracket notation" (DBN) format. This format is a
-	 * well-parenthesized word over the alphabet '(',')','.'.<br/>
-	 * Ex: <code>((((((((....))))..(((((...))).))))))</code><br />
-	 * 
-	 * @param firstSeq
-	 *            The first RNA raw nucleotides sequence
-	 * @param firstStruct
-	 *            The first RNA secondary structure
-	 * @param secondSeq
-	 *            The second RNA raw nucleotides sequence
-	 * @param secondStruct
-	 *            The second RNA secondary structure
-	 * @param drawMode
-	 *            The drawing algorithm
-	 */
-	public void drawRNA(String firstSeq, String firstStruct, String secondSeq,
-			String secondStruct, int drawMode) {
-		_RNA.setDrawMode(drawMode);
-		/**
-		 * Checking the sequences and structures validities...
-		 */
-
-		// This is a comparison, so the two RNA alignment past in parameters
-		// must
-		// have the same sequence and structure length.
-		if (firstSeq.length() == secondSeq.length()
-				&& firstStruct.length() == secondStruct.length()) {
-			// First RNA
-			if (firstSeq.length() != firstStruct.length()) {
-				if (_conf._showWarnings) {
-					emitWarning("First sequence length " + firstSeq.length()
-							+ " differs from that of it's secondary structure "
-							+ firstStruct.length()
-							+ ". \nAdapting first sequence length ...");
-				}
-				if (firstSeq.length() < firstStruct.length()) {
-					while (firstSeq.length() < firstStruct.length()) {
-						firstSeq += " ";
-					}
-				} else {
-					firstSeq = firstSeq.substring(0, firstStruct.length());
-				}
-			}
-
-			// Second RNA
-			if (secondSeq.length() != secondStruct.length()) {
-				if (_conf._showWarnings) {
-					emitWarning("Second sequence length " + secondSeq.length()
-							+ " differs from that of it's secondary structure "
-							+ secondStruct.length()
-							+ ". \nAdapting second sequence length ...");
-				}
-				if (secondSeq.length() < secondStruct.length()) {
-					while (secondSeq.length() < secondStruct.length()) {
-						secondSeq += " ";
-					}
-				} else {
-					secondSeq = secondSeq.substring(0, secondStruct.length());
-				}
-			}
-
-			int RNALength = firstSeq.length();
-			String string_superStruct = new String("");
-			String string_superSeq = new String("");
-			/**
-			 * In this array, we'll have for each indexes of each characters of
-			 * the final super-structure, the RNA number which is own it.
-			 */
-			ArrayList<Integer> array_rnaOwn = new ArrayList<Integer>();
-
-			/**
-			 * Generating super-structure sequences and structures...
-			 */
-
-			firstStruct = firstStruct.replace('-', '.');
-			secondStruct = secondStruct.replace('-', '.');
-			// First of all, we make the structure
-			for (int i = 0; i < RNALength; i++) {
-				// If both characters are the same, so it'll be in the super
-				// structure
-				if (firstStruct.charAt(i) == secondStruct.charAt(i)) {
-					string_superStruct = string_superStruct
-							+ firstStruct.charAt(i);
-					array_rnaOwn.add(0);
-				}
-				// Else if one of the characters is an opening parenthese, so
-				// it'll be an opening parenthese in the super structure
-				else if (firstStruct.charAt(i) == '('
-						|| secondStruct.charAt(i) == '(') {
-					string_superStruct = string_superStruct + '(';
-					array_rnaOwn.add((firstStruct.charAt(i) == '(') ? 1 : 2);
-				}
-				// Else if one of the characters is a closing parenthese, so
-				// it'll be a closing parenthese in the super structure
-				else if (firstStruct.charAt(i) == ')'
-						|| secondStruct.charAt(i) == ')') {
-					string_superStruct = string_superStruct + ')';
-					array_rnaOwn.add((firstStruct.charAt(i) == ')') ? 1 : 2);
-				} else {
-					string_superStruct = string_superStruct + '.';
-					array_rnaOwn.add(-1);
-				}
-			}
-
-			// Next, we make the sequence taking the characters at the same
-			// index in the first and second sequence
-			for (int i = 0; i < RNALength; i++) {
-				string_superSeq = string_superSeq + firstSeq.charAt(i)
-						+ secondSeq.charAt(i);
-			}
-
-			// Now, we need to create the super-structure RNA with the owning
-			// bases array
-			// in order to color bases outer depending on the owning statement
-			// of each bases.
-			if (!string_superSeq.equals("") && !string_superStruct.equals("")) {
-				try {
-					_RNA.setRNA(string_superSeq, string_superStruct,
-							array_rnaOwn);
-				} catch (ExceptionUnmatchedClosingParentheses e) {
-					errorDialog(e);
-				} catch (ExceptionFileFormatOrSyntax e) {
-					errorDialog(e);
-				}
-			} else {
-				emitWarning("ERROR : The super-structure is NULL.");
-			}
-
-			switch (_RNA.get_drawMode()) {
-			case RNA.DRAW_MODE_RADIATE:
-				_RNA.drawRNARadiate(_conf);
-				break;
-			case RNA.DRAW_MODE_CIRCULAR:
-				_RNA.drawRNACircle(_conf);
-				break;
-			case RNA.DRAW_MODE_LINEAR:
-				_RNA.drawRNALine(_conf);
-				break;
-			case RNA.DRAW_MODE_NAVIEW:
-				try {
-					_RNA.drawRNANAView(_conf);
-				} catch (ExceptionNAViewAlgorithm e) {
-					errorDialog(e);
-				}
-				break;
-			default:
-				break;
-			}
-
-		}
-	}
-
-	/**
-	 * Returns the currently selected base index, obtained through a mouse-left
-	 * click
-	 * 
-	 * @return Selected base
-	 * 
-	 *         public int getSelectedBaseIndex() { return _selectedBase; }
-	 * 
-	 *         /** Returns the currently selected base, obtained through a
-	 *         mouse-left click
-	 * 
-	 * @return Selected base
-	 * 
-	 *         public ModeleBase getSelectedBase() { return
-	 *         _RNA.get_listeBases().get(_selectedBase); }
-	 * 
-	 *         /** Sets the selected base index
-	 * 
-	 * @param base
-	 *            New selected base index
-	 * 
-	 *            public void setSelectedBase(int base) { _selectedBase = base;
-	 *            }
-	 */
-
-	/**
-	 * Returns the coordinates of the currently displayed RNA
-	 * 
-	 * @return Coordinates array
-	 */
-	public Point2D.Double[] getRealCoords() {
-		return _realCoords;
-	}
-
-	/**
-	 * Sets the coordinates of the currently displayed RNA
-	 * 
-	 * @param coords
-	 *            New coordinates
-	 */
-	public void setRealCoords(Point2D.Double[] coords) {
-		_realCoords = coords;
-	}
-
-	/**
-	 * Returns the popup menu used for user mouse iteractions
-	 * 
-	 * @return Popup menu
-	 */
-	public VueMenu getPopup() {
-		return _popup;
-	}
-
-	/**
-	 * Sets the color used to display hydrogen bonds (base pairings)
-	 * 
-	 * @param bond_color
-	 *            The color of hydrogen bonds
-	 */
-	public void setBondColor(Color bond_color) {
-		_conf._bondColor = bond_color;
-	}
-
-	/**
-	 * Returns the color used to draw the title
-	 * 
-	 * @return The color used to draw the title
-	 */
-	public Color getTitleColor() {
-		return _conf._titleColor;
-	}
-
-	/**
-	 * Sets the color used to draw the title
-	 * 
-	 * @param title_color
-	 *            The new color used to draw the title
-	 */
-	public void setTitleColor(Color title_color) {
-		_conf._titleColor = title_color;
-	}
-
-	/**
-	 * Returns the height taken by the title
-	 * 
-	 * @return The height taken by the title
-	 */
-	private int getTitleHeight() {
-		return _titleHeight;
-	}
-
-	/**
-	 * Sets the height taken by the title
-	 * 
-	 * @param title_height
-	 *            The height taken by the title
-	 */
-	@SuppressWarnings("unused")
-	private void setTitleHeight(int title_height) {
-		_titleHeight = title_height;
-	}
-
-	/**
-	 * Returns the current state of auto centering mode.
-	 * 
-	 * @return True if autocentered, false otherwise
-	 */
-	public boolean isAutoCentered() {
-		return _conf._autoCenter;
-	}
-
-	/**
-	 * Sets the current state of auto centering mode.
-	 * 
-	 * @param center
-	 *            New auto-centered state
-	 */
-	public void setAutoCenter(boolean center) {
-		_conf._autoCenter = center;
-	}
-
-	/**
-	 * Returns the font currently used for rendering the title.
-	 * 
-	 * @return Current title font
-	 */
-	public Font getTitleFont() {
-		return _conf._titleFont;
-	}
-
-	/**
-	 * Sets the font used for rendering the title.
-	 * 
-	 * @param font
-	 *            New title font
-	 */
-	public void setTitleFont(Font font) {
-		_conf._titleFont = font;
-		updateTitleHeight();
-	}
-
-	/**
-	 * For the LINE_MODE drawing algorithm, sets the base pair height increment,
-	 * i.e. the vertical distance between two nested arcs.
-	 * 
-	 * @return The current base pair increment
-	 */
-	public double getBPHeightIncrement() {
-		return _RNA._bpHeightIncrement;
-	}
-
-	/**
-	 * Sets the base pair height increment, i.e. the vertical distance between
-	 * two arcs to be used in LINE_MODE.
-	 * 
-	 * @param inc
-	 *            New height increment
-	 */
-	public void setBPHeightIncrement(double inc) {
-		_RNA._bpHeightIncrement = inc;
-	}
-
-	/**
-	 * Returns the shifting of the origin of the Panel in zoom mode
-	 * 
-	 * @return The logical coordinate of the top-left panel point
-	 */
-	public Point2D.Double getOffsetPanel() {
-		return _offsetPanel;
-	}
-
-	/**
-	 * Returns the vector bringing the logical coordinate of left-top-most point
-	 * in the panel to the left-top-most point of the RNA.
-	 * 
-	 * @return The logical coordinate of the top-left panel point
-	 */
-	private Point2D.Double getRNAOffset() {
-		return _offsetRNA;
-	}
-
-	/**
-	 * Returns this panel's UI menu
-	 * 
-	 * @return Applet's UI popupmenu
-	 */
-	public VueMenu getPopupMenu() {
-		return _popup;
-	}
-
-	/**
-	 * Returns the atomic zoom factor step, or increment.
-	 * 
-	 * @return Atomic zoom factor increment
-	 */
-	public double getZoomIncrement() {
-		return _conf._zoomAmount;
-	}
-
-	/**
-	 * Sets the atomic zoom factor step, or increment.
-	 * 
-	 * @param amount
-	 *            Atomic zoom factor increment
-	 */
-	public void setZoomIncrement(Object amount) {
-		setZoomIncrement(Float.valueOf(amount.toString()));
-	}
-
-	/**
-	 * Sets the atomic zoom factor step, or increment.
-	 * 
-	 * @param amount
-	 *            Atomic zoom factor increment
-	 */
-	public void setZoomIncrement(double amount) {
-		_conf._zoomAmount = amount;
-	}
-
-	/**
-	 * Returns the current zoom factor
-	 * 
-	 * @return Current zoom factor
-	 */
-	public double getZoom() {
-		return _conf._zoom;
-	}
-
-	/**
-	 * Sets the current zoom factor
-	 * 
-	 * @param _zoom
-	 *            New zoom factor
-	 */
-	public void setZoom(Object _zoom) {
-		double d = Float.valueOf(_zoom.toString());
-		if (_conf._zoom != d) {
-			_conf._zoom = d;
-			fireZoomLevelChanged(d);
-		}
-	}
-
-	/**
-	 * Returns the translation used for zooming in and out
-	 * 
-	 * @return A vector describing the translation
-	 */
-	public Point getTranslation() {
-		return _translation;
-	}
-
-	/**
-	 * Sets the translation used for zooming in and out
-	 * 
-	 * @param trans
-	 *            A vector describing the new translation
-	 */
-	public void setTranslation(Point trans) {
-		_translation = trans;
-		checkTranslation();
-		fireTranslationChanged();
-	}
-
-	/**
-	 * Returns the current RNA model
-	 * 
-	 * @return Current RNA model
-	 */
-	public RNA getRNA() {
-		return _RNA;
-	}
-
-	/**
-	 * Checks whether the drawn RNA is too large to be displayed, allowing for
-	 * shifting mouse interactions.
-	 * 
-	 * @return true if the RNA is too large to be displayed, false otherwise
-	 */
-	public boolean isOutOfFrame() {
-		return _horsCadre;
-	}
-
-	/**
-	 * Pops up an error Dialog displaying an exception in an human-readable way.
-	 * 
-	 * @param error
-	 *            The exception to display within the Dialog
-	 */
-	public void errorDialog(Exception error) {
-		errorDialog(error, this);
-	}
-
-	/**
-	 * Pops up an error Dialog displaying an exception in an human-readable way
-	 * if errors are set to be displayed.
-	 * 
-	 * @see #setErrorsOn(boolean)
-	 * @param error
-	 *            The exception to display within the Dialog
-	 * @param c
-	 *            Parent component for the dialog box
-	 */
-	public void errorDialog(Exception error, Component c) {
-		if (isErrorsOn()) {
-			JOptionPane.showMessageDialog(c, error.getMessage(), "VARNA Error",
-					JOptionPane.ERROR_MESSAGE);
-		}
-	}
-
-	/**
-	 * Pops up an error Dialog displaying an exception in an human-readable way.
-	 * 
-	 * @param error
-	 *            The exception to display within the Dialog
-	 * @param c
-	 *            Parent component for the dialog box
-	 */
-	public static void errorDialogStatic(Exception error, Component c) {
-		if (c != null) {
-			JOptionPane.showMessageDialog(c, error.getMessage(),
-					"VARNA Critical Error", JOptionPane.ERROR_MESSAGE);
-		} else {
-			System.err.println("Error: " + error.getMessage());
-		}
-	}
-
-	/**
-	 * Displays a warning message through a modal dialog if warnings are set to
-	 * be displayed.
-	 * 
-	 * @see #setShowWarnings(boolean)
-	 * @param warning
-	 *            A message expliciting the warning
-	 */
-	public void emitWarning(String warning) {
-		if (_conf._showWarnings)
-			JOptionPane.showMessageDialog(this, warning, "VARNA Warning",
-					JOptionPane.WARNING_MESSAGE);
-	}
-
-	public static void emitWarningStatic(Exception e, Component c) {
-		emitWarningStatic(e.getMessage(), c);
-	}
-
-	public static void emitWarningStatic(String warning, Component c) {
-		if (c != null) {
-			JOptionPane.showMessageDialog(c, warning, "VARNA Warning",
-					JOptionPane.WARNING_MESSAGE);
-		} else {
-			System.err.println("Error: " + warning);
-		}
-	}
-
-	/**
-	 * Toggles modifications on and off
-	 * 
-	 * @param modifiable
-	 *            Modification status
-	 */
-	public void setModifiable(boolean modifiable) {
-		_conf._modifiable = modifiable;
-	}
-
-	/**
-	 * Returns current modification status
-	 * 
-	 * @return current modification status
-	 */
-	public boolean isModifiable() {
-		return _conf._modifiable;
-	}
-
-	/**
-	 * Resets the visual aspects (Zoom factor, shift) for the Panel.
-	 */
-	public void reset() {
-		this.setBorderSize(new Dimension(0, 0));
-		this.setTranslation(new Point(0, (int) (-getTitleHeight() / 2.0)));
-		this.setZoom(VARNAConfig.DEFAULT_ZOOM);
-		this.setZoomIncrement(VARNAConfig.DEFAULT_AMOUNT);
-	}
-
-	/**
-	 * Returns the color used to draw non-standard bases
-	 * 
-	 * @return The color used to draw non-standard bases
-	 */
-	public Color getNonStandardBasesColor() {
-		return _conf._specialBasesColor;
-	}
-
-	/**
-	 * Sets the color used to draw non-standard bases
-	 * 
-	 * @param basesColor
-	 *            The color used to draw non-standard bases
-	 */
-	public void setNonStandardBasesColor(Color basesColor) {
-		_conf._specialBasesColor = basesColor;
-	}
-
-	/**
-	 * Checks if the current translation doesn't "kick" the whole RNA out of the
-	 * panel, and corrects the situation if necessary.
-	 */
-	public void checkTranslation() {
-		// verification pour un zoom < 1
-		if (this.getZoom() <= 1) {
-			// verification sortie gauche
-			if (this.getTranslation().x < -(int) ((this.getWidth() - this
-					.getInnerWidth()) / 2.0)) {
-				this.setTranslation(new Point(-(int) ((this.getWidth() - this
-						.getInnerWidth()) / 2.0), this.getTranslation().y));
-			}
-			// verification sortie droite
-			if (this.getTranslation().x > (int) ((this.getWidth() - this
-					.getInnerWidth()) / 2.0)) {
-				this.setTranslation(new Point((int) ((this.getWidth() - this
-						.getInnerWidth()) / 2.0), this.getTranslation().y));
-			}
-			// verification sortie bas
-			if (this.getTranslation().y > (int) ((this.getHeight()
-					- getTitleHeight() * 2 - this.getInnerHeight()) / 2.0)) {
-				this.setTranslation(new Point(this.getTranslation().x,
-						(int) ((this.getHeight() - getTitleHeight() * 2 - this
-								.getInnerHeight()) / 2.0)));
-			}
-			// verification sortie haut
-			if (this.getTranslation().y < -(int) ((this.getHeight() - this
-					.getInnerHeight()) / 2.0)) {
-				this.setTranslation(new Point(
-						this.getTranslation().x,
-						-(int) ((this.getHeight() - this.getInnerHeight()) / 2.0)));
-			}
-		} else {
-			// zoom > 1
-			Rectangle r2 = getZoomedInTranslationBox();
-			int LBoundX = r2.x;
-			int UBoundX = r2.x + r2.width;
-			int LBoundY = r2.y;
-			int UBoundY = r2.y + r2.height;
-			if (this.getTranslation().x < LBoundX) {
-				this.setTranslation(new Point(LBoundX, getTranslation().y));
-			} else if (this.getTranslation().x > UBoundX) {
-				this.setTranslation(new Point(UBoundX, getTranslation().y));
-			}
-			if (this.getTranslation().y < LBoundY) {
-				this.setTranslation(new Point(getTranslation().x, LBoundY));
-			} else if (this.getTranslation().y > UBoundY) {
-				this.setTranslation(new Point(getTranslation().x, UBoundY));
-			}
-		}
-	}
-
-	public Rectangle getZoomedInTranslationBox() {
-		int LBoundX = -(int) ((this.getInnerWidth()) / 2.0);
-		int UBoundX = (int) ((this.getInnerWidth()) / 2.0);
-		int LBoundY = -(int) ((this.getInnerHeight()) / 2.0);
-		int UBoundY = (int) ((this.getInnerHeight()) / 2.0);
-		return new Rectangle(LBoundX, LBoundY, UBoundX - LBoundX, UBoundY
-				- LBoundY);
-
-	}
-
-	/**
-	 * Returns the "real pixels" x-coordinate of the RNA.
-	 * 
-	 * @return X-coordinate of the translation
-	 */
-	public int getLeftOffset() {
-		return _border.width
-				+ ((this.getWidth() - 2 * _border.width) - this.getInnerWidth())
-				/ 2 + _translation.x;
-	}
-
-	/**
-	 * Returns the "real pixels" width of the drawing surface for our RNA.
-	 * 
-	 * @return Width of the drawing surface for our RNA
-	 */
-	public int getInnerWidth() {
-		// Largeur du dessin
-		return (int) Math.round((this.getWidth() - 2 * _border.width)
-				* _conf._zoom);
-	}
-
-	/**
-	 * Returns the "real pixels" y-coordinate of the RNA.
-	 * 
-	 * @return Y-coordinate of the translation
-	 */
-	public int getTopOffset() {
-		return _border.height
-				+ ((this.getHeight() - 2 * _border.height) - this
-						.getInnerHeight()) / 2 + _translation.y;
-	}
-
-	/**
-	 * Returns the "real pixels" height of the drawing surface for our RNA.
-	 * 
-	 * @return Height of the drawing surface for our RNA
-	 */
-	public int getInnerHeight() {
-		// Hauteur du dessin
-		return (int) Math.round((this.getHeight()) * _conf._zoom - 2
-				* _border.height - getTitleHeight());
-	}
-
-	/**
-	 * Checks if the current mode is the "comparison" mode
-	 * 
-	 * @return True if comparison, false otherwise
-	 */
-	public boolean isComparisonMode() {
-		return _conf._comparisonMode;
-	}
-
-	/**
-	 * Rotates the RNA coordinates by a certain angle
-	 * 
-	 * @param angleDegres
-	 *            Rotation angle, in degrees
-	 */
-	public void globalRotation(Double angleDegres) {
-		_RNA.globalRotation(angleDegres);
-		fireLayoutChanged();
-		repaint();
-	}
-
-	/**
-	 * Returns the index of the currently selected base, defaulting to the
-	 * closest base to the last mouse-click.
-	 * 
-	 * @return Index of the currently selected base
-	 */
-	public Integer getNearestBase() {
-		return _nearestBase;
-	}
-
-	/**
-	 * Sets the index of the currently selected base.
-	 * 
-	 * @param base
-	 *            Index of the new selected base
-	 */
-	public void setNearestBase(Integer base) {
-		_nearestBase = base;
-	}
-
-	/**
-	 * Returns the color used to draw 'Gaps' bases in comparison mode
-	 * 
-	 * @return Color used for 'Gaps'
-	 */
-	public Color getGapsBasesColor() {
-		return _conf._dashBasesColor;
-	}
-
-	/**
-	 * Sets the color to use for 'Gaps' bases in comparison mode
-	 * 
-	 * @param c
-	 *            Color used for 'Gaps'
-	 */
-	public void setGapsBasesColor(Color c) {
-		_conf._dashBasesColor = c;
-	}
-
-	@SuppressWarnings("unused")
-	private void imprimer() {
-		// PrintPanel canvas;
-		// canvas = new PrintPanel();
-		PrintRequestAttributeSet attributes;
-		attributes = new HashPrintRequestAttributeSet();
-		try {
-			PrinterJob job = PrinterJob.getPrinterJob();
-			// job.setPrintable(this);
-			if (job.printDialog(attributes)) {
-				job.print(attributes);
-			}
-		} catch (PrinterException exception) {
-			errorDialog(exception);
-		}
-	}
-
-	/**
-	 * Checks whether errors are to be displayed
-	 * 
-	 * @return Error display status
-	 */
-	public boolean isErrorsOn() {
-		return _conf._errorsOn;
-	}
-
-	/**
-	 * Sets whether errors are to be displayed
-	 * 
-	 * @param on
-	 *            New error display status
-	 */
-	public void setErrorsOn(boolean on) {
-		_conf._errorsOn = on;
-	}
-
-	/**
-	 * Returns the view associated with user interactions
-	 * 
-	 * @return A view associated with user interactions
-	 */
-	public VueUI getVARNAUI() {
-		return _UI;
-	}
-
-	/**
-	 * Toggles on/off using base inner color for drawing base-pairs
-	 * 
-	 * @param on
-	 *            True for using base inner color for drawing base-pairs, false
-	 *            for classic mode
-	 */
-	public void setUseBaseColorsForBPs(boolean on) {
-		_conf._useBaseColorsForBPs = on;
-	}
-
-	/**
-	 * Returns true if current base color is used as inner color for drawing
-	 * base-pairs
-	 * 
-	 * @return True for using base inner color for drawing base-pairs, false for
-	 *         classic mode
-	 */
-	public boolean getUseBaseColorsForBPs() {
-		return _conf._useBaseColorsForBPs;
-	}
-
-	/**
-	 * Toggles on/off using a special color used for drawing "non-standard"
-	 * bases
-	 * 
-	 * @param on
-	 *            True for using a special color used for drawing "non-standard"
-	 *            bases, false for classic mode
-	 */
-	public void setColorNonStandardBases(boolean on) {
-		_conf._colorSpecialBases = on;
-	}
-
-	/**
-	 * Returns true if a special color is used as inner color for non-standard
-	 * base
-	 * 
-	 * @return True for using a special color used for drawing "non-standard"
-	 *         bases, false for classic mode
-	 */
-	public boolean getColorSpecialBases() {
-		return _conf._colorSpecialBases;
-	}
-
-	/**
-	 * Toggles on/off using a special color used for drawing "Gaps" bases in
-	 * comparison mode
-	 * 
-	 * @param on
-	 *            True for using a special color used for drawing "Gaps" bases
-	 *            in comparison mode, false for classic mode
-	 */
-	public void setColorGapsBases(boolean on) {
-		_conf._colorDashBases = on;
-	}
-
-	/**
-	 * Returns true if a special color is used for drawing "Gaps" bases in
-	 * comparison mode
-	 * 
-	 * @return True for using a special color used for drawing "Gaps" bases in
-	 *         comparison mode, false for classic mode
-	 */
-	public boolean getColorGapsBases() {
-		return _conf._colorDashBases;
-	}
-
-	/**
-	 * Toggles on/off displaying warnings
-	 * 
-	 * @param on
-	 *            True to display warnings, false otherwise
-	 */
-	public void setShowWarnings(boolean on) {
-		_conf._showWarnings = on;
-	}
-
-	/**
-	 * Get current warning display status
-	 * 
-	 * @return True to display warnings, false otherwise
-	 */
-	public boolean getShowWarnings() {
-		return _conf._showWarnings;
-	}
-
-	/**
-	 * Toggles on/off displaying non-canonical base-pairs
-	 * 
-	 * @param on
-	 *            True to display NC base-pairs, false otherwise
-	 */
-	public void setShowNonCanonicalBP(boolean on) {
-		_conf._drawnNonCanonicalBP = on;
-	}
-
-	/**
-	 * Return the current display status for non-canonical base-pairs
-	 * 
-	 * @return True if NC base-pairs are displayed, false otherwise
-	 */
-	public boolean getShowNonCanonicalBP() {
-		return _conf._drawnNonCanonicalBP;
-	}
-
-	/**
-	 * Toggles on/off displaying "non-planar" base-pairs
-	 * 
-	 * @param on
-	 *            True to display "non-planar" base-pairs, false otherwise
-	 */
-	public void setShowNonPlanarBP(boolean on) {
-		_conf._drawnNonPlanarBP = on;
-	}
-
-	/**
-	 * Return the current display status for non-planar base-pairs
-	 * 
-	 * @return True if non-planars base-pairs are displayed, false otherwise
-	 */
-	public boolean getShowNonPlanarBP() {
-		return _conf._drawnNonPlanarBP;
-	}
-
-	/**
-	 * Sets the base-pair representation style
-	 * 
-	 * @param st
-	 *            The new base-pair style
-	 */
-	public void setBPStyle(VARNAConfig.BP_STYLE st) {
-		_conf._mainBPStyle = st;
-	}
-
-	/**
-	 * Returns the base-pair representation style
-	 * 
-	 * @return The current base-pair style
-	 */
-	public VARNAConfig.BP_STYLE getBPStyle() {
-		return _conf._mainBPStyle;
-	}
-
-	/**
-	 * Returns the current VARNA Panel configuration. The returned instance
-	 * should not be modified directly, but rather through the getters/setters
-	 * from the VARNAPanel class.
-	 * 
-	 * @return Current configuration
-	 */
-	public VARNAConfig getConfig() {
-		return _conf;
-	}
-
-	/**
-	 * Sets the background color
-	 * 
-	 * @param c
-	 *            New background color
-	 */
-	public void setBackground(Color c) {
-		if (_conf != null) {
-			if (c != null) {
-				_conf._backgroundColor = c;
-				_conf._drawBackground = (!c
-						.equals(VARNAConfig.DEFAULT_BACKGROUND_COLOR));
-			} else {
-				_conf._backgroundColor = VARNAConfig.DEFAULT_BACKGROUND_COLOR;
-				_conf._drawBackground = false;
-			}
-		}
-
-	}
-
-	/**
-	 * Starts highlighting the selected base.
-	 */
-	public void highlightSelectedBase(ModeleBase m) {
-		ArrayList<Integer> v = new ArrayList<Integer>();
-		int sel = m.getIndex();
-		if (sel != -1) {
-			v.add(sel);
-		}
-		setSelection(v);
-	}
-
-	/**
-	 * Starts highlighting the selected base.
-	 */
-	public void highlightSelectedStem(ModeleBase m) {
-		ArrayList<Integer> v = new ArrayList<Integer>();
-		int sel = m.getIndex();
-		if (sel != -1) {
-			ArrayList<Integer> r = _RNA.findStem(sel);
-			v.addAll(r);
-		}
-		setSelection(v);
-	}
-
-	public BaseList getSelection() {
-		return _selectedBases;
-	}
-
-	public ArrayList<Integer> getSelectionIndices() {
-		return _selectedBases.getIndices();
-	}
-
-	public void setSelection(ArrayList<Integer> indices) {
-		setSelection(_RNA.getBasesAt(indices));
-	}
-
-	public void setSelection(Collection<? extends ModeleBase> mbs) {
-		BaseList bck = new BaseList(_selectedBases);
-		_selectedBases.clear();
-		_selectedBases.addBases(mbs);
-		_blink.setActive(true);
-		fireSelectionChanged(bck, _selectedBases);
-	}
-
-	public ArrayList<Integer> getBasesInRectangleDiff(Rectangle recIn,
-			Rectangle recOut) {
-		ArrayList<Integer> result = new ArrayList<Integer>();
-		for (int i = 0; i < _realCoords.length; i++) {
-			if (recIn.contains(_realCoords[i])
-					^ recOut.contains(_realCoords[i]))
-				result.add(i);
-		}
-		return result;
-	}
-
-	public ArrayList<Integer> getBasesInRectangle(Rectangle rec) {
-		ArrayList<Integer> result = new ArrayList<Integer>();
-		for (int i = 0; i < _realCoords.length; i++) {
-			if (rec.contains(_realCoords[i]))
-				result.add(i);
-		}
-		return result;
-	}
-
-	public void setSelectionRectangle(Rectangle rec) {
-		ArrayList<Integer> result = new ArrayList<Integer>();
-		if (_selectionRectangle != null) {
-			result = getBasesInRectangleDiff(_selectionRectangle, rec);
-		} else {
-			result = getBasesInRectangle(rec);
-		}
-		_selectionRectangle = new Rectangle(rec);
-		toggleSelection(result);
-		repaint();
-	}
-
-	public void removeSelectionRectangle() {
-		_selectionRectangle = null;
-	}
-
-	public void addToSelection(Collection<? extends Integer> indices) {
-		for (int i : indices) {
-			addToSelection(i);
-		}
-	}
-
-	public void addToSelection(int i) {
-		BaseList bck = new BaseList(_selectedBases);
-		ModeleBase mb = _RNA.getBaseAt(i);
-		_selectedBases.addBase(mb);
-		_blink.setActive(true);
-		fireSelectionChanged(bck, _selectedBases);
-	}
-
-	public void removeFromSelection(int i) {
-		BaseList bck = new BaseList(_selectedBases);
-		ModeleBase mb = _RNA.getBaseAt(i);
-		_selectedBases.removeBase(mb);
-		if (_selectedBases.size() == 0) {
-			_blink.setActive(false);
-		} else {
-			_blink.setActive(true);
-		}
-		fireSelectionChanged(bck, _selectedBases);
-	}
-
-	public boolean isInSelection(int i) {
-		return _selectedBases.contains(_RNA.getBaseAt(i));
-	}
-
-	public void toggleSelection(int i) {
-		if (isInSelection(i))
-			removeFromSelection(i);
-		else
-			addToSelection(i);
-	}
-
-	public void toggleSelection(Collection<? extends Integer> indices) {
-		for (int i : indices) {
-			toggleSelection(i);
-		}
-	}
-
-	/**
-	 * Stops highlighting bases
-	 */
-	public void clearSelection() {
-		BaseList bck = new BaseList(_selectedBases);
-		_selectedBases.clear();
-		_blink.setActive(false);
-		repaint();
-		fireSelectionChanged(bck, _selectedBases);
-	}
-
-	public void saveSelection() {
-		_backupSelection.clear();
-		_backupSelection.addAll(_selectedBases.getBases());
-	}
-
-	public void restoreSelection() {
-		setSelection(_backupSelection);
-	}
-
-	/**
-	 * Stops highlighting bases
-	 */
-	public void resetAnnotationHighlight() {
-		_highlightAnnotation = false;
-		repaint();
-	}
-
-	/**
-	 * Toggles on/off a rectangular outline of the bounding box.
-	 * 
-	 * @param on
-	 *            True to draw the bounding box, false otherwise
-	 */
-	public void drawBBox(boolean on) {
-		_drawBBox = on;
-	}
-
-	/**
-	 * Toggles on/off a rectangular outline of the border.
-	 * 
-	 * @param on
-	 *            True to draw the bounding box, false otherwise
-	 */
-	public void drawBorder(boolean on) {
-		_drawBorder = on;
-	}
-
-	public void setBaseInnerColor(Color c) {
-		_RNA.setBaseInnerColor(c);
-	}
-
-	public void setBaseNumbersColor(Color c) {
-		_RNA.setBaseNumbersColor(c);
-	}
-
-	public void setBaseNameColor(Color c) {
-		_RNA.setBaseNameColor(c);
-	}
-
-	public void setBaseOutlineColor(Color c) {
-		_RNA.setBaseOutlineColor(c);
-	}
-
-	public ArrayList<TextAnnotation> getListeAnnotations() {
-		return _RNA.getAnnotations();
-	}
-
-	public void resetListeAnnotations() {
-		_RNA.clearAnnotations();
-		repaint();
-	}
-
-	public void addAnnotation(TextAnnotation textAnnotation) {
-		_RNA.addAnnotation(textAnnotation);
-		repaint();
-	}
-
-	public boolean removeAnnotation(TextAnnotation textAnnotation) {
-		boolean done = _RNA.removeAnnotation(textAnnotation);
-		repaint();
-		return done;
-	}
-
-	public TextAnnotation get_selectedAnnotation() {
-		return _selectedAnnotation;
-	}
-
-	public void set_selectedAnnotation(TextAnnotation annotation) {
-		_selectedAnnotation = annotation;
-	}
-
-	public void removeSelectedAnnotation() {
-		_highlightAnnotation = false;
-		_selectedAnnotation = null;
-	}
-
-	public void highlightSelectedAnnotation() {
-		_highlightAnnotation = true;
-	}
-
-	public boolean getFlatExteriorLoop() {
-		return _conf._flatExteriorLoop;
-	}
-
-	public void setFlatExteriorLoop(boolean on) {
-		_conf._flatExteriorLoop = on;
-	}
-
-	public void setLastSelectedPosition(Point2D.Double p) {
-		_lastSelectedCoord.x = p.x;
-		_lastSelectedCoord.y = p.y;
-	}
-
-	public Point2D.Double getLastSelectedPosition() {
-		return _lastSelectedCoord;
-	}
-
-	public void setSequence(String s) {
-		_RNA.setSequence(s);
-		repaint();
-	}
-
-	public void setColorMapVisible(boolean b) {
-		_conf._drawColorMap = b;
-		repaint();
-	}
-
-	public boolean getColorMapVisible() {
-		return _conf._drawColorMap;
-	}
-
-	public void removeColorMap() {
-		_conf._drawColorMap = false;
-		repaint();
-	}
-
-	public void saveSession(String path) {
-		/*
-		 * FileOutputStream fos = null; ObjectOutputStream out = null; try { fos
-		 * = new FileOutputStream(path); out = new ObjectOutputStream(fos);
-		 * out.writeObject(new FullBackup(_conf, _RNA, _conf._title));
-		 * out.close(); } catch (Exception ex) { ex.printStackTrace(); }
-		 */
-		toXML(path);
-	}
-
-        public FullBackup loadSession(String path) throws ExceptionLoadingFailed { 
-          return loadSession(new File(path));
+public class VARNAPanel extends JPanel implements PropertyChangeListener
+{
+
+  /**
+   * SwingJS uses a PropertyChangeEvent to signal that a pseudo-modal dialog has
+   * been closed.
+   * 
+   * @param event
+   */
+  @Override
+  public void propertyChange(PropertyChangeEvent event)
+  {
+    Object val = event.getNewValue();
+    switch (event.getPropertyName())
+    {
+    case "value":
+      _UI.onDialogReturn(val == null ? JOptionPane.CLOSED_OPTION
+              : ((Integer) val).intValue());
+      return;
+    case "SelectedFile":
+    case "SelectedColor":
+    case "inputValue":
+      _UI.onDialogReturn(val);
+      break;
+    }
+  }
+
+  private static final long serialVersionUID = 8194421570308956001L;
+
+  private RNA _RNA = new RNA();
+
+  private boolean _debug = false;
+
+  private VARNAConfig _conf = new VARNAConfig();
+
+  private ArrayList<InterfaceVARNAListener> _VARNAListeners = new ArrayList<InterfaceVARNAListener>();
+
+  private ArrayList<InterfaceVARNASelectionListener> _selectionListeners = new ArrayList<InterfaceVARNASelectionListener>();
+
+  private ArrayList<InterfaceVARNARNAListener> _RNAListeners = new ArrayList<InterfaceVARNARNAListener>();
+
+  private ArrayList<InterfaceVARNABasesListener> _basesListeners = new ArrayList<InterfaceVARNABasesListener>();
+
+  UndoManager _manager;
+
+  // private boolean _foldMode = true;
+
+  private Point2D.Double[] _realCoords = new Point2D.Double[0];
+
+  private Point2D.Double[] _realCenters = new Point2D.Double[0];
+
+  private double _scaleFactor = 1.0;
+
+  private Point2D.Double _offsetPanel = new Point2D.Double();
+
+  private Point2D.Double _offsetRNA = new Point2D.Double();
+
+  private double _offX;
+
+  private double _offY;
+
+  private ControleurBlinkingThread _blink;
+
+  private BaseList _selectedBases = new BaseList("selection");
+
+  private ArrayList<ModeleBase> _backupSelection = new ArrayList<ModeleBase>();
+
+  private Integer _nearestBase = null;
+
+  private Point2D.Double _lastSelectedCoord = new Point2D.Double(0.0, 0.0);
+
+  private Point2D.Double _linkOrigin = null;
+
+  private Point2D.Double _linkDestination = null;
+
+  private Rectangle _selectionRectangle = null;
+
+  private boolean _highlightAnnotation = false;
+
+  private int _titleHeight;
+
+  // BH SwingJS issue here is that we are using _border already. Hmm.
+  private Dimension _border = new Dimension(0, 0);
+
+  private boolean _drawBBox = false;
+
+  private boolean _drawBorder = false;
+
+  // private Point _positionRelativeSouris;
+  private Point _translation;
+
+  private boolean _horsCadre;
+
+  private boolean _premierAffichage;
+
+  private ControleurInterpolator _interpolator;
+
+  /**
+   * If comparison mode is TRUE (ON), then the application will be used to
+   * display a super-structure resulting on an RNA secondary structure
+   * comparison. Else, the application is used by default.
+   */
+
+  private VueMenu _popup = new VueMenu(this);
+
+  private VueUI _UI = new VueUI(this);
+
+  private TextAnnotation _selectedAnnotation;
+
+  /**
+   * Creates an RNA 2D panel with initially displays the empty structure.
+   * 
+   * @throws ExceptionNonEqualLength
+   * 
+   */
+  public VARNAPanel()
+  {
+    init();
+    drawRNA();
+  }
+
+  /**
+   * Creates an RNA 2D panel, and creates and displays an RNA coupled with its
+   * secondary structure formatted as a well-balanced parenthesis with dots word
+   * (DBN format).
+   * 
+   * @param seq
+   *          The raw nucleotide sequence
+   * @param str
+   *          The secondary structure in DBN format
+   * @throws ExceptionNonEqualLength
+   */
+
+  public VARNAPanel(String seq, String str) throws ExceptionNonEqualLength
+  {
+    this(seq, str, RNA.DRAW_MODE_RADIATE);
+  }
+
+  /**
+   * Creates a VARNAPanel instance, and creates and displays an RNA coupled with
+   * its secondary structure formatted as a well-balanced parenthesis with dots
+   * word (DBN format). Allows the user to choose the drawing algorithm to be
+   * used.
+   * 
+   * @param seq
+   *          The raw nucleotide sequence
+   * @param str
+   *          The secondary structure in DBN format
+   * @param drawMode
+   *          The drawing mode
+   * @throws ExceptionNonEqualLength
+   * @see RNA#DRAW_MODE_RADIATE
+   * @see RNA#DRAW_MODE_CIRCULAR
+   * @see RNA#DRAW_MODE_NAVIEW
+   */
+  public VARNAPanel(String seq, String str, int drawMode)
+          throws ExceptionNonEqualLength
+  {
+    this(seq, str, drawMode, "");
+  }
+
+  public VARNAPanel(Reader r)
+          throws ExceptionNonEqualLength, ExceptionFileFormatOrSyntax
+  {
+    this(r, RNA.DRAW_MODE_RADIATE);
+  }
+
+  public VARNAPanel(Reader r, int drawMode)
+          throws ExceptionNonEqualLength, ExceptionFileFormatOrSyntax
+  {
+    this(r, drawMode, "");
+  }
+
+  public VARNAPanel(Reader r, int drawMode, String title)
+          throws ExceptionNonEqualLength, ExceptionFileFormatOrSyntax
+  {
+    init();
+    drawRNA(r, drawMode);
+    setTitle(title);
+  }
+
+  public void setOriginLink(Point2D.Double p)
+  {
+    _linkOrigin = (p);
+  }
+
+  public void setDestinationLink(Point2D.Double p)
+  {
+    _linkDestination = (p);
+  }
+
+  public void removeLink()
+  {
+    _linkOrigin = null;
+    _linkDestination = null;
+  }
+
+  /**
+   * Creates a VARNAPanel instance, and displays an RNA.
+   * 
+   * @param r
+   *          The RNA to be displayed within this panel
+   */
+
+  public VARNAPanel(RNA r)
+  {
+    showRNA(r);
+    init();
+  }
+
+  /**
+   * Creates a VARNAPanel instance, and creates and displays an RNA coupled with
+   * its secondary structure formatted as a well-balanced parenthesis with dots
+   * word (DBN format). Allows the user to choose the drawing algorithm to be
+   * used. Additionally, sets the panel's title.
+   * 
+   * @param seq
+   *          The raw nucleotide sequence
+   * @param str
+   *          The secondary structure in DBN format
+   * @param drawMode
+   *          The drawing mode
+   * @param title
+   *          The panel title
+   * @throws ExceptionNonEqualLength
+   * @see RNA#DRAW_MODE_CIRCULAR
+   * @see RNA#DRAW_MODE_RADIATE
+   * @see RNA#DRAW_MODE_NAVIEW
+   */
+
+  public VARNAPanel(String seq, String str, int drawMode, String title)
+          throws ExceptionNonEqualLength
+  {
+    drawRNA(seq, str, drawMode);
+    init();
+    setTitle(title);
+    // VARNASecDraw._vp = this;
+  }
+
+  public VARNAPanel(String seq1, String struct1, String seq2,
+          String struct2, int drawMode, String title)
+  {
+    _conf._comparisonMode = true;
+    drawRNA(seq1, struct1, seq2, struct2, drawMode);
+    init();
+    setTitle(title);
+  }
+
+  private void init()
+  {
+    _popup.buildPopupMenu();
+    this.add(_popup);
+    setBackground(VARNAConfig.DEFAULT_BACKGROUND_COLOR);
+    _manager = new UndoManager();
+    _manager.setLimit(10000);
+    _UI.addUndoableEditListener(_manager);
+
+    _blink = new ControleurBlinkingThread(this,
+            ControleurBlinkingThread.DEFAULT_FREQUENCY, 0, 1.0, 0.0, 0.2);
+    _blink.start();
+
+    _premierAffichage = true;
+    _translation = new Point(0, 0);
+
+    _horsCadre = false;
+    this.setFont(_conf._fontBasesGeneral);
+
+    // ajout des controleurs au VARNAPanel
+    ControleurClicMovement controleurClicMovement = new ControleurClicMovement(
+            this);
+    this.addMouseListener(controleurClicMovement);
+    this.addMouseMotionListener(controleurClicMovement);
+    this.addMouseWheelListener(new ControleurMolette(this));
+
+    ControleurDraggedMolette ctrlDraggedMolette = new ControleurDraggedMolette(
+            this);
+    this.addMouseMotionListener(ctrlDraggedMolette);
+    this.addMouseListener(ctrlDraggedMolette);
+
+    ControleurVARNAPanelKeys ctrlKey = new ControleurVARNAPanelKeys(this);
+    this.addKeyListener(ctrlKey);
+    this.addFocusListener(ctrlKey);
+
+    _interpolator = new ControleurInterpolator(this);
+    /**
+     * 
+     * BH SwingJS do not start this thread
+     * 
+     * @j2sNative
+     */
+    {
+      _interpolator.start();
+    }
+
+  }
+
+  public void undo()
+  {
+    if (_manager.canUndo())
+      _manager.undo();
+  }
+
+  public void redo()
+  {
+    if (_manager.canRedo())
+      _manager.redo();
+  }
+
+  /**
+   * Sets the new style of the title font.
+   * 
+   * @param newStyle
+   *          An int that describes the new font style ("PLAIN","BOLD",
+   *          "BOLDITALIC", or "ITALIC")
+   */
+  public void setTitleFontStyle(int newStyle)
+  {
+    _conf._titleFont = _conf._titleFont.deriveFont(newStyle);
+    updateTitleHeight();
+  }
+
+  /**
+   * Sets the new size of the title font.
+   * 
+   * @param newSize
+   *          The new size of the title font
+   */
+  public void setTitleFontSize(float newSize)
+  {
+    // System.err.println("Applying title size "+newSize);
+    _conf._titleFont = _conf._titleFont.deriveFont(newSize);
+    updateTitleHeight();
+  }
+
+  /**
+   * Sets the new font family to be used for the title. Available fonts are
+   * system-specific, yet it seems that "Arial", "Dialog", and "MonoSpaced" are
+   * almost always available.
+   * 
+   * @param newFamily
+   *          New font family used for the title
+   */
+  public void setTitleFontFamily(String newFamily)
+  {
+    _conf._titleFont = new Font(newFamily, _conf._titleFont.getStyle(),
+            _conf._titleFont.getSize());
+    updateTitleHeight();
+  }
+
+  /**
+   * Sets the color to be used for the title.
+   * 
+   * @param newColor
+   *          A color used to draw the title
+   */
+  public void setTitleFontColor(Color newColor)
+  {
+    _conf._titleColor = newColor;
+    updateTitleHeight();
+  }
+
+  /**
+   * Sets the font size for displaying bases
+   * 
+   * @param size
+   *          Font size for base caption
+   */
+
+  public void setBaseFontSize(Float size)
+  {
+    _conf._fontBasesGeneral = _conf._fontBasesGeneral.deriveFont(size);
+  }
+
+  /**
+   * Sets the font size for displaying base numbers
+   * 
+   * @param size
+   *          Font size for base numbers
+   */
+
+  public void setNumbersFontSize(Float size)
+  {
+    _conf._numbersFont = _conf._numbersFont.deriveFont(size);
+  }
+
+  /**
+   * Sets the font style for displaying bases
+   * 
+   * @param style
+   *          An int that describes the new font style ("PLAIN","BOLD",
+   *          "BOLDITALIC", or "ITALIC")
+   */
+
+  public void setBaseFontStyle(int style)
+  {
+    _conf._fontBasesGeneral = _conf._fontBasesGeneral.deriveFont(style);
+  }
+
+  private void updateTitleHeight()
+  {
+    if (!getTitle().equals(""))
+    {
+      _titleHeight = (int) (_conf._titleFont.getSize() * 1.5);
+    }
+    else
+    {
+      _titleHeight = 0;
+    }
+    if (Math.abs(this.getZoom() - 1) < .02)
+    {
+      _translation.y = (int) (-getTitleHeight() / 2.0);
+    }
+  }
+
+  /**
+   * Sets the panel's title, giving a short description of the RNA secondary
+   * structure.
+   * 
+   * @param title
+   *          The new title
+   */
+  public void setTitle(String title)
+  {
+    _RNA.setName(title);
+    updateTitleHeight();
+  }
+
+  /**
+   * Sets the distance between consecutive base numbers. Please notice that :
+   * <ul>
+   * <li>The first and last base are always numbered</li>
+   * <li>The numbering is based on the base numbers, not on the indices. So base
+   * numbers may appear more frequently than expected if bases are skipped</li>
+   * <li>The periodicity is measured starting from 0. This means that for a
+   * period of 10 and bases numbered from 1 to 52, the base numbers
+   * [1,10,20,30,40,50,52] will be drawn.</li>
+   * </ul>
+   * 
+   * @param n
+   *          New numbering period
+   */
+  public void setNumPeriod(int n)
+  {
+    _conf._numPeriod = n;
+  }
+
+  /**
+   * Returns the current numbering period. Please notice that :
+   * <ul>
+   * <li>The first and last base are always numbered</li>
+   * <li>The numbering is based on the base numbers, not on the indices. So base
+   * numbers may appear more frequently than expected if bases are skipped</li>
+   * <li>The periodicity is measured starting from 0. This means that for a
+   * period of 10 and bases numbered from 1 to 52, the base numbers
+   * [1,10,20,30,40,50,52] will be drawn.</li>
+   * </ul>
+   * 
+   * @return Current numbering period
+   */
+  public int getNumPeriod()
+  {
+    return _conf._numPeriod;
+  }
+
+  private void setScaleFactor(double d)
+  {
+    _scaleFactor = d;
+  }
+
+  private double getScaleFactor()
+  {
+    return _scaleFactor;
+  }
+
+  private void setAutoFit(boolean fit)
+  {
+    _conf._autoFit = fit;
+    repaint();
+  }
+
+  public void lockScrolling()
+  {
+    setAutoFit(false);
+    setAutoCenter(false);
+  }
+
+  public void unlockScrolling()
+  {
+    setAutoFit(true);
+    setAutoCenter(true);
+  }
+
+  private void drawStringOutline(VueVARNAGraphics g2D, String res, double x,
+          double y, double margin)
+  {
+    Dimension d = g2D.getStringDimension(res);
+    x -= (double) d.width / 2.0;
+    y += (double) d.height / 2.0;
+    g2D.setColor(Color.GRAY);
+    g2D.setSelectionStroke();
+    g2D.drawRect((x - margin), (y - d.height - margin),
+            (d.width + 2.0 * margin), (d.height + 2.0 * margin));
+  }
+
+  private void drawSymbol(VueVARNAGraphics g2D, double posx, double posy,
+          double normx, double normy, double radius, boolean isCIS,
+          ModeleBP.Edge e)
+  {
+    Color bck = g2D.getColor();
+    switch (e)
+    {
+    case WC:
+      if (isCIS)
+      {
+        g2D.setColor(bck);
+        g2D.fillCircle((posx - (radius) / 2.0), (posy - (radius) / 2.0),
+                radius);
+        g2D.drawCircle((posx - (radius) / 2.0), (posy - (radius) / 2.0),
+                radius);
+      }
+      else
+      {
+        g2D.setColor(Color.white);
+        g2D.fillCircle(posx - (radius) / 2.0, (posy - (radius) / 2.0),
+                (radius));
+        g2D.setColor(bck);
+        g2D.drawCircle((posx - (radius) / 2.0), (posy - (radius) / 2.0),
+                (radius));
+      }
+      break;
+    case HOOGSTEEN:
+    {
+      GeneralPath p2 = new GeneralPath();
+      radius /= 1.05;
+      p2.moveTo(
+              (float) (posx - radius * normx / 2.0 - radius * normy / 2.0),
+              (float) (posy - radius * normy / 2.0 + radius * normx / 2.0));
+      p2.lineTo(
+              (float) (posx + radius * normx / 2.0 - radius * normy / 2.0),
+              (float) (posy + radius * normy / 2.0 + radius * normx / 2.0));
+      p2.lineTo(
+              (float) (posx + radius * normx / 2.0 + radius * normy / 2.0),
+              (float) (posy + radius * normy / 2.0 - radius * normx / 2.0));
+      p2.lineTo(
+              (float) (posx - radius * normx / 2.0 + radius * normy / 2.0),
+              (float) (posy - radius * normy / 2.0 - radius * normx / 2.0));
+      p2.closePath();
+
+      if (isCIS)
+      {
+        g2D.setColor(bck);
+        g2D.fill(p2);
+        g2D.draw(p2);
+      }
+      else
+      {
+        g2D.setColor(Color.white);
+        g2D.fill(p2);
+        g2D.setColor(bck);
+        g2D.draw(p2);
+      }
+    }
+      break;
+    case SUGAR:
+    {
+      double ix = radius * normx / 2.0;
+      double iy = radius * normy / 2.0;
+      double jx = radius * normy / 2.0;
+      double jy = -radius * normx / 2.0;
+
+      GeneralPath p2 = new GeneralPath();
+      p2.moveTo((float) (posx - ix + jx), (float) (posy - iy + jy));
+      p2.lineTo((float) (posx + ix + jx), (float) (posy + iy + jy));
+      p2.lineTo((float) (posx - jx), (float) (posy - jy));
+      p2.closePath();
+
+      if (isCIS)
+      {
+        g2D.setColor(bck);
+        g2D.fill(p2);
+        g2D.draw(p2);
+      }
+      else
+      {
+        g2D.setColor(Color.white);
+        g2D.fill(p2);
+        g2D.setColor(bck);
+        g2D.draw(p2);
+      }
+    }
+      break;
+    }
+    g2D.setColor(bck);
+  }
+
+  private void drawBasePairArc(VueVARNAGraphics g2D, int i, int j,
+          Point2D.Double orig, Point2D.Double dest, double scaleFactor,
+          ModeleBP style, double newRadius)
+  {
+    double distance, coef;
+    if (j - i == 1)
+      coef = getBPHeightIncrement() * 1.75;
+    else
+      coef = getBPHeightIncrement();
+    distance = dest.x - orig.x;
+    switch (_conf._mainBPStyle)
+    {
+    case LW:
+    {
+      double radiusCircle = ((RNA.BASE_PAIR_DISTANCE - _RNA.BASE_RADIUS)
+              / 5.0) * scaleFactor;
+      if (style.isCanonical())
+      {
+        if (style.isCanonicalGC())
+        {
+          if ((orig.x != dest.x) || (orig.y != dest.y))
+          {
+            g2D.drawArc((dest.x + orig.x) / 2.,
+                    dest.y - scaleFactor * _RNA.BASE_RADIUS / 2.0,
+                    (distance - scaleFactor * _RNA.BASE_RADIUS / 3.0),
+                    (distance * coef
+                            - scaleFactor * _RNA.BASE_RADIUS / 3.0),
+                    0, 180);
+            g2D.drawArc((dest.x + orig.x) / 2.,
+                    dest.y - scaleFactor * _RNA.BASE_RADIUS / 2.0,
+                    (distance + scaleFactor * _RNA.BASE_RADIUS / 3.0),
+                    (distance * coef
+                            + scaleFactor * _RNA.BASE_RADIUS / 3.0),
+                    0, 180);
+          }
+        }
+        else if (style.isCanonicalAU())
+        {
+          g2D.drawArc((dest.x + orig.x) / 2.,
+                  dest.y - scaleFactor * _RNA.BASE_RADIUS / 2.0, (distance),
+                  (distance * coef), 0, 180);
+        }
+        else if (style.isWobbleUG())
+        {
+          Point2D.Double midtop = new Point2D.Double((dest.x + orig.x) / 2.,
+                  dest.y - distance * coef / 2.
+                          - scaleFactor * _RNA.BASE_RADIUS / 2.0);
+          g2D.drawArc(midtop.x,
+                  dest.y - scaleFactor * _RNA.BASE_RADIUS / 2.0, (distance),
+                  (distance * coef), 0, 180);
+          drawSymbol(g2D, midtop.x, midtop.y, 1., 0., radiusCircle, false,
+                  ModeleBP.Edge.WC);
+        }
+        else
+        {
+          Point2D.Double midtop = new Point2D.Double((dest.x + orig.x) / 2.,
+                  dest.y - distance * coef / 2.
+                          - scaleFactor * _RNA.BASE_RADIUS / 2.0);
+          g2D.drawArc(midtop.x,
+                  dest.y - scaleFactor * _RNA.BASE_RADIUS / 2.0, (distance),
+                  (distance * coef), 0, 180);
+          drawSymbol(g2D, midtop.x, midtop.y, 1., 0., radiusCircle,
+                  style.isCIS(), style.getEdgePartner5());
+        }
+      }
+      else
+      {
+        ModeleBP.Edge p1 = style.getEdgePartner5();
+        ModeleBP.Edge p2 = style.getEdgePartner3();
+        Point2D.Double midtop = new Point2D.Double((dest.x + orig.x) / 2.,
+                dest.y - distance * coef / 2.
+                        - scaleFactor * _RNA.BASE_RADIUS / 2.0);
+        g2D.drawArc(midtop.x, dest.y - scaleFactor * _RNA.BASE_RADIUS / 2.0,
+                (distance), (distance * coef), 0, 180);
+        if (p1 == p2)
+        {
+          drawSymbol(g2D, midtop.x, midtop.y, 1., 0., radiusCircle, false,
+                  style.getEdgePartner5());
+        }
+        else
+        {
+          drawSymbol(g2D, midtop.x - scaleFactor * _RNA.BASE_RADIUS,
+                  midtop.y, 1., 0., radiusCircle, style.isCIS(), p1);
+          drawSymbol(g2D, midtop.x + scaleFactor * _RNA.BASE_RADIUS,
+                  midtop.y, -1., 0., radiusCircle, style.isCIS(), p2);
+        }
+      }
+    }
+      break;
+    case LW_ALT:
+    {
+      double radiusCircle = ((RNA.BASE_PAIR_DISTANCE - _RNA.BASE_RADIUS)
+              / 5.0) * scaleFactor;
+      double distFromBaseCenter = DISTANCE_FACT * scaleFactor;
+      orig = new Point2D.Double(orig.x,
+              orig.y - (distFromBaseCenter + newRadius));
+      dest = new Point2D.Double(dest.x,
+              dest.y - (distFromBaseCenter + newRadius));
+      if (style.isCanonical())
+      {
+        if (style.isCanonicalGC())
+        {
+          if ((orig.x != dest.x) || (orig.y != dest.y))
+          {
+            g2D.drawArc((dest.x + orig.x) / 2.,
+                    dest.y - scaleFactor * _RNA.BASE_RADIUS / 2.0,
+                    (distance - scaleFactor * _RNA.BASE_RADIUS / 3.0),
+                    (distance * coef
+                            - scaleFactor * _RNA.BASE_RADIUS / 3.0),
+                    0, 180);
+            g2D.drawArc((dest.x + orig.x) / 2.,
+                    dest.y - scaleFactor * _RNA.BASE_RADIUS / 2.0,
+                    (distance + scaleFactor * _RNA.BASE_RADIUS / 3.0),
+                    (distance * coef
+                            + scaleFactor * _RNA.BASE_RADIUS / 3.0),
+                    0, 180);
+          }
+        }
+        else if (style.isCanonicalAU())
+        {
+          g2D.drawArc((dest.x + orig.x) / 2.,
+                  dest.y - scaleFactor * _RNA.BASE_RADIUS / 2.0, (distance),
+                  (distance * coef), 0, 180);
+        }
+      }
+      else
+      {
+        ModeleBP.Edge p1 = style.getEdgePartner5();
+        ModeleBP.Edge p2 = style.getEdgePartner3();
+        Point2D.Double midtop = new Point2D.Double((dest.x + orig.x) / 2.,
+                dest.y - distance * coef / 2.
+                        - scaleFactor * _RNA.BASE_RADIUS / 2.0);
+        g2D.drawArc(midtop.x, dest.y - scaleFactor * _RNA.BASE_RADIUS / 2.0,
+                (distance), (distance * coef), 0, 180);
+        drawSymbol(g2D, orig.x, orig.y - radiusCircle * .95, 1., 0.,
+                radiusCircle, style.isCIS(), p1);
+        drawSymbol(g2D, dest.x, dest.y - radiusCircle * .95, -1., 0.,
+                radiusCircle, style.isCIS(), p2);
+      }
+    }
+      break;
+    default:
+      g2D.drawArc((dest.x + orig.x) / 2.,
+              dest.y - scaleFactor * _RNA.BASE_RADIUS / 2.0, (distance),
+              (distance * coef), 0, 180);
+      break;
+    }
+
+  }
+
+  public static double DISTANCE_FACT = 2.;
+
+  private void drawBasePair(VueVARNAGraphics g2D, Point2D.Double orig,
+          Point2D.Double dest, ModeleBP style, double newRadius,
+          double scaleFactor)
+  {
+
+    double dx = dest.x - orig.x;
+    double dy = dest.y - orig.y;
+    double dist = Math.sqrt((dest.x - orig.x) * (dest.x - orig.x)
+            + (dest.y - orig.y) * (dest.y - orig.y));
+    dx /= dist;
+    dy /= dist;
+    double nx = -dy;
+    double ny = dx;
+    orig = new Point2D.Double(orig.x + newRadius * dx,
+            orig.y + newRadius * dy);
+    dest = new Point2D.Double(dest.x - newRadius * dx,
+            dest.y - newRadius * dy);
+    switch (_conf._mainBPStyle)
+    {
+    case LW:
+    {
+      double radiusCircle = ((RNA.BASE_PAIR_DISTANCE - _RNA.BASE_RADIUS)
+              / 5.0) * scaleFactor;
+      if (style.isCanonical())
+      {
+        if (style.isCanonicalGC())
+        {
+          if ((orig.x != dest.x) || (orig.y != dest.y))
+          {
+            nx *= scaleFactor * _RNA.BASE_RADIUS / 4.0;
+            ny *= scaleFactor * _RNA.BASE_RADIUS / 4.0;
+            g2D.drawLine((orig.x + nx), (orig.y + ny), (dest.x + nx),
+                    (dest.y + ny));
+            g2D.drawLine((orig.x - nx), (orig.y - ny), (dest.x - nx),
+                    (dest.y - ny));
+          }
+        }
+        else if (style.isCanonicalAU())
+        {
+          g2D.drawLine(orig.x, orig.y, dest.x, dest.y);
+        }
+        else if (style.isWobbleUG())
+        {
+          double cx = (dest.x + orig.x) / 2.0;
+          double cy = (dest.y + orig.y) / 2.0;
+          g2D.drawLine(orig.x, orig.y, dest.x, dest.y);
+          drawSymbol(g2D, cx, cy, nx, ny, radiusCircle, false,
+                  ModeleBP.Edge.WC);
+        }
+        else
+        {
+          double cx = (dest.x + orig.x) / 2.0;
+          double cy = (dest.y + orig.y) / 2.0;
+          g2D.drawLine(orig.x, orig.y, dest.x, dest.y);
+          drawSymbol(g2D, cx, cy, nx, ny, radiusCircle, style.isCIS(),
+                  style.getEdgePartner5());
+        }
+      }
+      else
+      {
+        ModeleBP.Edge p1 = style.getEdgePartner5();
+        ModeleBP.Edge p2 = style.getEdgePartner3();
+        double cx = (dest.x + orig.x) / 2.0;
+        double cy = (dest.y + orig.y) / 2.0;
+        g2D.drawLine(orig.x, orig.y, dest.x, dest.y);
+        if (p1 == p2)
+        {
+          drawSymbol(g2D, cx, cy, nx, ny, radiusCircle, style.isCIS(), p1);
+
+        }
+        else
+        {
+          double vdx = (dest.x - orig.x);
+          double vdy = (dest.y - orig.y);
+          vdx /= 6.0;
+          vdy /= 6.0;
+          drawSymbol(g2D, cx + vdx, cy + vdy, -nx, -ny, radiusCircle,
+                  style.isCIS(), p2);
+          drawSymbol(g2D, cx - vdx, cy - vdy, nx, ny, radiusCircle,
+                  style.isCIS(), p1);
+        }
+      }
+    }
+      break;
+    case LW_ALT:
+    {
+      double radiusCircle = ((RNA.BASE_PAIR_DISTANCE - _RNA.BASE_RADIUS)
+              / 5.0) * scaleFactor;
+      double distFromBaseCenter = DISTANCE_FACT * scaleFactor;
+      Point2D.Double norig = new Point2D.Double(
+              orig.x + (distFromBaseCenter + .5 * newRadius) * dx,
+              orig.y + (distFromBaseCenter + .5 * newRadius) * dy);
+      Point2D.Double ndest = new Point2D.Double(
+              dest.x - (distFromBaseCenter + .5 * newRadius) * dx,
+              dest.y - (distFromBaseCenter + .5 * newRadius) * dy);
+      if (style.isCanonical())
+      {
+        if (style.isCanonicalGC())
+        {
+          if ((norig.x != ndest.x) || (norig.y != ndest.y))
+          {
+            nx *= scaleFactor * _RNA.BASE_RADIUS / 4.0;
+            ny *= scaleFactor * _RNA.BASE_RADIUS / 4.0;
+            g2D.drawLine((norig.x + nx), (norig.y + ny), (ndest.x + nx),
+                    (ndest.y + ny));
+            g2D.drawLine((norig.x - nx), (norig.y - ny), (ndest.x - nx),
+                    (ndest.y - ny));
+          }
+        }
+        else if (style.isCanonicalAU())
+        {
+          g2D.drawLine(norig.x, norig.y, ndest.x, ndest.y);
+        }
+        else if (style.isWobbleUG())
+        {
+          double cx = (ndest.x + norig.x) / 2.0;
+          double cy = (ndest.y + norig.y) / 2.0;
+          g2D.drawLine(norig.x, norig.y, ndest.x, ndest.y);
+          drawSymbol(g2D, cx, cy, nx, ny, radiusCircle, false,
+                  ModeleBP.Edge.WC);
+        }
+        else
+        {
+          double cx = (ndest.x + norig.x) / 2.0;
+          double cy = (ndest.y + norig.y) / 2.0;
+          g2D.drawLine(norig.x, norig.y, ndest.x, ndest.y);
+          drawSymbol(g2D, cx, cy, nx, ny, radiusCircle, style.isCIS(),
+                  style.getEdgePartner5());
+        }
+      }
+      else
+      {
+        ModeleBP.Edge p1 = style.getEdgePartner5();
+        ModeleBP.Edge p2 = style.getEdgePartner3();
+        double cx = (ndest.x + norig.x) / 2.0;
+        double cy = (ndest.y + norig.y) / 2.0;
+        g2D.drawLine(norig.x, norig.y, ndest.x, ndest.y);
+        if (p1 == p2)
+        {
+          drawSymbol(g2D, cx, cy, nx, ny, radiusCircle, style.isCIS(), p1);
+
+        }
+        else
+        {
+          double fac = .4;
+          drawSymbol(g2D, ndest.x - fac * radiusCircle * dx,
+                  ndest.y - fac * radiusCircle * dy, -nx, -ny, radiusCircle,
+                  style.isCIS(), p2);
+          drawSymbol(g2D, norig.x + fac * radiusCircle * dx,
+                  norig.y + fac * radiusCircle * dy, nx, ny, radiusCircle,
+                  style.isCIS(), p1);
+        }
+      }
+    }
+      break;
+    case SIMPLE:
+      g2D.drawLine(orig.x, orig.y, dest.x, dest.y);
+      break;
+    case RNAVIZ:
+      double xcenter = (orig.x + dest.x) / 2.0;
+      double ycenter = (orig.y + dest.y) / 2.0;
+      double radius = Math.max(4.0 * scaleFactor, 1.0);
+      g2D.fillCircle((xcenter - radius), (ycenter - radius),
+              (2.0 * radius));
+      break;
+    case NONE:
+      break;
+    }
+  }
+
+  private Color getHighlightedVersion(Color c1, Color c2)
+  {
+    int r1 = c1.getRed();
+    int g1 = c1.getGreen();
+    int b1 = c1.getBlue();
+    int r2 = c2.getRed();
+    int g2 = c2.getGreen();
+    int b2 = c2.getBlue();
+    double val = _blink.getVal();
+    int nr = Math.max(0,
+            Math.min((int) ((r1 * val + r2 * (1.0 - val))), 255));
+    int ng = Math.max(0,
+            Math.min((int) ((g1 * val + g2 * (1.0 - val))), 255));
+    int nb = Math.max(0,
+            Math.min((int) ((b1 * val + b2 * (1.0 - val))), 255));
+    return new Color(nr, ng, nb);
+  }
+
+  private Color highlightFilter(int index, Color initialColor, Color c1,
+          Color c2, boolean localView)
+  {
+    if (_selectedBases.contains(_RNA.getBaseAt(index)) && localView)
+    {
+      return getHighlightedVersion(c1, c2);
+    }
+    else
+      return initialColor;
+  }
+
+  public static Point2D.Double computeExcentricUnitVector(int i,
+          Point2D.Double[] points, Point2D.Double[] centers)
+  {
+    double dist = points[i].distance(centers[i]);
+    Point2D.Double byCenter = new Point2D.Double(
+            (points[i].x - centers[i].x) / dist,
+            (points[i].y - centers[i].y) / dist);
+    if ((i > 0) && (i < points.length - 1))
+    {
+      Point2D.Double p0 = points[i - 1];
+      Point2D.Double p1 = points[i];
+      Point2D.Double p2 = points[i + 1];
+      double dist1 = p2.distance(p1);
+      Point2D.Double v1 = new Point2D.Double((p2.x - p1.x) / dist1,
+              (p2.y - p1.y) / dist1);
+      Point2D.Double vn1 = new Point2D.Double(v1.y, -v1.x);
+      double dist2 = p1.distance(p0);
+      Point2D.Double v2 = new Point2D.Double((p1.x - p0.x) / dist2,
+              (p1.y - p0.y) / dist2);
+      Point2D.Double vn2 = new Point2D.Double(v2.y, -v2.x);
+      Point2D.Double vn = new Point2D.Double((vn1.x + vn2.x) / 2.0,
+              (vn1.y + vn2.y) / 2.0);
+      double D = vn.distance(new Point2D.Double(0.0, 0.0));
+      vn.x /= D;
+      vn.y /= D;
+      if (byCenter.x * vn.x + byCenter.y * vn.y < 0)
+      {
+        vn.x = -vn.x;
+        vn.y = -vn.y;
+      }
+      return vn;
+    }
+    else if (((i == 0) || (i == points.length - 1)) && (points.length > 1))
+    {
+      int a = (i == 0) ? 0 : points.length - 1;
+      int b = (i == 0) ? 1 : points.length - 2;
+      double D = points[a].distance(points[b]);
+      return new Point2D.Double((points[a].x - points[b].x) / D,
+              (points[a].y - points[b].y) / D);
+    }
+    else
+    {
+      return byCenter;
+    }
+  }
+
+  private void drawBase(VueVARNAGraphics g2D, int i,
+          Point2D.Double[] points, Point2D.Double[] centers,
+          double newRadius, double _scaleFactor, boolean localView)
+  {
+    Point2D.Double p = points[i];
+    ModeleBase mb = _RNA.get_listeBases().get(i);
+    g2D.setFont(_conf._fontBasesGeneral);
+    Color baseInnerColor = highlightFilter(i,
+            _RNA.getBaseInnerColor(i, _conf), Color.white,
+            _RNA.getBaseInnerColor(i, _conf), localView);
+    Color baseOuterColor = highlightFilter(i,
+            _RNA.getBaseOuterColor(i, _conf),
+            _RNA.getBaseOuterColor(i, _conf), Color.white, localView);
+    Color baseNameColor = highlightFilter(i,
+            _RNA.getBaseNameColor(i, _conf),
+            _RNA.getBaseNameColor(i, _conf), Color.white, localView);
+    if (RNA.whiteLabelPreferrable(baseInnerColor))
+    {
+      baseNameColor = Color.white;
+    }
+
+    if (mb instanceof ModeleBaseNucleotide)
+    {
+      ModeleBaseNucleotide mbn = (ModeleBaseNucleotide) mb;
+      String res = mbn.getBase();
+      if (_hoveredBase == mb && localView && isModifiable())
+      {
+        g2D.setColor(_conf._hoverColor);
+        g2D.fillCircle(p.getX() - 1.5 * newRadius,
+                p.getY() - 1.5 * newRadius, 3.0 * newRadius);
+        g2D.setColor(_conf._hoverColor.darker());
+        g2D.drawCircle(p.getX() - 1.5 * newRadius,
+                p.getY() - 1.5 * newRadius, 3.0 * newRadius);
+        g2D.setPlainStroke();
+      }
+      if (_conf._fillBases)
+      {
+        // Filling inner circle
+        g2D.setColor(baseInnerColor);
+        g2D.fillCircle(p.getX() - newRadius, p.getY() - newRadius,
+                2.0 * newRadius);
+      }
+
+      if (_conf._drawOutlineBases)
+      {
+        // Drawing outline
+        g2D.setColor(baseOuterColor);
+        g2D.setStrokeThickness(_conf._baseThickness * _scaleFactor);
+        g2D.drawCircle(p.getX() - newRadius, p.getY() - newRadius,
+                2.0 * newRadius);
+      }
+      // Drawing label
+      g2D.setColor(baseNameColor);
+      g2D.drawStringCentered(String.valueOf(res), p.getX(), p.getY());
+    }
+    else if (mb instanceof ModeleBasesComparison)
+    {
+
+      ModeleBasesComparison mbc = (ModeleBasesComparison) mb;
+
+      // On lui donne l'aspect voulue (on a un trait droit)
+      g2D.setPlainStroke(); // On doit avoir un trait droit, sans arrondit
+      g2D.setStrokeThickness(_conf._baseThickness * _scaleFactor);
+
+      // On dessine l'étiquette, rectangle aux bords arrondies.
+      g2D.setColor(baseInnerColor);
+      g2D.fillRoundRect((p.getX() - 1.5 * newRadius),
+              (p.getY() - newRadius), (3.0 * newRadius), (2.0 * newRadius),
+              10 * _scaleFactor, 10 * _scaleFactor);
+
+      /* Dessin du rectangle exterieur (bords) */
+      g2D.setColor(baseOuterColor);
+      g2D.drawRoundRect((p.getX() - 1.5 * newRadius),
+              (p.getY() - newRadius), (3 * newRadius), (2 * newRadius),
+              10 * _scaleFactor, 10 * _scaleFactor);
+
+      // On le dessine au centre de l'étiquette.
+      g2D.drawLine((p.getX()), (p.getY() + newRadius) - 1, (p.getX()),
+              (p.getY() - newRadius) + 1);
+
+      /* Dessin du nom de la base (A,C,G,U,etc...) */
+      // On créer le texte des étiquettes
+      String label1 = String.valueOf(mbc.getBase1());
+      String label2 = String.valueOf(mbc.getBase2());
+
+      // On leur donne une couleur
+      g2D.setColor(getRNA().get_listeBases().get(i).getStyleBase()
+              .getBaseNameColor());
+
+      // Et on les dessine.
+      g2D.drawStringCentered(label1, p.getX() - (.75 * newRadius),
+              p.getY());
+      g2D.drawStringCentered(label2, p.getX() + (.75 * newRadius),
+              p.getY());
+    }
+
+    // Drawing base number
+    if (_RNA.isNumberDrawn(mb, getNumPeriod()))
+    {
+
+      Point2D.Double vn = computeExcentricUnitVector(i, points, centers);
+      g2D.setColor(mb.getStyleBase().getBaseNumberColor());
+      g2D.setFont(_conf._numbersFont);
+      double factorMin = Math.min(.5, _conf._distNumbers);
+      double factorMax = Math.min(_conf._distNumbers - 1.5,
+              _conf._distNumbers);
+      g2D.drawLine(p.x + vn.x * ((1 + factorMin) * newRadius),
+              p.y + vn.y * ((1 + factorMin) * newRadius),
+              p.x + vn.x * ((1 + factorMax) * newRadius),
+              p.y + vn.y * ((1 + factorMax) * newRadius));
+      g2D.drawStringCentered(mb.getLabel(),
+              p.x + vn.x * ((1 + _conf._distNumbers) * newRadius),
+              p.y + vn.y * ((1 + _conf._distNumbers) * newRadius));
+
+    }
+  }
+
+  void drawChemProbAnnotation(VueVARNAGraphics g2D, ChemProbAnnotation cpa,
+          Point2D.Double anchor, double scaleFactor)
+  {
+    g2D.setColor(cpa.getColor());
+    g2D.setStrokeThickness(RNA.CHEM_PROB_ARROW_THICKNESS * scaleFactor
+            * cpa.getIntensity());
+    g2D.setPlainStroke();
+    Point2D.Double v = cpa.getDirVector();
+    Point2D.Double vn = cpa.getNormalVector();
+    Point2D.Double base = new Point2D.Double(
+            (anchor.x + _RNA.CHEM_PROB_DIST * scaleFactor * v.x),
+            (anchor.y + _RNA.CHEM_PROB_DIST * scaleFactor * v.y));
+    Point2D.Double edge = new Point2D.Double(
+            (base.x + _RNA.CHEM_PROB_BASE_LENGTH * cpa.getIntensity()
+                    * scaleFactor * v.x),
+            (base.y + _RNA.CHEM_PROB_BASE_LENGTH * cpa.getIntensity()
+                    * scaleFactor * v.y));
+    switch (cpa.getType())
+    {
+    case ARROW:
+    {
+      Point2D.Double arrowTip1 = new Point2D.Double(
+              (base.x + cpa.getIntensity() * scaleFactor
+                      * (_RNA.CHEM_PROB_ARROW_WIDTH * vn.x
+                              + _RNA.CHEM_PROB_ARROW_HEIGHT * v.x)),
+              (base.y + cpa.getIntensity() * scaleFactor
+                      * (_RNA.CHEM_PROB_ARROW_WIDTH * vn.y
+                              + _RNA.CHEM_PROB_ARROW_HEIGHT * v.y)));
+      Point2D.Double arrowTip2 = new Point2D.Double(
+              (base.x + cpa.getIntensity() * scaleFactor
+                      * (-_RNA.CHEM_PROB_ARROW_WIDTH * vn.x
+                              + _RNA.CHEM_PROB_ARROW_HEIGHT * v.x)),
+              (base.y + cpa.getIntensity() * scaleFactor
+                      * (-_RNA.CHEM_PROB_ARROW_WIDTH * vn.y
+                              + _RNA.CHEM_PROB_ARROW_HEIGHT * v.y)));
+      g2D.drawLine(base.x, base.y, edge.x, edge.y);
+      g2D.drawLine(base.x, base.y, arrowTip1.x, arrowTip1.y);
+      g2D.drawLine(base.x, base.y, arrowTip2.x, arrowTip2.y);
+    }
+      break;
+    case PIN:
+    {
+      Point2D.Double side1 = new Point2D.Double(
+              (edge.x - cpa.getIntensity() * scaleFactor
+                      * (_RNA.CHEM_PROB_PIN_SEMIDIAG * v.x)),
+              (edge.y - cpa.getIntensity() * scaleFactor
+                      * (_RNA.CHEM_PROB_PIN_SEMIDIAG * v.y)));
+      Point2D.Double side2 = new Point2D.Double(
+              (edge.x - cpa.getIntensity() * scaleFactor
+                      * (_RNA.CHEM_PROB_PIN_SEMIDIAG * vn.x)),
+              (edge.y - cpa.getIntensity() * scaleFactor
+                      * (_RNA.CHEM_PROB_PIN_SEMIDIAG * vn.y)));
+      Point2D.Double side3 = new Point2D.Double(
+              (edge.x + cpa.getIntensity() * scaleFactor
+                      * (_RNA.CHEM_PROB_PIN_SEMIDIAG * v.x)),
+              (edge.y + cpa.getIntensity() * scaleFactor
+                      * (_RNA.CHEM_PROB_PIN_SEMIDIAG * v.y)));
+      Point2D.Double side4 = new Point2D.Double(
+              (edge.x + cpa.getIntensity() * scaleFactor
+                      * (_RNA.CHEM_PROB_PIN_SEMIDIAG * vn.x)),
+              (edge.y + cpa.getIntensity() * scaleFactor
+                      * (_RNA.CHEM_PROB_PIN_SEMIDIAG * vn.y)));
+      GeneralPath p2 = new GeneralPath();
+      p2.moveTo((float) side1.x, (float) side1.y);
+      p2.lineTo((float) side2.x, (float) side2.y);
+      p2.lineTo((float) side3.x, (float) side3.y);
+      p2.lineTo((float) side4.x, (float) side4.y);
+      p2.closePath();
+      g2D.fill(p2);
+      g2D.drawLine(base.x, base.y, edge.x, edge.y);
+    }
+      break;
+    case TRIANGLE:
+    {
+      Point2D.Double arrowTip1 = new Point2D.Double(
+              (edge.x + cpa.getIntensity() * scaleFactor
+                      * (_RNA.CHEM_PROB_TRIANGLE_WIDTH * vn.x)),
+              (edge.y + cpa.getIntensity() * scaleFactor
+                      * (_RNA.CHEM_PROB_TRIANGLE_WIDTH * vn.y)));
+      Point2D.Double arrowTip2 = new Point2D.Double(
+              (edge.x + cpa.getIntensity() * scaleFactor
+                      * (-_RNA.CHEM_PROB_TRIANGLE_WIDTH * vn.x)),
+              (edge.y + cpa.getIntensity() * scaleFactor
+                      * (-_RNA.CHEM_PROB_TRIANGLE_WIDTH * vn.y)));
+      GeneralPath p2 = new GeneralPath();
+      p2.moveTo((float) base.x, (float) base.y);
+      p2.lineTo((float) arrowTip1.x, (float) arrowTip1.y);
+      p2.lineTo((float) arrowTip2.x, (float) arrowTip2.y);
+      p2.closePath();
+      g2D.fill(p2);
+    }
+      break;
+    case DOT:
+    {
+      Double radius = scaleFactor * _RNA.CHEM_PROB_DOT_RADIUS
+              * cpa.getIntensity();
+      Point2D.Double center = new Point2D.Double((base.x + radius * v.x),
+              (base.y + radius * v.y));
+      g2D.fillCircle((center.x - radius), (center.y - radius),
+              (2 * radius));
+    }
+      break;
+    }
+  }
+
+  Point2D.Double buildCaptionPosition(ModeleBase mb, double scaleFactor,
+          double heightEstimate)
+  {
+    double radius = 2.0;
+    if (_RNA.isNumberDrawn(mb, getNumPeriod()))
+    {
+      radius += _conf._distNumbers;
+    }
+    Point2D.Double center = mb.getCenter();
+    Point2D.Double p = mb.getCoords();
+    double realDistance = _RNA.BASE_RADIUS * radius + heightEstimate;
+    return new Point2D.Double(center.getX() + (p.getX() - center.getX())
+            * ((p.distance(center) + realDistance) / p.distance(center)),
+            center.getY() + (p.getY() - center.getY())
+                    * ((p.distance(center) + realDistance)
+                            / p.distance(center)));
+  }
+
+  private void renderAnnotations(VueVARNAGraphics g2D, double offX,
+          double offY, double rnaBBoxX, double rnaBBoxY, double scaleFactor)
+  {
+    for (TextAnnotation textAnnotation : _RNA.getAnnotations())
+    {
+      g2D.setColor(textAnnotation.getColor());
+      g2D.setFont(textAnnotation.getFont().deriveFont((float) (2.0
+              * textAnnotation.getFont().getSize() * scaleFactor)));
+      Point2D.Double position = textAnnotation.getCenterPosition();
+      if (textAnnotation.getType() == TextAnnotation.AnchorType.BASE)
+      {
+        ModeleBase mb = (ModeleBase) textAnnotation.getAncrage();
+        double fontHeight = Math.ceil(textAnnotation.getFont().getSize());
+        position = buildCaptionPosition(mb, scaleFactor, fontHeight);
+      }
+      position = transformCoord(position, offX, offY, rnaBBoxX, rnaBBoxY,
+              scaleFactor);
+      g2D.drawStringCentered(textAnnotation.getTexte(), position.x,
+              position.y);
+      if ((_selectedAnnotation == textAnnotation) && (_highlightAnnotation))
+      {
+        drawStringOutline(g2D, textAnnotation.getTexte(), position.x,
+                position.y, 5);
+      }
+    }
+    for (ChemProbAnnotation cpa : _RNA.getChemProbAnnotations())
+    {
+      Point2D.Double anchor = transformCoord(cpa.getAnchorPosition(), offX,
+              offY, rnaBBoxX, rnaBBoxY, scaleFactor);
+      drawChemProbAnnotation(g2D, cpa, anchor, scaleFactor);
+    }
+
+  }
+
+  public Rectangle2D.Double getExtendedRNABBox()
+  {
+    // We get the logical bounding box
+    Rectangle2D.Double rnabbox = _RNA.getBBox();
+    rnabbox.y -= _conf._distNumbers * _RNA.BASE_RADIUS;
+    rnabbox.height += 2.0 * _conf._distNumbers * _RNA.BASE_RADIUS;
+    rnabbox.x -= _conf._distNumbers * _RNA.BASE_RADIUS;
+    rnabbox.width += 2.0 * _conf._distNumbers * _RNA.BASE_RADIUS;
+    if (_RNA.hasVirtualLoops())
+    {
+      rnabbox.y -= RNA.VIRTUAL_LOOP_RADIUS;
+      rnabbox.height += 2.0 * RNA.VIRTUAL_LOOP_RADIUS;
+      rnabbox.x -= RNA.VIRTUAL_LOOP_RADIUS;
+      rnabbox.width += 2.0 * RNA.VIRTUAL_LOOP_RADIUS;
+    }
+    return rnabbox;
+  }
+
+  public void drawBackbone(VueVARNAGraphics g2D, Point2D.Double[] newCoords,
+          double newRadius, double _scaleFactor)
+  {
+    // Drawing backbone
+    if (getDrawBackbone())
+    {
+      g2D.setStrokeThickness(1.5 * _scaleFactor);
+      g2D.setColor(_conf._backboneColor);
+
+      ModeleBackbone bck = _RNA.getBackbone();
+
+      for (int i = 1; i < _RNA.get_listeBases().size(); i++)
+      {
+        Point2D.Double p1 = newCoords[i - 1];
+        Point2D.Double p2 = newCoords[i];
+        double dist = p1.distance(p2);
+        int a = _RNA.getBaseAt(i - 1).getElementStructure();
+        int b = _RNA.getBaseAt(i).getElementStructure();
+        boolean consecutivePair = (a == i) && (b == i - 1);
+
+        if ((dist > 0))
+        {
+          Point2D.Double vbp = new Point2D.Double();
+          vbp.x = (p2.x - p1.x) / dist;
+          vbp.y = (p2.y - p1.y) / dist;
+
+          BackboneType bt = bck.getTypeBefore(i);
+          if (bt != BackboneType.DISCONTINUOUS_TYPE)
+          {
+            if (bt == BackboneType.MISSING_PART_TYPE)
+            {
+              g2D.setSelectionStroke();
+            }
+            else
+            {
+              g2D.setPlainStroke();
+            }
+            g2D.setColor(bck.getColorBefore(i, _conf._backboneColor));
+
+            if (consecutivePair
+                    && (_RNA.getDrawMode() != RNA.DRAW_MODE_LINEAR)
+                    && (_RNA.getDrawMode() != RNA.DRAW_MODE_CIRCULAR))
+            {
+              int dir = 0;
+              if (i + 1 < newCoords.length)
+              {
+                dir = (_RNA.testDirectionality(i - 1, i, i + 1) ? -1 : 1);
+              }
+              else if (i - 2 >= 0)
+              {
+                dir = (_RNA.testDirectionality(i - 2, i - 1, i) ? -1 : 1);
+              }
+              Point2D.Double vn = new Point2D.Double(dir * vbp.y,
+                      -dir * vbp.x);
+              Point2D.Double centerSeg = new Point2D.Double(
+                      (p1.x + p2.x) / 2.0, (p1.y + p2.y) / 2.0);
+              double distp1CenterSeq = p1.distance(centerSeg);
+              double centerDist = Math
+                      .sqrt((RNA.VIRTUAL_LOOP_RADIUS * _scaleFactor
+                              * RNA.VIRTUAL_LOOP_RADIUS * _scaleFactor)
+                              - distp1CenterSeq * distp1CenterSeq);
+              Point2D.Double centerLoop = new Point2D.Double(
+                      centerSeg.x + centerDist * vn.x,
+                      centerSeg.y + centerDist * vn.y);
+              double radius = centerLoop.distance(p1);
+              double a1 = 360. * (Math.atan2(-(p1.y - centerLoop.y),
+                      (p1.x - centerLoop.x))) / (2. * Math.PI);
+              double a2 = 360. * (Math.atan2(-(p2.y - centerLoop.y),
+                      (p2.x - centerLoop.x))) / (2. * Math.PI);
+              double angle = (a2 - a1);
+              if (-dir * angle < 0)
+              {
+                angle += -dir * 360.;
+              }
+              // if (angle<0.) angle += 360.;
+              // angle = -dir*(360-dir*angle);
+              g2D.drawArc(centerLoop.x + .8 * newRadius * vn.x,
+                      centerLoop.y + .8 * newRadius * vn.y, 2 * radius,
+                      2 * radius, a1, angle);
+            }
+            else
+            {
+              g2D.drawLine((newCoords[i - 1].x + newRadius * vbp.x),
+                      (newCoords[i - 1].y + newRadius * vbp.y),
+                      (newCoords[i].x - newRadius * vbp.x),
+                      (newCoords[i].y - newRadius * vbp.y));
+            }
+          }
+        }
+      }
+    }
+  }
+
+  public Point2D.Double logicToPanel(Point2D.Double logicPoint)
+  {
+    return new Point2D.Double(
+            _offX + (getScaleFactor() * (logicPoint.x - _offsetRNA.x)),
+            _offY + (getScaleFactor() * (logicPoint.y - _offsetRNA.y)));
+
+  }
+
+  public Rectangle2D.Double renderRNA(VueVARNAGraphics g2D,
+          Rectangle2D.Double bbox)
+  {
+    return renderRNA(g2D, bbox, false, true);
+  }
+
+  private double computeScaleFactor(Rectangle2D.Double bbox,
+          boolean localView, boolean autoCenter)
+  {
+    Rectangle2D.Double rnabbox = getExtendedRNABBox();
+    double scaleFactor = Math.min(
+            (double) bbox.width / (double) rnabbox.width,
+            (double) bbox.height / (double) rnabbox.height);
+
+    // Use it to get an estimate of the font size for numbers ...
+    float newFontSize = Math.max(1,
+            (int) ((1.7 * _RNA.BASE_RADIUS) * scaleFactor));
+    // ... and increase bounding box accordingly
+    rnabbox.y -= newFontSize;
+    rnabbox.height += newFontSize;
+    if (_conf._drawColorMap)
+    {
+      rnabbox.height += getColorMapHeight();
+    }
+    rnabbox.x -= newFontSize;
+    rnabbox.width += newFontSize;
+
+    // Now, compute the final scaling factor and corresponding font size
+    scaleFactor = Math.min((double) bbox.width / (double) rnabbox.width,
+            (double) bbox.height / (double) rnabbox.height);
+    if (localView)
+    {
+      if (_conf._autoFit)
+        setScaleFactor(scaleFactor);
+      scaleFactor = getScaleFactor();
+    }
+    return scaleFactor;
+  }
+
+  public synchronized Rectangle2D.Double renderRNA(VueVARNAGraphics g2D,
+          Rectangle2D.Double bbox, boolean localView, boolean autoCenter)
+  {
+    Rectangle2D.Double rnaMultiBox = new Rectangle2D.Double(0, 0, 1, 1);
+    double scaleFactor = computeScaleFactor(bbox, localView, autoCenter);
+    float newFontSize = Math.max(1,
+            (int) ((1.7 * _RNA.BASE_RADIUS) * scaleFactor));
+    double newRadius = Math.max(1.0, (scaleFactor * _RNA.BASE_RADIUS));
+    setBaseFontSize(newFontSize);
+    setNumbersFontSize(newFontSize);
+    double offX = bbox.x;
+    double offY = bbox.y;
+    Rectangle2D.Double rnabbox = getExtendedRNABBox();
+
+    if (_RNA.getSize() != 0)
+    {
+
+      Point2D.Double offsetRNA = new Point2D.Double(rnabbox.x, rnabbox.y);
+
+      if (autoCenter)
+      {
+        offX = (bbox.x
+                + (bbox.width - Math.round(rnabbox.width * scaleFactor))
+                        / 2.0);
+        offY = (bbox.y
+                + (bbox.height - Math.round(rnabbox.height * scaleFactor))
+                        / 2.0);
+        if (localView)
+        {
+          _offX = offX;
+          _offY = offY;
+          _offsetPanel = new Point2D.Double(_offX, _offY);
+          _offsetRNA = new Point2D.Double(rnabbox.x, rnabbox.y);
+        }
+      }
+
+      if (localView)
+      {
+        offX = _offX;
+        offY = _offY;
+        offsetRNA = _offsetRNA;
+      }
+
+      // Re-scaling once and for all
+      Point2D.Double[] newCoords = new Point2D.Double[_RNA.get_listeBases()
+              .size()];
+      Point2D.Double[] newCenters = new Point2D.Double[_RNA.get_listeBases()
+              .size()];
+      for (int i = 0; i < _RNA.get_listeBases().size(); i++)
+      {
+        ModeleBase mb = _RNA.getBaseAt(i);
+        newCoords[i] = new Point2D.Double(
+                offX + (scaleFactor * (mb.getCoords().x - offsetRNA.x)),
+                offY + (scaleFactor * (mb.getCoords().y - offsetRNA.y)));
+
+        Point2D.Double centerBck = _RNA.getCenter(i);
+        // si la base est dans un angle entre une boucle et une helice
+        if (_RNA.get_drawMode() == RNA.DRAW_MODE_NAVIEW
+                || _RNA.get_drawMode() == RNA.DRAW_MODE_RADIATE)
+        {
+          if ((mb.getElementStructure() != -1)
+                  && i < _RNA.get_listeBases().size() - 1 && i > 1)
+          {
+            ModeleBase b1 = _RNA.get_listeBases().get(i - 1);
+            ModeleBase b2 = _RNA.get_listeBases().get(i + 1);
+            int j1 = b1.getElementStructure();
+            int j2 = b2.getElementStructure();
+            if ((j1 == -1) ^ (j2 == -1))
+            {
+              // alors la position du nombre associé doit etre
+              Point2D.Double a1 = b1.getCoords();
+              Point2D.Double a2 = b2.getCoords();
+              Point2D.Double c1 = b1.getCenter();
+              Point2D.Double c2 = b2.getCenter();
+
+              centerBck.x = mb.getCoords().x
+                      + (c1.x - a1.x) / c1.distance(a1)
+                      + (c2.x - a2.x) / c2.distance(a2);
+              centerBck.y = mb.getCoords().y
+                      + (c1.y - a1.y) / c1.distance(a1)
+                      + (c2.y - a2.y) / c2.distance(a2);
+            }
+          }
+        }
+        newCenters[i] = new Point2D.Double(
+                offX + (scaleFactor * (centerBck.x - offsetRNA.x)),
+                offY + (scaleFactor * (centerBck.y - offsetRNA.y)));
+      }
+      // Keep track of coordinates for mouse interactions
+      if (localView)
+      {
+        _realCoords = newCoords;
+        _realCenters = newCenters;
+      }
+
+      g2D.setStrokeThickness(1.5 * scaleFactor);
+      g2D.setPlainStroke();
+      g2D.setFont(_conf._fontBasesGeneral);
+
+      // Drawing region highlights Annotation
+      drawRegionHighlightsAnnotation(g2D, _realCoords, _realCenters,
+              scaleFactor);
+      drawBackbone(g2D, newCoords, newRadius, scaleFactor);
+
+      // Drawing base-pairs
+      // pour chaque base
+      for (int i = 0; i < _RNA.get_listeBases().size(); i++)
+      {
+        int j = _RNA.get_listeBases().get(i).getElementStructure();
+        // si c'est une parenthese ouvrante (premiere base du
+        // couple)
+        if (j > i)
+        {
+          ModeleBP msbp = _RNA.get_listeBases().get(i).getStyleBP();
+          // System.err.println(msbp);
+          if (msbp.isCanonical() || _conf._drawnNonCanonicalBP)
+          {
+            if (_RNA.get_drawMode() == RNA.DRAW_MODE_LINEAR)
+            {
+              g2D.setStrokeThickness(_RNA.getBasePairThickness(msbp, _conf)
+                      * 2.0 * scaleFactor * _conf._bpThickness);
+            }
+            else
+            {
+              g2D.setStrokeThickness(_RNA.getBasePairThickness(msbp, _conf)
+                      * 1.5 * scaleFactor);
+            }
+            g2D.setColor(_RNA.getBasePairColor(msbp, _conf));
+
+            if (_RNA.get_drawMode() == RNA.DRAW_MODE_LINEAR)
+            {
+              drawBasePairArc(g2D, i, j, newCoords[i], newCoords[j],
+                      scaleFactor, msbp, newRadius);
+            }
+            else
+            {
+              drawBasePair(g2D, newCoords[i], newCoords[j], msbp, newRadius,
+                      scaleFactor);
+            }
+          }
+        }
+      }
+
+      // Liaisons additionelles (non planaires)
+      if (_conf._drawnNonPlanarBP)
+      {
+        ArrayList<ModeleBP> bpaux = _RNA.getStructureAux();
+        for (int k = 0; k < bpaux.size(); k++)
+        {
+          ModeleBP msbp = bpaux.get(k);
+          if (msbp.isCanonical() || _conf._drawnNonCanonicalBP)
+          {
+            int i = msbp.getPartner5().getIndex();
+            int j = msbp.getPartner3().getIndex();
+            if (_RNA.get_drawMode() == RNA.DRAW_MODE_LINEAR)
+            {
+              g2D.setStrokeThickness(_RNA.getBasePairThickness(msbp, _conf)
+                      * 2.5 * scaleFactor * _conf._bpThickness);
+              g2D.setPlainStroke();
+            }
+            else
+            {
+              g2D.setStrokeThickness(_RNA.getBasePairThickness(msbp, _conf)
+                      * 1.5 * scaleFactor);
+              g2D.setPlainStroke();
+            }
+
+            g2D.setColor(_RNA.getBasePairColor(msbp, _conf));
+            if (j > i)
+            {
+              if (_RNA.get_drawMode() == RNA.DRAW_MODE_LINEAR)
+              {
+                drawBasePairArc(g2D, i, j, newCoords[i], newCoords[j],
+                        scaleFactor, msbp, newRadius);
+              }
+              else
+              {
+                drawBasePair(g2D, newCoords[i], newCoords[j], msbp,
+                        newRadius, scaleFactor);
+              }
+            }
+          }
+        }
+      }
+
+      // Drawing bases
+      g2D.setPlainStroke();
+      for (int i = 0; i < Math.min(_RNA.get_listeBases().size(),
+              newCoords.length); i++)
+      {
+        drawBase(g2D, i, newCoords, newCenters, newRadius, scaleFactor,
+                localView);
+      }
+
+      rnaMultiBox = new Rectangle2D.Double(offX, offY,
+              (scaleFactor * rnabbox.width) - 1,
+              (scaleFactor * rnabbox.height) - 1);
+
+      if (localView)
+      {
+        // Drawing bbox
+        if (_debug || _drawBBox)
+        {
+          g2D.setColor(Color.RED);
+          g2D.setSelectionStroke();
+          g2D.drawRect(rnaMultiBox.x, rnaMultiBox.y, rnaMultiBox.width,
+                  rnaMultiBox.height);
+        }
+
+        // Draw color map
+        if (_conf._drawColorMap)
+        {
+          drawColorMap(g2D, scaleFactor, rnabbox);
         }
-	public FullBackup loadSession(File path) throws ExceptionLoadingFailed {
-
-		FullBackup bck = importSession(path);
-		Mapping map = Mapping.DefaultOutermostMapping(getRNA().getSize(),
-				bck.rna.getSize());
-		showRNAInterpolated(bck.rna, map);
-		_conf = bck.config;
-		repaint();
-		return bck;
-	}
-
-	public static String VARNA_SESSION_EXTENSION = "varna";
-
-	public static FullBackup importSession(Object path) // BH was String
-			throws ExceptionLoadingFailed {
-		try {
-			FileInputStream fis = (path instanceof File ? new FileInputStream((File) path) : new FileInputStream(path.toString()));
-			// ZipInputStream zis = new
-			// ZipInputStream(new BufferedInputStream(fis));
-			// zis.getNextEntry();
-			FullBackup h = importSession(fis, path.toString());
-			// zis.close();
-			return h;
-		} catch (FileNotFoundException e) {
-			throw (new ExceptionLoadingFailed("File not found.", path.toString()));
-		} catch (IOException e) {
-			// TODO Auto-generated catch block
-			throw (new ExceptionLoadingFailed(
-					"I/O error while loading session.", path.toString()));
-		}
-	}
-
-	public static FullBackup importSession(InputStream fis, String path)
-			throws ExceptionLoadingFailed {
-		System.setProperty("javax.xml.parsers.SAXParserFactory",
-				"com.sun.org.apache.xerces.internal.jaxp.SAXParserFactoryImpl");
-		SAXParserFactory saxFact = javax.xml.parsers.SAXParserFactory
-				.newInstance();
-		saxFact.setValidating(false);
-		saxFact.setXIncludeAware(false);
-		saxFact.setNamespaceAware(false);
-		try {
-			SAXParser sp = saxFact.newSAXParser();
-			VARNASessionParser sessionData = new VARNASessionParser();
-			sp.parse(fis, sessionData);
-			FullBackup res = new FullBackup(sessionData.getVARNAConfig(),
-					sessionData.getRNA(), "test"); 
-			return res;
-		} catch (ParserConfigurationException e) {
-			throw new ExceptionLoadingFailed("Bad XML parser configuration",
-					path);
-		} catch (SAXException e) {
-			throw new ExceptionLoadingFailed("XML parser Exception", path);
-		} catch (IOException e) {
-			throw new ExceptionLoadingFailed("I/O error", path);
-		}
-	}
-
-	public void loadFile(File path) {
-		loadFile(path, false);
-	}
-
-	public boolean getDrawBackbone() {
-		return _conf._drawBackbone;
-	}
-
-	public void setDrawBackbone(boolean b) {
-		_conf._drawBackbone = b;
-	}
-
-	public void addHighlightRegion(HighlightRegionAnnotation n) {
-		_RNA.addHighlightRegion(n);
-	}
-
-	public void removeHighlightRegion(HighlightRegionAnnotation n) {
-		_RNA.removeHighlightRegion(n);
-	}
-
-	public void addHighlightRegion(int i, int j) {
-		_RNA.addHighlightRegion(i, j);
-	}
-
-	public void addHighlightRegion(int i, int j, Color fill, Color outline,
-			double radius) {
-		_RNA.addHighlightRegion(i, j, fill, outline, radius);
-	}
-	
-	public void loadRNA(String path) {
-		loadRNA(path, false);
-	}
-	
-	public void loadRNA(Object path, boolean interpolate) { // BH was String
-		try {
-			Collection<RNA> rnas = (path instanceof File ? RNAFactory.loadSecStr(new FileReader((File) path)) : RNAFactory.loadSecStr(path.toString()));
-			if (rnas.isEmpty()) {
-				throw new ExceptionFileFormatOrSyntax(
-						"No RNA could be parsed from that source.");
-			}
-			RNA rna = rnas.iterator().next();
-			try {
-				rna.drawRNA(_conf);
-			} catch (ExceptionNAViewAlgorithm e) {
-				e.printStackTrace();
-			}
-			if (!interpolate) {
-				showRNA(rna);
-			} else {
-				this.showRNAInterpolated(rna);
-			}
-
-		} catch (FileNotFoundException e) {
-			e.printStackTrace();
-		} catch (ExceptionFileFormatOrSyntax e) {
-			e.printStackTrace();
-		} catch (Exception e) {
-			e.printStackTrace();
-		}
-	}
-
-	public void loadFile(File path, boolean interpolate) { // was String BH StringJS
-		try {
-			loadSession(path);
-		} catch (Exception e1) {
-			loadRNA(path, interpolate);
-		}
-	}
-
-	public void setConfig(VARNAConfig cfg) {
-		_conf = cfg;
-	}
-
-	public void toggleDrawOutlineBases() {
-		_conf._drawOutlineBases = !_conf._drawOutlineBases;
-	}
-
-	public void toggleFillBases() {
-		_conf._fillBases = !_conf._fillBases;
-	}
-
-	public void setDrawOutlineBases(boolean drawn) {
-		_conf._drawOutlineBases = drawn;
-	}
-
-	public void setFillBases(boolean drawn) {
-		_conf._fillBases = drawn;
-	}
-
-	public void readValues(Reader r) {
-		this._RNA.readValues(r, _conf._cm);
-	}
-
-	public void addVARNAListener(InterfaceVARNAListener v) {
-		_VARNAListeners.add(v);
-	}
-
-	public void fireLayoutChanged() {
-		for (InterfaceVARNAListener v : _VARNAListeners) {
-			v.onStructureRedrawn();
-		}
-	}
-
-	public void fireUINewStructure(RNA r) {
-		for (InterfaceVARNAListener v : _VARNAListeners) {
-			v.onUINewStructure(_conf, r);
-		}
-	}
-
-	public void fireZoomLevelChanged(double d) {
-		for (InterfaceVARNAListener v : _VARNAListeners) {
-			v.onZoomLevelChanged();
-		}
-	}
-
-	public void fireTranslationChanged() {
-		for (InterfaceVARNAListener v2 : _VARNAListeners) {
-			v2.onTranslationChanged();
-		}
-	}
-
-	public void addSelectionListener(InterfaceVARNASelectionListener v) {
-		_selectionListeners.add(v);
-	}
-
-	public void fireSelectionChanged(BaseList mold, BaseList mnew) {
-		BaseList addedBases = mnew.removeAll(mold);
-		BaseList removedBases = mold.removeAll(mnew);
-		for (InterfaceVARNASelectionListener v2 : _selectionListeners) {
-			v2.onSelectionChanged(mnew, addedBases, removedBases);
-		}
-	}
-
-	public void fireHoverChanged(ModeleBase mold, ModeleBase mnew) {
-		for (InterfaceVARNASelectionListener v2 : _selectionListeners) {
-			v2.onHoverChanged(mold, mnew);
-		}
-	}
-
-	public void addRNAListener(InterfaceVARNARNAListener v) {
-		_RNAListeners.add(v);
-	}
-
-	public void addVARNABasesListener(InterfaceVARNABasesListener l) {
-		_basesListeners.add(l);
-	}
-
-	public void fireSequenceChanged(int index, String oldseq, String newseq) {
-		for (InterfaceVARNARNAListener v2 : _RNAListeners) {
-			v2.onSequenceModified(index, oldseq, newseq);
-		}
-	}
-
-	public void fireStructureChanged(Set<ModeleBP> current,
-			Set<ModeleBP> addedBasePairs, Set<ModeleBP> removedBasePairs) {
-		for (InterfaceVARNARNAListener v2 : _RNAListeners) {
-			v2.onStructureModified(current, addedBasePairs, removedBasePairs);
-		}
-	}
-
-	public void fireLayoutChanged(
-			Hashtable<Integer, Point2D.Double> movedPositions) {
-		for (InterfaceVARNARNAListener v2 : _RNAListeners) {
-			v2.onRNALayoutChanged(movedPositions);
-		}
-	}
-
-	public void fireBaseClicked(ModeleBase mb, MouseEvent me) {
-		if (mb != null) {
-			for (InterfaceVARNABasesListener v2 : _basesListeners) {
-				v2.onBaseClicked(mb, me);
-			}
-		}
-	}
-
-	public double getOrientation() {
-		return _RNA.getOrientation();
-	}
-
-	public ModeleBase _hoveredBase = null;
-
-	public void setHoverBase(ModeleBase m) {
-		if (m != _hoveredBase) {
-			ModeleBase bck = _hoveredBase;
-			_hoveredBase = m;
-			repaint();
-			fireHoverChanged(bck, m);
-		}
-	}
-
-	public void toXML(String path) {
-		FileOutputStream fis;
-		try {
-			fis = new FileOutputStream(path);
-			// ZipOutputStream zis = new ZipOutputStream(new
-			// BufferedOutputStream(fis));
-			// ZipEntry entry = new ZipEntry("VARNASession");
-			// zis.putNextEntry(entry);
-			PrintWriter pw = new PrintWriter(fis);
-			toXML(pw);
-			pw.flush();
-			// zis.closeEntry();
-			// zis.close();
-			fis.close();
-		} catch (FileNotFoundException e) {
-			// TODO Auto-generated catch block
-			e.printStackTrace();
-		} catch (IOException e) {
-			// TODO Auto-generated catch block
-			e.printStackTrace();
-		}
-	}
-
-	public void toXML(PrintWriter out) {
-		try {
-
-			// out = new PrintWriter(System.out);
-			StreamResult streamResult = new StreamResult(out);
-			SAXTransformerFactory tf = (SAXTransformerFactory) SAXTransformerFactory
-					.newInstance();
-			// SAX2.0 ContentHandler.
-			TransformerHandler hd = tf.newTransformerHandler();
-			Transformer serializer = hd.getTransformer();
-			serializer.setOutputProperty(OutputKeys.ENCODING, "ISO-8859-1");
-			serializer
-					.setOutputProperty(OutputKeys.DOCTYPE_SYSTEM, "users.dtd");
-			serializer.setOutputProperty(OutputKeys.INDENT, "yes");
-			hd.setResult(streamResult);
-			hd.startDocument();
-			toXML(hd);
-			hd.endDocument();
-		} catch (TransformerConfigurationException e) {
-			// TODO Auto-generated catch block
-			e.printStackTrace();
-		} catch (SAXException e) {
-			// TODO Auto-generated catch block
-			e.printStackTrace();
-		}
-
-	}
-
-	public static String XML_ELEMENT_NAME = "VARNASession";
-
-	public void toXML(TransformerHandler hd) throws SAXException {
-		AttributesImpl atts = new AttributesImpl();
-		hd.startElement("", "", XML_ELEMENT_NAME, atts);
-		_RNA.toXML(hd);
-		_conf.toXML(hd);
-		hd.endElement("", "", XML_ELEMENT_NAME);
-	}
-
-	public TextAnnotation getNearestAnnotation(int x, int y) {
-		TextAnnotation t = null;
-		if (getListeAnnotations().size() != 0) {
-			double dist = Double.MAX_VALUE;
-			double d2;
-			Point2D.Double position;
-			for (TextAnnotation textAnnot : getListeAnnotations()) {
-				// calcul de la distance
-				position = textAnnot.getCenterPosition();
-				position = transformCoord(position);
-				d2 = Math.sqrt(Math.pow((position.x - x), 2)
-						+ Math.pow((position.y - y), 2));
-				// si la valeur est inferieur au minimum actuel
-				if ((dist > d2)
-						&& (d2 < getScaleFactor()
-								* ControleurClicMovement.MIN_SELECTION_DISTANCE)) {
-					t = textAnnot;
-					dist = d2;
-				}
-			}
-		}
-		return t;
-	}
-
-	public ModeleBase getNearestBase(int x, int y, boolean always,
-			boolean onlyPaired) {
-		int i = getNearestBaseIndex(x, y, always, onlyPaired);
-		if (i == -1)
-			return null;
-		return getRNA().get_listeBases().get(i);
-	}
-
-	public ModeleBase getNearestBase(int x, int y) {
-		return getNearestBase(x, y, false, false);
-	}
-
-	public int getNearestBaseIndex(int x, int y, boolean always,
-			boolean onlyPaired) {
-		double d2, dist = Double.MAX_VALUE;
-		int mb = -1;
-		for (int i = 0; i < getRealCoords().length; i++) {
-			if (!onlyPaired
-					|| (getRNA().get_listeBases().get(i).getElementStructure() != -1)) {
-				d2 = Math.sqrt(Math.pow((getRealCoords()[i].x - x), 2)
-						+ Math.pow((getRealCoords()[i].y - y), 2));
-				if ((dist > d2)
-						&& ((d2 < getScaleFactor()
-								* ControleurClicMovement.MIN_SELECTION_DISTANCE) || always)) {
-					dist = d2;
-					mb = i;
-				}
-			}
-		}
-		return mb;
-	}
-
-	public void globalRescale(double factor) {
-		_RNA.rescale(factor);
-		fireLayoutChanged();
-		repaint();
-	}
-
-	public void setSpaceBetweenBases(double sp) {
-		_conf._spaceBetweenBases = sp;
-	}
-
-	public double getSpaceBetweenBases() {
-		return _conf._spaceBetweenBases;
-	}
 
+        if (_debug || _drawBBox)
+        {
+          g2D.setColor(Color.GRAY);
+          g2D.setSelectionStroke();
+          g2D.drawRect(0, 0, getWidth() - 1,
+                  getHeight() - getTitleHeight() - 1);
+        }
+      }
+      // Draw annotations
+      renderAnnotations(g2D, offX, offY, offsetRNA.x, offsetRNA.y,
+              scaleFactor);
+      // Draw additional debug shape
+      if (_RNA._debugShape != null)
+      {
+        Color c = new Color(255, 0, 0, 50);
+        g2D.setColor(c);
+        AffineTransform at = new AffineTransform();
+        at.translate(offX - scaleFactor * rnabbox.x,
+                offY - scaleFactor * rnabbox.y);
+        at.scale(scaleFactor, scaleFactor);
+        Shape s = at.createTransformedShape(_RNA._debugShape);
+        if (s instanceof GeneralPath)
+        {
+          g2D.fill((GeneralPath) s);
+        }
+      }
+    }
+    else
+    {
+      g2D.setColor(VARNAConfig.DEFAULT_MESSAGE_COLOR);
+      g2D.setFont(VARNAConfig.DEFAULT_MESSAGE_FONT);
+      rnaMultiBox = new Rectangle2D.Double(0, 0, 10, 10);
+      g2D.drawStringCentered("No RNA here", bbox.getCenterX(),
+              bbox.getCenterY());
+    }
+    return rnaMultiBox;
+  }
+
+  public void centerViewOn(double x, double y)
+  {
+    Rectangle2D.Double r = _RNA.getBBox();
+    _target = new Point2D.Double(x, y);
+    Point2D.Double q = logicToPanel(_target);
+    Point p = new Point((int) (-q.x), (int) (-q.y));
+    setTranslation(p);
+    repaint();
+  }
+
+  Point2D.Double _target = new Point2D.Double(0, 0);
+
+  Point2D.Double _target2 = new Point2D.Double(0, 0);
+
+  public ModeleBase getBaseAt(Point2D.Double po)
+  {
+    ModeleBase mb = null;
+    Point2D.Double p = panelToLogicPoint(po);
+    double dist = Double.MAX_VALUE;
+    for (ModeleBase tmp : _RNA.get_listeBases())
+    {
+      double ndist = tmp.getCoords().distance(p);
+      if (dist > ndist)
+      {
+        mb = tmp;
+        dist = ndist;
+      }
+    }
+    return mb;
+  }
+
+  public void setColorMapValues(Double[] values)
+  {
+    _RNA.setColorMapValues(values, _conf._cm, true);
+    _conf._drawColorMap = true;
+    repaint();
+  }
+
+  public void setColorMapMaxValue(double d)
+  {
+    _conf._cm.setMaxValue(d);
+  }
+
+  public void setColorMapMinValue(double d)
+  {
+    _conf._cm.setMinValue(d);
+  }
+
+  public ModeleColorMap getColorMap()
+  {
+    return _conf._cm;
+  }
+
+  public void setColorMap(ModeleColorMap cm)
+  {
+    // _RNA.adaptColorMapToValues(cm);
+    _conf._cm = cm;
+    repaint();
+  }
+
+  public void setColorMapCaption(String caption)
+  {
+    _conf._colorMapCaption = caption;
+    repaint();
+  }
+
+  public String getColorMapCaption()
+  {
+    return _conf._colorMapCaption;
+  }
+
+  public void drawColorMap(boolean draw)
+  {
+    _conf._drawColorMap = draw;
+  }
+
+  private double getColorMapHeight()
+  {
+    double result = VARNAConfig.DEFAULT_COLOR_MAP_FONT_SIZE
+            + _conf._colorMapHeight;
+    if (!_conf._colorMapCaption.equals(""))
+      result += VARNAConfig.DEFAULT_COLOR_MAP_FONT_SIZE;
+    return result;
+  }
+
+  private void drawColorMap(VueVARNAGraphics g2D, double scaleFactor,
+          Rectangle2D.Double rnabbox)
+  {
+    double v1 = _conf._cm.getMinValue();
+    double v2 = _conf._cm.getMaxValue();
+    double x, y;
+    g2D.setPlainStroke();
+
+    double xSpaceAvail = 0;
+    double ySpaceAvail = Math.min(
+            (getHeight() - rnabbox.height * scaleFactor - getTitleHeight())
+                    / 2.0,
+            scaleFactor * (_conf._colorMapHeight
+                    + VARNAConfig.DEFAULT_COLOR_MAP_FONT_SIZE));
+    if ((int) ySpaceAvail == 0)
+    {
+      xSpaceAvail = Math.min((getWidth() - rnabbox.width * scaleFactor) / 2,
+              scaleFactor * (_conf._colorMapWidth)
+                      + VARNAConfig.DEFAULT_COLOR_MAP_STRIPE_WIDTH);
+    }
+    double xBase = (xSpaceAvail + _offX + scaleFactor * (rnabbox.width
+            - _conf._colorMapWidth - _conf._colorMapXOffset));
+    double hcaption = VARNAConfig.DEFAULT_COLOR_MAP_FONT_SIZE;
+    double yBase = (ySpaceAvail + _offY + scaleFactor * (rnabbox.height
+            - _conf._colorMapHeight - _conf._colorMapYOffset - hcaption));
+
+    for (int i = 0; i < _conf._colorMapWidth; i++)
+    {
+      double ratio = (((double) i) / ((double) _conf._colorMapWidth));
+      double val = v1 + (v2 - v1) * ratio;
+      g2D.setColor(_conf._cm.getColorForValue(val));
+      x = (xBase + scaleFactor * i);
+      y = yBase;
+      g2D.fillRect(x, y,
+              scaleFactor * VARNAConfig.DEFAULT_COLOR_MAP_STRIPE_WIDTH,
+              (scaleFactor * _conf._colorMapHeight));
+    }
+    g2D.setColor(VARNAConfig.DEFAULT_COLOR_MAP_OUTLINE);
+    g2D.drawRect(xBase, yBase,
+            (VARNAConfig.DEFAULT_COLOR_MAP_STRIPE_WIDTH - 1
+                    + scaleFactor * _conf._colorMapWidth),
+            ((scaleFactor * _conf._colorMapHeight)));
+    g2D.setFont(getFont().deriveFont((float) (scaleFactor
+            * VARNAConfig.DEFAULT_COLOR_MAP_FONT_SIZE)));
+    g2D.setColor(VARNAConfig.DEFAULT_COLOR_MAP_FONT_COLOR);
+    NumberFormat nf = NumberFormat.getInstance();
+    nf.setMaximumFractionDigits(2);
+    nf.setMinimumFractionDigits(0);
+    g2D.drawStringCentered(nf.format(_conf._cm.getMinValue()), xBase,
+            yBase + scaleFactor * (_conf._colorMapHeight
+                    + (VARNAConfig.DEFAULT_COLOR_MAP_FONT_SIZE / 1.7)));
+    g2D.drawStringCentered(nf.format(_conf._cm.getMaxValue()),
+            xBase + VARNAConfig.DEFAULT_COLOR_MAP_STRIPE_WIDTH
+                    + scaleFactor * _conf._colorMapWidth,
+            yBase + scaleFactor * (_conf._colorMapHeight
+                    + (VARNAConfig.DEFAULT_COLOR_MAP_FONT_SIZE / 1.7)));
+    if (!_conf._colorMapCaption.equals(""))
+      g2D.drawStringCentered("" + _conf._colorMapCaption,
+              xBase + scaleFactor * _conf._colorMapWidth / 2.0,
+              yBase + scaleFactor
+                      * (VARNAConfig.DEFAULT_COLOR_MAP_FONT_SIZE / 1.7
+                              + _conf._colorMapHeight));
+
+  }
+
+  public Point2D.Double panelToLogicPoint(Point2D.Double p)
+  {
+    return new Point2D.Double(
+            ((p.x - getOffsetPanel().x) / getScaleFactor())
+                    + getRNAOffset().x,
+            ((p.y - getOffsetPanel().y) / getScaleFactor())
+                    + getRNAOffset().y);
+  }
+
+  public Point2D.Double transformCoord(Point2D.Double coordDebut,
+          double offX, double offY, double rnaBBoxX, double rnaBBoxY,
+          double scaleFactor)
+  {
+    return new Point2D.Double(
+            offX + (scaleFactor * (coordDebut.x - rnaBBoxX)),
+            offY + (scaleFactor * (coordDebut.y - rnaBBoxY)));
+  }
+
+  public void eraseSequence()
+  {
+    _RNA.eraseSequence();
+  }
+
+  public Point2D.Double transformCoord(Point2D.Double coordDebut)
+  {
+    Rectangle2D.Double rnabbox = getExtendedRNABBox();
+    return new Point2D.Double(
+            _offX + (getScaleFactor() * (coordDebut.x - rnabbox.x)),
+            _offY + (getScaleFactor() * (coordDebut.y - rnabbox.y)));
+  }
+
+  public void paintComponent(Graphics g)
+  {
+    paintComponent(g, false);
+  }
+
+  public void paintComponent(Graphics g, boolean transparentBackground)
+  {
+    if (_premierAffichage)
+    {
+      // _border = new Dimension(0, 0);
+      _translation.x = 0;
+      _translation.y = (int) (-getTitleHeight() / 2.0);
+      _premierAffichage = false;
+    }
+
+    Graphics2D g2 = (Graphics2D) g;
+    Stroke dflt = g2.getStroke();
+    VueVARNAGraphics g2D = new SwingGraphics(g2);
+    g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING,
+            RenderingHints.VALUE_ANTIALIAS_ON);
+    this.removeAll();
+    super.paintComponent(g2);
+    renderComponent(g2D, transparentBackground, getScaleFactor());
+    if (isFocusOwner())
+    {
+      g2.setStroke(new BasicStroke(1.5f));
+      g2.setColor(Color.decode("#C0C0C0"));
+      g2.drawRect(0, 0, getWidth() - 1, getHeight() - 1);
+
+    }
+    g2.setStroke(dflt);
+    /*
+     * PSExport e = new PSExport(); SecStrProducerGraphics export = new
+     * SecStrProducerGraphics(e); renderRNA(export, getExtendedRNABBox());
+     * try { export.saveToDisk("./out.ps"); } catch
+     * (ExceptionWritingForbidden e1) { e1.printStackTrace(); }
+     */
+  }
+
+  /**
+   * Draws current RNA structure in a given Graphics "device".
+   * 
+   * @param g2D
+   *          A graphical device
+   * @param transparentBackground
+   *          Whether the background should be transparent, or drawn.
+   */
+  public synchronized void renderComponent(VueVARNAGraphics g2D,
+          boolean transparentBackground, double scaleFactor)
+  {
+
+    updateTitleHeight();
+
+    if (!transparentBackground)
+    {
+      g2D.setColor(_conf._backgroundColor);
+      g2D.fillRect(0, 0, getWidth(), getHeight());
+    }
+    else
+    {
+      super.setBackground(new Color(0, 0, 0, 120));
+    }
+
+    if (_debug || _drawBorder)
+    {
+      g2D.setColor(Color.BLACK);
+      g2D.setPlainStroke();
+      g2D.drawRect(getLeftOffset(), getTopOffset(), getInnerWidth(),
+              getInnerHeight());
+
+    }
+
+    // if (!transparentBackground) {
+    // super.setBackground(_conf._backgroundColor);
+    // } else {
+    // super.setBackground(new Color(0, 0, 0, 120));
+    // }
+
+    if (getMinimumSize().height < getSize().height
+            && getMinimumSize().width < getSize().width)
+    {
+      // Draw Title
+      if (!getTitle().equals(""))
+      {
+        g2D.setColor(_conf._titleColor);
+        g2D.setFont(_conf._titleFont);
+        g2D.drawStringCentered(getTitle(), this.getWidth() / 2,
+                this.getHeight() - getTitleHeight() / 2.0);
+      }
+      // Draw RNA
+      renderRNA(g2D, getClip(), true, _conf._autoCenter);
+    }
+    if (_selectionRectangle != null)
+    {
+      g2D.setColor(Color.BLACK);
+      g2D.setSelectionStroke();
+      g2D.drawRect(_selectionRectangle.x, _selectionRectangle.y,
+              _selectionRectangle.width, _selectionRectangle.height);
+    }
+    if ((_linkOrigin != null) && (_linkDestination != null))
+    {
+      g2D.setColor(_conf._bondColor);
+      g2D.setPlainStroke();
+      g2D.setStrokeThickness(3.0 * scaleFactor);
+      Point2D.Double linkOrigin = (_linkOrigin);
+      Point2D.Double linkDestination = (_linkDestination);
+      g2D.drawLine(linkOrigin.x, linkOrigin.y, linkDestination.x,
+              linkDestination.y);
+      for (int i : getSelection().getIndices())
+        drawBase(g2D, i, _realCoords, _realCenters,
+                scaleFactor * _RNA.BASE_RADIUS, scaleFactor, true);
+    }
+
+    if (_debug)
+    {
+      g2D.setStrokeThickness(3.0 * scaleFactor);
+      g2D.setColor(Color.black);
+      Point2D.Double t = this.logicToPanel(_target);
+      g2D.drawLine(t.x - 3, t.y - 3, t.x + 3, t.y + 3);
+      g2D.drawLine(t.x - 3, t.y + 3, t.x + 3, t.y - 3);
+      g2D.setColor(Color.red);
+      t = this.logicToPanel(_target2);
+      g2D.drawLine(t.x - 3, t.y - 3, t.x + 3, t.y + 3);
+      g2D.drawLine(t.x - 3, t.y + 3, t.x + 3, t.y - 3);
+    }
+  }
+
+  public void drawRegionHighlightsAnnotation(VueVARNAGraphics g2D,
+          Point2D.Double[] realCoords, Point2D.Double[] realCenters,
+          double scaleFactor)
+  {
+    g2D.setStrokeThickness(2.0 * scaleFactor);
+    g2D.setPlainStroke();
+    for (HighlightRegionAnnotation r : _RNA.getHighlightRegion())
+    {
+      GeneralPath s = r.getShape(realCoords, realCenters, scaleFactor);
+      g2D.setColor(r.getFillColor());
+      g2D.fill(s);
+      g2D.setColor(r.getOutlineColor());
+      g2D.draw(s);
+    }
+  }
+
+  private Rectangle2D.Double getClip()
+  {
+    return new Rectangle2D.Double(getLeftOffset(), getTopOffset(),
+            this.getInnerWidth(), this.getInnerHeight());
+  }
+
+  public Rectangle2D.Double getViewClip()
+  {
+    return new Rectangle2D.Double(this.getLeftOffset(), this.getTopOffset(),
+            this.getInnerWidth(), this.getInnerHeight());
+  }
+
+  /**
+   * Returns the color used to draw backbone bounds.
+   * 
+   * @return The color used to draw backbone bounds
+   */
+  public Color getBackboneColor()
+  {
+    return _conf._backboneColor;
+  }
+
+  /**
+   * Sets the color to be used for drawing backbone interactions.
+   * 
+   * @param backbone_color
+   *          The new color for the backbone bounds
+   */
+  public void setBackboneColor(Color backbone_color)
+  {
+    _conf._backboneColor = backbone_color;
+  }
+
+  /**
+   * Returns the color used to display hydrogen bonds (base pairings)
+   * 
+   * @return The color of hydrogen bonds
+   */
+  public Color getBondColor()
+  {
+    return _conf._bondColor;
+  }
+
+  /**
+   * Returns the title of this panel
+   * 
+   * @return The title
+   */
+  public String getTitle()
+  {
+    return _RNA.getName();
+  }
+
+  /**
+   * Sets the new color to be used for hydrogen bonds (base pairings)
+   * 
+   * @param bond_color
+   *          The new color for hydrogen bonds
+   */
+  public void setDefaultBPColor(Color bond_color)
+  {
+    _conf._bondColor = bond_color;
+  }
+
+  /**
+   * Sets the size of the border, i.e. the empty space between the end of the
+   * drawing area and the actual border.
+   * 
+   * @param b
+   *          The new border size
+   */
+  public void setBorderSize(Dimension b)
+  {
+    _border = b;
+  }
+
+  /**
+   * Returns the size of the border, i.e. the empty space between the end of the
+   * drawing area
+   * 
+   * @return The border size
+   */
+  public Dimension getBorderSize()
+  {
+    return _border;
+  }
+
+  /**
+   * Sets the RNA to be displayed within this Panel. This method does not use a
+   * drawing algorithm to reassigns base coordinates, rather assuming that the
+   * RNA was previously drawn.
+   * 
+   * @param r
+   *          An already drawn RNA to display in this panel
+   */
+  public synchronized void showRNA(RNA r)
+  {
+    fireUINewStructure(r);
+    _RNA = r;
+  }
+
+  /**
+   * Sets the RNA secondary structure to be drawn in this panel, using the
+   * default layout algorithm. In addition to the raw nucleotides sequence, the
+   * secondary structure is given in the so-called "Dot-bracket notation" (DBN)
+   * format. This format is a well-parenthesized word over the alphabet
+   * '(',')','.'.<br/>
+   * Ex:<code>((((((((....))))..(((((...))).))))))</code><br />
+   * Returns <code>true</code> if the sequence/structure couple could be parsed
+   * into a valid secondary structure, and <code>false</code> otherwise.
+   * 
+   * @param seq
+   *          The raw nucleotides sequence
+   * @param str
+   *          The secondary structure
+   * @throws ExceptionNonEqualLength
+   */
+  public void drawRNA(String seq, String str) throws ExceptionNonEqualLength
+  {
+    drawRNA(seq, str, _RNA.get_drawMode());
+  }
+
+  /**
+   * Sets the RNA secondary structure to be drawn in this panel, using a given
+   * layout algorithm.
+   * 
+   * @param r
+   *          The new secondary structure
+   * @param drawMode
+   *          The drawing algorithm
+   */
+  public void drawRNA(RNA r, int drawMode)
+  {
+    r.setDrawMode(drawMode);
+    drawRNA(r);
+  }
+
+  /**
+   * Redraws the current RNA. This reassigns base coordinates to their default
+   * value using the current drawing algorithm.
+   */
+
+  public void drawRNA()
+  {
+    try
+    {
+      _RNA.drawRNA(_RNA.get_drawMode(), _conf);
+    } catch (ExceptionNAViewAlgorithm e)
+    {
+      errorDialog(e);
+      e.printStackTrace();
+    }
+    repaint();
+  }
+
+  /**
+   * Sets the RNA secondary structure to be drawn in this panel, using the
+   * current drawing algorithm.
+   * 
+   * @param r
+   *          The new secondary structure
+   */
+  public void drawRNA(RNA r)
+  {
+    if (r != null)
+    {
+      _RNA = r;
+      drawRNA();
+    }
+  }
+
+  /**
+   * Sets the RNA secondary structure to be drawn in this panel, using a given
+   * layout algorithm. In addition to the raw nucleotides sequence, the
+   * secondary structure is given in the so-called "Dot-bracket notation" (DBN)
+   * format. This format is a well-parenthesized word over the alphabet
+   * '(',')','.'.<br/>
+   * Ex: <code>((((((((....))))..(((((...))).))))))</code><br />
+   * Returns <code>true</code> if the sequence/structure couple could be parsed
+   * into a valid secondary structure, and <code>false</code> otherwise.
+   * 
+   * @param seq
+   *          The raw nucleotides sequence
+   * @param str
+   *          The secondary structure
+   * @param drawMode
+   *          The drawing algorithm
+   * @throws ExceptionNonEqualLength
+   */
+  public void drawRNA(String seq, String str, int drawMode)
+          throws ExceptionNonEqualLength
+  {
+    _RNA.setDrawMode(drawMode);
+    try
+    {
+      _RNA.setRNA(seq, str);
+      drawRNA();
+    } catch (ExceptionUnmatchedClosingParentheses e)
+    {
+      errorDialog(e);
+    } catch (ExceptionFileFormatOrSyntax e1)
+    {
+      errorDialog(e1);
+    }
+  }
+
+  public void drawRNA(Reader r, int drawMode)
+          throws ExceptionNonEqualLength, ExceptionFileFormatOrSyntax
+  {
+    _RNA.setDrawMode(drawMode);
+    Collection<RNA> rnas = RNAFactory.loadSecStr(r);
+    if (rnas.isEmpty())
+    {
+      throw new ExceptionFileFormatOrSyntax(
+              "No RNA could be parsed from that source.");
+    }
+    _RNA = rnas.iterator().next();
+    drawRNA();
+  }
+
+  /**
+   * Draws a secondary structure of RNA using the default drawing algorithm and
+   * displays it, using an interpolated transition between the previous one and
+   * the new one. Extra bases, resulting from a size difference between the two
+   * successive RNAs, are assumed to initiate from the middle of the sequence.
+   * In other words, both prefixes and suffixes of the RNAs are assumed to
+   * match, and what remains is an insertion.
+   * 
+   * @param seq
+   *          Sequence
+   * @param str
+   *          Structure in dot bracket notation
+   * @throws ExceptionNonEqualLength
+   *           If len(seq)!=len(str)
+   */
+  public void drawRNAInterpolated(String seq, String str)
+          throws ExceptionNonEqualLength
+  {
+    drawRNAInterpolated(seq, str, _RNA.get_drawMode());
+  }
+
+  /**
+   * Draws a secondary structure of RNA using a given algorithm and displays it,
+   * using an interpolated transition between the previous one and the new one.
+   * Extra bases, resulting from a size difference between the two successive
+   * RNAs, are assumed to initiate from the middle of the sequence. In other
+   * words, both prefixes and suffixes of the RNAs are assumed to match, and
+   * what remains is an insertion.
+   * 
+   * @param seq
+   *          Sequence
+   * @param str
+   *          Structure in dot bracket notation
+   * @param drawMode
+   *          The drawing algorithm to be used for the initial placement
+   * @throws ExceptionNonEqualLength
+   *           If len(seq)!=len(str)
+   */
+  public void drawRNAInterpolated(String seq, String str, int drawMode)
+  {
+    drawRNAInterpolated(seq, str, drawMode, Mapping.DefaultOutermostMapping(
+            _RNA.get_listeBases().size(), str.length()));
+  }
+
+  /**
+   * Draws a secondary structure of RNA using the default drawing algorithm and
+   * displays it, using an interpolated transition between the previous one and
+   * the new one. Here, a mapping between those bases of the new structure and
+   * the previous one is explicitly provided.
+   * 
+   * @param seq
+   *          Sequence
+   * @param str
+   *          Structure in dot bracket notation
+   * @param m
+   *          A mapping between the currently rendered structure and its
+   *          successor (seq,str)
+   * @throws ExceptionNonEqualLength
+   *           If len(seq)!=len(str)
+   */
+  public void drawRNAInterpolated(String seq, String str, Mapping m)
+  {
+    drawRNAInterpolated(seq, str, _RNA.get_drawMode(), m);
+  }
+
+  /**
+   * Draws a secondary structure of RNA using a given drawing algorithm and
+   * displays it, using an interpolated transition between the previous one and
+   * the new one. Here, a mapping between those bases of the new structure and
+   * the previous one is provided.
+   * 
+   * @param seq
+   *          Sequence
+   * @param str
+   *          Structure in dot bracket notation
+   * @param drawMode
+   *          The drawing algorithm to be used for the initial placement
+   * @param m
+   *          A mapping between the currently rendered structure and its
+   *          successor (seq,str)
+   */
+  public void drawRNAInterpolated(String seq, String str, int drawMode,
+          Mapping m)
+  {
+    RNA target = new RNA();
+    try
+    {
+      target.setRNA(seq, str);
+      drawRNAInterpolated(target, drawMode, m);
+    } catch (ExceptionUnmatchedClosingParentheses e)
+    {
+      errorDialog(e);
+    } catch (ExceptionFileFormatOrSyntax e)
+    {
+      errorDialog(e);
+    }
+  }
+
+  /**
+   * Draws a secondary structure of RNA using the default drawing algorithm and
+   * displays it, using an interpolated transition between the previous one and
+   * the new one. Here, a mapping between those bases of the new structure and
+   * the previous one is explicitly provided.
+   * 
+   * @param target
+   *          Secondary structure
+   */
+  public void drawRNAInterpolated(RNA target)
+  {
+    drawRNAInterpolated(target, target.get_drawMode(),
+            Mapping.DefaultOutermostMapping(_RNA.get_listeBases().size(),
+                    target.getSize()));
+  }
+
+  /**
+   * Draws a secondary structure of RNA using the default drawing algorithm and
+   * displays it, using an interpolated transition between the previous one and
+   * the new one. Here, a mapping between those bases of the new structure and
+   * the previous one is explicitly provided.
+   * 
+   * @param target
+   *          Secondary structure
+   * @param m
+   *          A mapping between the currently rendered structure and its
+   *          successor (seq,str)
+   */
+  public void drawRNAInterpolated(RNA target, Mapping m)
+  {
+    drawRNAInterpolated(target, target.get_drawMode(), m);
+  }
+
+  /**
+   * Draws a secondary structure of RNA using a given drawing algorithm and
+   * displays it, using an interpolated transition between the previous one and
+   * the new one. Here, a mapping between those bases of the new structure and
+   * the previous one is provided.
+   * 
+   * @param target
+   *          Secondary structure of RNA
+   * @param drawMode
+   *          The drawing algorithm to be used for the initial placement
+   * @param m
+   *          A mapping between the currently rendered structure and its
+   *          successor (seq,str)
+   */
+  public void drawRNAInterpolated(RNA target, int drawMode, Mapping m)
+  {
+    try
+    {
+      target.drawRNA(drawMode, _conf);
+      _conf._drawColorMap = false;
+      _interpolator.addTarget(target, m);
+    } catch (ExceptionNAViewAlgorithm e)
+    {
+      errorDialog(e);
+      e.printStackTrace();
+    }
+  }
+
+  /**
+   * Returns the current algorithm used for drawing the structure
+   * 
+   * @return The current drawing algorithm
+   */
+  public int getDrawMode()
+  {
+    return this._RNA.getDrawMode();
+  }
+
+  public void showRNA(RNA t, VARNAConfig cfg)
+  {
+    showRNA(t);
+    if (cfg != null)
+    {
+      this.setConfig(cfg);
+    }
+    repaint();
+  }
+
+  /**
+   * Checks whether an interpolated transition bewteen two RNAs is occurring.
+   * 
+   * @return True if an interpolated transition is occurring, false otherwise
+   */
+
+  public boolean isInterpolationInProgress()
+  {
+    if (_interpolator == null)
+    {
+      return false;
+    }
+    else
+      return _interpolator.isInterpolationInProgress();
+  }
+
+  /**
+   * Simply displays (does not redraw) a secondary structure , using an
+   * interpolated transition between the previous one and the new one. A default
+   * mapping between those bases of the new structure and the previous one is
+   * used.
+   * 
+   * @param target
+   *          Secondary structure of RNA
+   */
+  public void showRNAInterpolated(RNA target)
+  {
+    showRNAInterpolated(target, Mapping.DefaultOutermostMapping(
+            _RNA.get_listeBases().size(), target.getSize()));
+  }
+
+  /**
+   * Simply displays (does not redraw) a secondary structure , using an
+   * interpolated transition between the previous one and the new one. Here, a
+   * mapping between bases of the new structure and the previous one is given.
+   * 
+   * @param target
+   *          Secondary structure of RNA
+   * @param m
+   *          A mapping between the currently rendered structure and its
+   *          successor (seq,str)
+   * @throws ExceptionNonEqualLength
+   *           If len(seq)!=len(str)
+   */
+  public void showRNAInterpolated(RNA target, Mapping m)
+  {
+    showRNAInterpolated(target, null, m);
+  }
+
+  public void showRNAInterpolated(RNA target, VARNAConfig cfg, Mapping m)
+  {
+    _interpolator.addTarget(target, cfg, m);
+  }
+
+  /**
+   * When comparison mode is ON, sets the two RNA secondary structure to be
+   * drawn in this panel, using a given layout algorithm. In addition to the raw
+   * nucleotides sequence, the secondary structure is given in the so-called
+   * "Dot-bracket notation" (DBN) format. This format is a well-parenthesized
+   * word over the alphabet '(',')','.'.<br/>
+   * Ex: <code>((((((((....))))..(((((...))).))))))</code><br />
+   * 
+   * @param firstSeq
+   *          The first RNA raw nucleotides sequence
+   * @param firstStruct
+   *          The first RNA secondary structure
+   * @param secondSeq
+   *          The second RNA raw nucleotides sequence
+   * @param secondStruct
+   *          The second RNA secondary structure
+   * @param drawMode
+   *          The drawing algorithm
+   */
+  public void drawRNA(String firstSeq, String firstStruct, String secondSeq,
+          String secondStruct, int drawMode)
+  {
+    _RNA.setDrawMode(drawMode);
+    /**
+     * Checking the sequences and structures validities...
+     */
+
+    // This is a comparison, so the two RNA alignment past in parameters
+    // must
+    // have the same sequence and structure length.
+    if (firstSeq.length() == secondSeq.length()
+            && firstStruct.length() == secondStruct.length())
+    {
+      // First RNA
+      if (firstSeq.length() != firstStruct.length())
+      {
+        if (_conf._showWarnings)
+        {
+          emitWarning("First sequence length " + firstSeq.length()
+                  + " differs from that of it's secondary structure "
+                  + firstStruct.length()
+                  + ". \nAdapting first sequence length ...");
+        }
+        if (firstSeq.length() < firstStruct.length())
+        {
+          while (firstSeq.length() < firstStruct.length())
+          {
+            firstSeq += " ";
+          }
+        }
+        else
+        {
+          firstSeq = firstSeq.substring(0, firstStruct.length());
+        }
+      }
+
+      // Second RNA
+      if (secondSeq.length() != secondStruct.length())
+      {
+        if (_conf._showWarnings)
+        {
+          emitWarning("Second sequence length " + secondSeq.length()
+                  + " differs from that of it's secondary structure "
+                  + secondStruct.length()
+                  + ". \nAdapting second sequence length ...");
+        }
+        if (secondSeq.length() < secondStruct.length())
+        {
+          while (secondSeq.length() < secondStruct.length())
+          {
+            secondSeq += " ";
+          }
+        }
+        else
+        {
+          secondSeq = secondSeq.substring(0, secondStruct.length());
+        }
+      }
+
+      int RNALength = firstSeq.length();
+      String string_superStruct = new String("");
+      String string_superSeq = new String("");
+      /**
+       * In this array, we'll have for each indexes of each characters of the
+       * final super-structure, the RNA number which is own it.
+       */
+      ArrayList<Integer> array_rnaOwn = new ArrayList<Integer>();
+
+      /**
+       * Generating super-structure sequences and structures...
+       */
+
+      firstStruct = firstStruct.replace('-', '.');
+      secondStruct = secondStruct.replace('-', '.');
+      // First of all, we make the structure
+      for (int i = 0; i < RNALength; i++)
+      {
+        // If both characters are the same, so it'll be in the super
+        // structure
+        if (firstStruct.charAt(i) == secondStruct.charAt(i))
+        {
+          string_superStruct = string_superStruct + firstStruct.charAt(i);
+          array_rnaOwn.add(0);
+        }
+        // Else if one of the characters is an opening parenthese, so
+        // it'll be an opening parenthese in the super structure
+        else if (firstStruct.charAt(i) == '('
+                || secondStruct.charAt(i) == '(')
+        {
+          string_superStruct = string_superStruct + '(';
+          array_rnaOwn.add((firstStruct.charAt(i) == '(') ? 1 : 2);
+        }
+        // Else if one of the characters is a closing parenthese, so
+        // it'll be a closing parenthese in the super structure
+        else if (firstStruct.charAt(i) == ')'
+                || secondStruct.charAt(i) == ')')
+        {
+          string_superStruct = string_superStruct + ')';
+          array_rnaOwn.add((firstStruct.charAt(i) == ')') ? 1 : 2);
+        }
+        else
+        {
+          string_superStruct = string_superStruct + '.';
+          array_rnaOwn.add(-1);
+        }
+      }
+
+      // Next, we make the sequence taking the characters at the same
+      // index in the first and second sequence
+      for (int i = 0; i < RNALength; i++)
+      {
+        string_superSeq = string_superSeq + firstSeq.charAt(i)
+                + secondSeq.charAt(i);
+      }
+
+      // Now, we need to create the super-structure RNA with the owning
+      // bases array
+      // in order to color bases outer depending on the owning statement
+      // of each bases.
+      if (!string_superSeq.equals("") && !string_superStruct.equals(""))
+      {
+        try
+        {
+          _RNA.setRNA(string_superSeq, string_superStruct, array_rnaOwn);
+        } catch (ExceptionUnmatchedClosingParentheses e)
+        {
+          errorDialog(e);
+        } catch (ExceptionFileFormatOrSyntax e)
+        {
+          errorDialog(e);
+        }
+      }
+      else
+      {
+        emitWarning("ERROR : The super-structure is NULL.");
+      }
+
+      switch (_RNA.get_drawMode())
+      {
+      case RNA.DRAW_MODE_RADIATE:
+        _RNA.drawRNARadiate(_conf);
+        break;
+      case RNA.DRAW_MODE_CIRCULAR:
+        _RNA.drawRNACircle(_conf);
+        break;
+      case RNA.DRAW_MODE_LINEAR:
+        _RNA.drawRNALine(_conf);
+        break;
+      case RNA.DRAW_MODE_NAVIEW:
+        try
+        {
+          _RNA.drawRNANAView(_conf);
+        } catch (ExceptionNAViewAlgorithm e)
+        {
+          errorDialog(e);
+        }
+        break;
+      default:
+        break;
+      }
+
+    }
+  }
+
+  /**
+   * Returns the currently selected base index, obtained through a mouse-left
+   * click
+   * 
+   * @return Selected base
+   * 
+   *         public int getSelectedBaseIndex() { return _selectedBase; }
+   * 
+   *         /** Returns the currently selected base, obtained through a
+   *         mouse-left click
+   * 
+   * @return Selected base
+   * 
+   *         public ModeleBase getSelectedBase() { return
+   *         _RNA.get_listeBases().get(_selectedBase); }
+   * 
+   *         /** Sets the selected base index
+   * 
+   * @param base
+   *          New selected base index
+   * 
+   *          public void setSelectedBase(int base) { _selectedBase = base; }
+   */
+
+  /**
+   * Returns the coordinates of the currently displayed RNA
+   * 
+   * @return Coordinates array
+   */
+  public Point2D.Double[] getRealCoords()
+  {
+    return _realCoords;
+  }
+
+  /**
+   * Sets the coordinates of the currently displayed RNA
+   * 
+   * @param coords
+   *          New coordinates
+   */
+  public void setRealCoords(Point2D.Double[] coords)
+  {
+    _realCoords = coords;
+  }
+
+  /**
+   * Returns the popup menu used for user mouse iteractions
+   * 
+   * @return Popup menu
+   */
+  public VueMenu getPopup()
+  {
+    return _popup;
+  }
+
+  /**
+   * Sets the color used to display hydrogen bonds (base pairings)
+   * 
+   * @param bond_color
+   *          The color of hydrogen bonds
+   */
+  public void setBondColor(Color bond_color)
+  {
+    _conf._bondColor = bond_color;
+  }
+
+  /**
+   * Returns the color used to draw the title
+   * 
+   * @return The color used to draw the title
+   */
+  public Color getTitleColor()
+  {
+    return _conf._titleColor;
+  }
+
+  /**
+   * Sets the color used to draw the title
+   * 
+   * @param title_color
+   *          The new color used to draw the title
+   */
+  public void setTitleColor(Color title_color)
+  {
+    _conf._titleColor = title_color;
+  }
+
+  /**
+   * Returns the height taken by the title
+   * 
+   * @return The height taken by the title
+   */
+  private int getTitleHeight()
+  {
+    return _titleHeight;
+  }
+
+  /**
+   * Sets the height taken by the title
+   * 
+   * @param title_height
+   *          The height taken by the title
+   */
+  @SuppressWarnings("unused")
+  private void setTitleHeight(int title_height)
+  {
+    _titleHeight = title_height;
+  }
+
+  /**
+   * Returns the current state of auto centering mode.
+   * 
+   * @return True if autocentered, false otherwise
+   */
+  public boolean isAutoCentered()
+  {
+    return _conf._autoCenter;
+  }
+
+  /**
+   * Sets the current state of auto centering mode.
+   * 
+   * @param center
+   *          New auto-centered state
+   */
+  public void setAutoCenter(boolean center)
+  {
+    _conf._autoCenter = center;
+  }
+
+  /**
+   * Returns the font currently used for rendering the title.
+   * 
+   * @return Current title font
+   */
+  public Font getTitleFont()
+  {
+    return _conf._titleFont;
+  }
+
+  /**
+   * Sets the font used for rendering the title.
+   * 
+   * @param font
+   *          New title font
+   */
+  public void setTitleFont(Font font)
+  {
+    _conf._titleFont = font;
+    updateTitleHeight();
+  }
+
+  /**
+   * For the LINE_MODE drawing algorithm, sets the base pair height increment,
+   * i.e. the vertical distance between two nested arcs.
+   * 
+   * @return The current base pair increment
+   */
+  public double getBPHeightIncrement()
+  {
+    return _RNA._bpHeightIncrement;
+  }
+
+  /**
+   * Sets the base pair height increment, i.e. the vertical distance between two
+   * arcs to be used in LINE_MODE.
+   * 
+   * @param inc
+   *          New height increment
+   */
+  public void setBPHeightIncrement(double inc)
+  {
+    _RNA._bpHeightIncrement = inc;
+  }
+
+  /**
+   * Returns the shifting of the origin of the Panel in zoom mode
+   * 
+   * @return The logical coordinate of the top-left panel point
+   */
+  public Point2D.Double getOffsetPanel()
+  {
+    return _offsetPanel;
+  }
+
+  /**
+   * Returns the vector bringing the logical coordinate of left-top-most point
+   * in the panel to the left-top-most point of the RNA.
+   * 
+   * @return The logical coordinate of the top-left panel point
+   */
+  private Point2D.Double getRNAOffset()
+  {
+    return _offsetRNA;
+  }
+
+  /**
+   * Returns this panel's UI menu
+   * 
+   * @return Applet's UI popupmenu
+   */
+  public VueMenu getPopupMenu()
+  {
+    return _popup;
+  }
+
+  /**
+   * Returns the atomic zoom factor step, or increment.
+   * 
+   * @return Atomic zoom factor increment
+   */
+  public double getZoomIncrement()
+  {
+    return _conf._zoomAmount;
+  }
+
+  /**
+   * Sets the atomic zoom factor step, or increment.
+   * 
+   * @param amount
+   *          Atomic zoom factor increment
+   */
+  public void setZoomIncrement(Object amount)
+  {
+    setZoomIncrement(Float.valueOf(amount.toString()));
+  }
+
+  /**
+   * Sets the atomic zoom factor step, or increment.
+   * 
+   * @param amount
+   *          Atomic zoom factor increment
+   */
+  public void setZoomIncrement(double amount)
+  {
+    _conf._zoomAmount = amount;
+  }
+
+  /**
+   * Returns the current zoom factor
+   * 
+   * @return Current zoom factor
+   */
+  public double getZoom()
+  {
+    return _conf._zoom;
+  }
+
+  /**
+   * Sets the current zoom factor
+   * 
+   * @param _zoom
+   *          New zoom factor
+   */
+  public void setZoom(Object _zoom)
+  {
+    double d = Float.valueOf(_zoom.toString());
+    if (_conf._zoom != d)
+    {
+      _conf._zoom = d;
+      fireZoomLevelChanged(d);
+    }
+  }
+
+  /**
+   * Returns the translation used for zooming in and out
+   * 
+   * @return A vector describing the translation
+   */
+  public Point getTranslation()
+  {
+    return _translation;
+  }
+
+  /**
+   * Sets the translation used for zooming in and out
+   * 
+   * @param trans
+   *          A vector describing the new translation
+   */
+  public void setTranslation(Point trans)
+  {
+    _translation = trans;
+    checkTranslation();
+    fireTranslationChanged();
+  }
+
+  /**
+   * Returns the current RNA model
+   * 
+   * @return Current RNA model
+   */
+  public RNA getRNA()
+  {
+    return _RNA;
+  }
+
+  /**
+   * Checks whether the drawn RNA is too large to be displayed, allowing for
+   * shifting mouse interactions.
+   * 
+   * @return true if the RNA is too large to be displayed, false otherwise
+   */
+  public boolean isOutOfFrame()
+  {
+    return _horsCadre;
+  }
+
+  /**
+   * Pops up an error Dialog displaying an exception in an human-readable way.
+   * 
+   * @param error
+   *          The exception to display within the Dialog
+   */
+  public void errorDialog(Exception error)
+  {
+    errorDialog(error, this);
+  }
+
+  /**
+   * Pops up an error Dialog displaying an exception in an human-readable way if
+   * errors are set to be displayed.
+   * 
+   * @see #setErrorsOn(boolean)
+   * @param error
+   *          The exception to display within the Dialog
+   * @param c
+   *          Parent component for the dialog box
+   */
+  public void errorDialog(Exception error, Component c)
+  {
+    if (isErrorsOn())
+    {
+      JOptionPane.showMessageDialog(c, error.getMessage(), "VARNA Error",
+              JOptionPane.ERROR_MESSAGE);
+    }
+  }
+
+  /**
+   * Pops up an error Dialog displaying an exception in an human-readable way.
+   * 
+   * @param error
+   *          The exception to display within the Dialog
+   * @param c
+   *          Parent component for the dialog box
+   */
+  public static void errorDialogStatic(Exception error, Component c)
+  {
+    if (c != null)
+    {
+      JOptionPane.showMessageDialog(c, error.getMessage(),
+              "VARNA Critical Error", JOptionPane.ERROR_MESSAGE);
+    }
+    else
+    {
+      System.err.println("Error: " + error.getMessage());
+    }
+  }
+
+  /**
+   * Displays a warning message through a modal dialog if warnings are set to be
+   * displayed.
+   * 
+   * @see #setShowWarnings(boolean)
+   * @param warning
+   *          A message expliciting the warning
+   */
+  public void emitWarning(String warning)
+  {
+    if (_conf._showWarnings)
+      JOptionPane.showMessageDialog(this, warning, "VARNA Warning",
+              JOptionPane.WARNING_MESSAGE);
+  }
+
+  public static void emitWarningStatic(Exception e, Component c)
+  {
+    emitWarningStatic(e.getMessage(), c);
+  }
+
+  public static void emitWarningStatic(String warning, Component c)
+  {
+    if (c != null)
+    {
+      JOptionPane.showMessageDialog(c, warning, "VARNA Warning",
+              JOptionPane.WARNING_MESSAGE);
+    }
+    else
+    {
+      System.err.println("Error: " + warning);
+    }
+  }
+
+  /**
+   * Toggles modifications on and off
+   * 
+   * @param modifiable
+   *          Modification status
+   */
+  public void setModifiable(boolean modifiable)
+  {
+    _conf._modifiable = modifiable;
+  }
+
+  /**
+   * Returns current modification status
+   * 
+   * @return current modification status
+   */
+  public boolean isModifiable()
+  {
+    return _conf._modifiable;
+  }
+
+  /**
+   * Resets the visual aspects (Zoom factor, shift) for the Panel.
+   */
+  public void reset()
+  {
+    this.setBorderSize(new Dimension(0, 0));
+    this.setTranslation(new Point(0, (int) (-getTitleHeight() / 2.0)));
+    this.setZoom(VARNAConfig.DEFAULT_ZOOM);
+    this.setZoomIncrement(VARNAConfig.DEFAULT_AMOUNT);
+  }
+
+  /**
+   * Returns the color used to draw non-standard bases
+   * 
+   * @return The color used to draw non-standard bases
+   */
+  public Color getNonStandardBasesColor()
+  {
+    return _conf._specialBasesColor;
+  }
+
+  /**
+   * Sets the color used to draw non-standard bases
+   * 
+   * @param basesColor
+   *          The color used to draw non-standard bases
+   */
+  public void setNonStandardBasesColor(Color basesColor)
+  {
+    _conf._specialBasesColor = basesColor;
+  }
+
+  /**
+   * Checks if the current translation doesn't "kick" the whole RNA out of the
+   * panel, and corrects the situation if necessary.
+   */
+  public void checkTranslation()
+  {
+    // verification pour un zoom < 1
+    if (this.getZoom() <= 1)
+    {
+      // verification sortie gauche
+      if (this.getTranslation().x < -(int) ((this.getWidth()
+              - this.getInnerWidth()) / 2.0))
+      {
+        this.setTranslation(new Point(
+                -(int) ((this.getWidth() - this.getInnerWidth()) / 2.0),
+                this.getTranslation().y));
+      }
+      // verification sortie droite
+      if (this.getTranslation().x > (int) ((this.getWidth()
+              - this.getInnerWidth()) / 2.0))
+      {
+        this.setTranslation(new Point(
+                (int) ((this.getWidth() - this.getInnerWidth()) / 2.0),
+                this.getTranslation().y));
+      }
+      // verification sortie bas
+      if (this.getTranslation().y > (int) ((this.getHeight()
+              - getTitleHeight() * 2 - this.getInnerHeight()) / 2.0))
+      {
+        this.setTranslation(new Point(this.getTranslation().x,
+                (int) ((this.getHeight() - getTitleHeight() * 2
+                        - this.getInnerHeight()) / 2.0)));
+      }
+      // verification sortie haut
+      if (this.getTranslation().y < -(int) ((this.getHeight()
+              - this.getInnerHeight()) / 2.0))
+      {
+        this.setTranslation(new Point(this.getTranslation().x,
+                -(int) ((this.getHeight() - this.getInnerHeight()) / 2.0)));
+      }
+    }
+    else
+    {
+      // zoom > 1
+      Rectangle r2 = getZoomedInTranslationBox();
+      int LBoundX = r2.x;
+      int UBoundX = r2.x + r2.width;
+      int LBoundY = r2.y;
+      int UBoundY = r2.y + r2.height;
+      if (this.getTranslation().x < LBoundX)
+      {
+        this.setTranslation(new Point(LBoundX, getTranslation().y));
+      }
+      else if (this.getTranslation().x > UBoundX)
+      {
+        this.setTranslation(new Point(UBoundX, getTranslation().y));
+      }
+      if (this.getTranslation().y < LBoundY)
+      {
+        this.setTranslation(new Point(getTranslation().x, LBoundY));
+      }
+      else if (this.getTranslation().y > UBoundY)
+      {
+        this.setTranslation(new Point(getTranslation().x, UBoundY));
+      }
+    }
+  }
+
+  public Rectangle getZoomedInTranslationBox()
+  {
+    int LBoundX = -(int) ((this.getInnerWidth()) / 2.0);
+    int UBoundX = (int) ((this.getInnerWidth()) / 2.0);
+    int LBoundY = -(int) ((this.getInnerHeight()) / 2.0);
+    int UBoundY = (int) ((this.getInnerHeight()) / 2.0);
+    return new Rectangle(LBoundX, LBoundY, UBoundX - LBoundX,
+            UBoundY - LBoundY);
+
+  }
+
+  /**
+   * Returns the "real pixels" x-coordinate of the RNA.
+   * 
+   * @return X-coordinate of the translation
+   */
+  public int getLeftOffset()
+  {
+    return _border.width + ((this.getWidth() - 2 * _border.width)
+            - this.getInnerWidth()) / 2 + _translation.x;
+  }
+
+  /**
+   * Returns the "real pixels" width of the drawing surface for our RNA.
+   * 
+   * @return Width of the drawing surface for our RNA
+   */
+  public int getInnerWidth()
+  {
+    // Largeur du dessin
+    return (int) Math
+            .round((this.getWidth() - 2 * _border.width) * _conf._zoom);
+  }
+
+  /**
+   * Returns the "real pixels" y-coordinate of the RNA.
+   * 
+   * @return Y-coordinate of the translation
+   */
+  public int getTopOffset()
+  {
+    return _border.height + ((this.getHeight() - 2 * _border.height)
+            - this.getInnerHeight()) / 2 + _translation.y;
+  }
+
+  /**
+   * Returns the "real pixels" height of the drawing surface for our RNA.
+   * 
+   * @return Height of the drawing surface for our RNA
+   */
+  public int getInnerHeight()
+  {
+    // Hauteur du dessin
+    return (int) Math.round((this.getHeight()) * _conf._zoom
+            - 2 * _border.height - getTitleHeight());
+  }
+
+  /**
+   * Checks if the current mode is the "comparison" mode
+   * 
+   * @return True if comparison, false otherwise
+   */
+  public boolean isComparisonMode()
+  {
+    return _conf._comparisonMode;
+  }
+
+  /**
+   * Rotates the RNA coordinates by a certain angle
+   * 
+   * @param angleDegres
+   *          Rotation angle, in degrees
+   */
+  public void globalRotation(Double angleDegres)
+  {
+    _RNA.globalRotation(angleDegres);
+    fireLayoutChanged();
+    repaint();
+  }
+
+  /**
+   * Returns the index of the currently selected base, defaulting to the closest
+   * base to the last mouse-click.
+   * 
+   * @return Index of the currently selected base
+   */
+  public Integer getNearestBase()
+  {
+    return _nearestBase;
+  }
+
+  /**
+   * Sets the index of the currently selected base.
+   * 
+   * @param base
+   *          Index of the new selected base
+   */
+  public void setNearestBase(Integer base)
+  {
+    _nearestBase = base;
+  }
+
+  /**
+   * Returns the color used to draw 'Gaps' bases in comparison mode
+   * 
+   * @return Color used for 'Gaps'
+   */
+  public Color getGapsBasesColor()
+  {
+    return _conf._dashBasesColor;
+  }
+
+  /**
+   * Sets the color to use for 'Gaps' bases in comparison mode
+   * 
+   * @param c
+   *          Color used for 'Gaps'
+   */
+  public void setGapsBasesColor(Color c)
+  {
+    _conf._dashBasesColor = c;
+  }
+
+  @SuppressWarnings("unused")
+  private void imprimer()
+  {
+    // PrintPanel canvas;
+    // canvas = new PrintPanel();
+    PrintRequestAttributeSet attributes;
+    attributes = new HashPrintRequestAttributeSet();
+    try
+    {
+      PrinterJob job = PrinterJob.getPrinterJob();
+      // job.setPrintable(this);
+      if (job.printDialog(attributes))
+      {
+        job.print(attributes);
+      }
+    } catch (PrinterException exception)
+    {
+      errorDialog(exception);
+    }
+  }
+
+  /**
+   * Checks whether errors are to be displayed
+   * 
+   * @return Error display status
+   */
+  public boolean isErrorsOn()
+  {
+    return _conf._errorsOn;
+  }
+
+  /**
+   * Sets whether errors are to be displayed
+   * 
+   * @param on
+   *          New error display status
+   */
+  public void setErrorsOn(boolean on)
+  {
+    _conf._errorsOn = on;
+  }
+
+  /**
+   * Returns the view associated with user interactions
+   * 
+   * @return A view associated with user interactions
+   */
+  public VueUI getVARNAUI()
+  {
+    return _UI;
+  }
+
+  /**
+   * Toggles on/off using base inner color for drawing base-pairs
+   * 
+   * @param on
+   *          True for using base inner color for drawing base-pairs, false for
+   *          classic mode
+   */
+  public void setUseBaseColorsForBPs(boolean on)
+  {
+    _conf._useBaseColorsForBPs = on;
+  }
+
+  /**
+   * Returns true if current base color is used as inner color for drawing
+   * base-pairs
+   * 
+   * @return True for using base inner color for drawing base-pairs, false for
+   *         classic mode
+   */
+  public boolean getUseBaseColorsForBPs()
+  {
+    return _conf._useBaseColorsForBPs;
+  }
+
+  /**
+   * Toggles on/off using a special color used for drawing "non-standard" bases
+   * 
+   * @param on
+   *          True for using a special color used for drawing "non-standard"
+   *          bases, false for classic mode
+   */
+  public void setColorNonStandardBases(boolean on)
+  {
+    _conf._colorSpecialBases = on;
+  }
+
+  /**
+   * Returns true if a special color is used as inner color for non-standard
+   * base
+   * 
+   * @return True for using a special color used for drawing "non-standard"
+   *         bases, false for classic mode
+   */
+  public boolean getColorSpecialBases()
+  {
+    return _conf._colorSpecialBases;
+  }
+
+  /**
+   * Toggles on/off using a special color used for drawing "Gaps" bases in
+   * comparison mode
+   * 
+   * @param on
+   *          True for using a special color used for drawing "Gaps" bases in
+   *          comparison mode, false for classic mode
+   */
+  public void setColorGapsBases(boolean on)
+  {
+    _conf._colorDashBases = on;
+  }
+
+  /**
+   * Returns true if a special color is used for drawing "Gaps" bases in
+   * comparison mode
+   * 
+   * @return True for using a special color used for drawing "Gaps" bases in
+   *         comparison mode, false for classic mode
+   */
+  public boolean getColorGapsBases()
+  {
+    return _conf._colorDashBases;
+  }
+
+  /**
+   * Toggles on/off displaying warnings
+   * 
+   * @param on
+   *          True to display warnings, false otherwise
+   */
+  public void setShowWarnings(boolean on)
+  {
+    _conf._showWarnings = on;
+  }
+
+  /**
+   * Get current warning display status
+   * 
+   * @return True to display warnings, false otherwise
+   */
+  public boolean getShowWarnings()
+  {
+    return _conf._showWarnings;
+  }
+
+  /**
+   * Toggles on/off displaying non-canonical base-pairs
+   * 
+   * @param on
+   *          True to display NC base-pairs, false otherwise
+   */
+  public void setShowNonCanonicalBP(boolean on)
+  {
+    _conf._drawnNonCanonicalBP = on;
+  }
+
+  /**
+   * Return the current display status for non-canonical base-pairs
+   * 
+   * @return True if NC base-pairs are displayed, false otherwise
+   */
+  public boolean getShowNonCanonicalBP()
+  {
+    return _conf._drawnNonCanonicalBP;
+  }
+
+  /**
+   * Toggles on/off displaying "non-planar" base-pairs
+   * 
+   * @param on
+   *          True to display "non-planar" base-pairs, false otherwise
+   */
+  public void setShowNonPlanarBP(boolean on)
+  {
+    _conf._drawnNonPlanarBP = on;
+  }
+
+  /**
+   * Return the current display status for non-planar base-pairs
+   * 
+   * @return True if non-planars base-pairs are displayed, false otherwise
+   */
+  public boolean getShowNonPlanarBP()
+  {
+    return _conf._drawnNonPlanarBP;
+  }
+
+  /**
+   * Sets the base-pair representation style
+   * 
+   * @param st
+   *          The new base-pair style
+   */
+  public void setBPStyle(VARNAConfig.BP_STYLE st)
+  {
+    _conf._mainBPStyle = st;
+  }
+
+  /**
+   * Returns the base-pair representation style
+   * 
+   * @return The current base-pair style
+   */
+  public VARNAConfig.BP_STYLE getBPStyle()
+  {
+    return _conf._mainBPStyle;
+  }
+
+  /**
+   * Returns the current VARNA Panel configuration. The returned instance should
+   * not be modified directly, but rather through the getters/setters from the
+   * VARNAPanel class.
+   * 
+   * @return Current configuration
+   */
+  public VARNAConfig getConfig()
+  {
+    return _conf;
+  }
+
+  /**
+   * Sets the background color
+   * 
+   * @param c
+   *          New background color
+   */
+  public void setBackground(Color c)
+  {
+    if (_conf != null)
+    {
+      if (c != null)
+      {
+        _conf._backgroundColor = c;
+        _conf._drawBackground = (!c
+                .equals(VARNAConfig.DEFAULT_BACKGROUND_COLOR));
+      }
+      else
+      {
+        _conf._backgroundColor = VARNAConfig.DEFAULT_BACKGROUND_COLOR;
+        _conf._drawBackground = false;
+      }
+    }
+
+  }
+
+  /**
+   * Starts highlighting the selected base.
+   */
+  public void highlightSelectedBase(ModeleBase m)
+  {
+    ArrayList<Integer> v = new ArrayList<Integer>();
+    int sel = m.getIndex();
+    if (sel != -1)
+    {
+      v.add(sel);
+    }
+    setSelection(v);
+  }
+
+  /**
+   * Starts highlighting the selected base.
+   */
+  public void highlightSelectedStem(ModeleBase m)
+  {
+    ArrayList<Integer> v = new ArrayList<Integer>();
+    int sel = m.getIndex();
+    if (sel != -1)
+    {
+      ArrayList<Integer> r = _RNA.findStem(sel);
+      v.addAll(r);
+    }
+    setSelection(v);
+  }
+
+  public BaseList getSelection()
+  {
+    return _selectedBases;
+  }
+
+  public ArrayList<Integer> getSelectionIndices()
+  {
+    return _selectedBases.getIndices();
+  }
+
+  public void setSelection(ArrayList<Integer> indices)
+  {
+    setSelection(_RNA.getBasesAt(indices));
+  }
+
+  public void setSelection(Collection<? extends ModeleBase> mbs)
+  {
+    BaseList bck = new BaseList(_selectedBases);
+    _selectedBases.clear();
+    _selectedBases.addBases(mbs);
+    _blink.setActive(true);
+    fireSelectionChanged(bck, _selectedBases);
+  }
+
+  public ArrayList<Integer> getBasesInRectangleDiff(Rectangle recIn,
+          Rectangle recOut)
+  {
+    ArrayList<Integer> result = new ArrayList<Integer>();
+    for (int i = 0; i < _realCoords.length; i++)
+    {
+      if (recIn.contains(_realCoords[i]) ^ recOut.contains(_realCoords[i]))
+        result.add(i);
+    }
+    return result;
+  }
+
+  public ArrayList<Integer> getBasesInRectangle(Rectangle rec)
+  {
+    ArrayList<Integer> result = new ArrayList<Integer>();
+    for (int i = 0; i < _realCoords.length; i++)
+    {
+      if (rec.contains(_realCoords[i]))
+        result.add(i);
+    }
+    return result;
+  }
+
+  public void setSelectionRectangle(Rectangle rec)
+  {
+    ArrayList<Integer> result = new ArrayList<Integer>();
+    if (_selectionRectangle != null)
+    {
+      result = getBasesInRectangleDiff(_selectionRectangle, rec);
+    }
+    else
+    {
+      result = getBasesInRectangle(rec);
+    }
+    _selectionRectangle = new Rectangle(rec);
+    toggleSelection(result);
+    repaint();
+  }
+
+  public void removeSelectionRectangle()
+  {
+    _selectionRectangle = null;
+  }
+
+  public void addToSelection(Collection<? extends Integer> indices)
+  {
+    for (int i : indices)
+    {
+      addToSelection(i);
+    }
+  }
+
+  public void addToSelection(int i)
+  {
+    BaseList bck = new BaseList(_selectedBases);
+    ModeleBase mb = _RNA.getBaseAt(i);
+    _selectedBases.addBase(mb);
+    _blink.setActive(true);
+    fireSelectionChanged(bck, _selectedBases);
+  }
+
+  public void removeFromSelection(int i)
+  {
+    BaseList bck = new BaseList(_selectedBases);
+    ModeleBase mb = _RNA.getBaseAt(i);
+    _selectedBases.removeBase(mb);
+    if (_selectedBases.size() == 0)
+    {
+      _blink.setActive(false);
+    }
+    else
+    {
+      _blink.setActive(true);
+    }
+    fireSelectionChanged(bck, _selectedBases);
+  }
+
+  public boolean isInSelection(int i)
+  {
+    return _selectedBases.contains(_RNA.getBaseAt(i));
+  }
+
+  public void toggleSelection(int i)
+  {
+    if (isInSelection(i))
+      removeFromSelection(i);
+    else
+      addToSelection(i);
+  }
+
+  public void toggleSelection(Collection<? extends Integer> indices)
+  {
+    for (int i : indices)
+    {
+      toggleSelection(i);
+    }
+  }
+
+  /**
+   * Stops highlighting bases
+   */
+  public void clearSelection()
+  {
+    BaseList bck = new BaseList(_selectedBases);
+    _selectedBases.clear();
+    _blink.setActive(false);
+    repaint();
+    fireSelectionChanged(bck, _selectedBases);
+  }
+
+  public void saveSelection()
+  {
+    _backupSelection.clear();
+    _backupSelection.addAll(_selectedBases.getBases());
+  }
+
+  public void restoreSelection()
+  {
+    setSelection(_backupSelection);
+  }
+
+  /**
+   * Stops highlighting bases
+   */
+  public void resetAnnotationHighlight()
+  {
+    _highlightAnnotation = false;
+    repaint();
+  }
+
+  /**
+   * Toggles on/off a rectangular outline of the bounding box.
+   * 
+   * @param on
+   *          True to draw the bounding box, false otherwise
+   */
+  public void drawBBox(boolean on)
+  {
+    _drawBBox = on;
+  }
+
+  /**
+   * Toggles on/off a rectangular outline of the border.
+   * 
+   * @param on
+   *          True to draw the bounding box, false otherwise
+   */
+  public void drawBorder(boolean on)
+  {
+    _drawBorder = on;
+  }
+
+  public void setBaseInnerColor(Color c)
+  {
+    _RNA.setBaseInnerColor(c);
+  }
+
+  public void setBaseNumbersColor(Color c)
+  {
+    _RNA.setBaseNumbersColor(c);
+  }
+
+  public void setBaseNameColor(Color c)
+  {
+    _RNA.setBaseNameColor(c);
+  }
+
+  public void setBaseOutlineColor(Color c)
+  {
+    _RNA.setBaseOutlineColor(c);
+  }
+
+  public ArrayList<TextAnnotation> getListeAnnotations()
+  {
+    return _RNA.getAnnotations();
+  }
+
+  public void resetListeAnnotations()
+  {
+    _RNA.clearAnnotations();
+    repaint();
+  }
+
+  public void addAnnotation(TextAnnotation textAnnotation)
+  {
+    _RNA.addAnnotation(textAnnotation);
+    repaint();
+  }
+
+  public boolean removeAnnotation(TextAnnotation textAnnotation)
+  {
+    boolean done = _RNA.removeAnnotation(textAnnotation);
+    repaint();
+    return done;
+  }
+
+  public TextAnnotation get_selectedAnnotation()
+  {
+    return _selectedAnnotation;
+  }
+
+  public void set_selectedAnnotation(TextAnnotation annotation)
+  {
+    _selectedAnnotation = annotation;
+  }
+
+  public void removeSelectedAnnotation()
+  {
+    _highlightAnnotation = false;
+    _selectedAnnotation = null;
+  }
+
+  public void highlightSelectedAnnotation()
+  {
+    _highlightAnnotation = true;
+  }
+
+  public boolean getFlatExteriorLoop()
+  {
+    return _conf._flatExteriorLoop;
+  }
+
+  public void setFlatExteriorLoop(boolean on)
+  {
+    _conf._flatExteriorLoop = on;
+  }
+
+  public void setLastSelectedPosition(Point2D.Double p)
+  {
+    _lastSelectedCoord.x = p.x;
+    _lastSelectedCoord.y = p.y;
+  }
+
+  public Point2D.Double getLastSelectedPosition()
+  {
+    return _lastSelectedCoord;
+  }
+
+  public void setSequence(String s)
+  {
+    _RNA.setSequence(s);
+    repaint();
+  }
+
+  public void setColorMapVisible(boolean b)
+  {
+    _conf._drawColorMap = b;
+    repaint();
+  }
+
+  public boolean getColorMapVisible()
+  {
+    return _conf._drawColorMap;
+  }
+
+  public void removeColorMap()
+  {
+    _conf._drawColorMap = false;
+    repaint();
+  }
+
+  public void saveSession(String path)
+  {
+    /*
+     * FileOutputStream fos = null; ObjectOutputStream out = null; try { fos
+     * = new FileOutputStream(path); out = new ObjectOutputStream(fos);
+     * out.writeObject(new FullBackup(_conf, _RNA, _conf._title));
+     * out.close(); } catch (Exception ex) { ex.printStackTrace(); }
+     */
+    toXML(path);
+  }
+
+  /** Added for Jalview */
+
+  public FullBackup loadSession(String path) throws ExceptionLoadingFailed
+  {
+    return loadSession(new File(path));
+  }
+
+  public FullBackup loadSession(File path) throws ExceptionLoadingFailed
+  {
+
+    FullBackup bck = importSession(path);
+    Mapping map = Mapping.DefaultOutermostMapping(getRNA().getSize(),
+            bck.rna.getSize());
+    showRNAInterpolated(bck.rna, map);
+    _conf = bck.config;
+    repaint();
+    return bck;
+  }
+
+  public static String VARNA_SESSION_EXTENSION = "varna";
+
+  public static FullBackup importSession(Object path) // BH was String
+          throws ExceptionLoadingFailed
+  {
+    try
+    {
+      FileInputStream fis = (path instanceof File
+              ? new FileInputStream((File) path)
+              : new FileInputStream(path.toString()));
+      // ZipInputStream zis = new
+      // ZipInputStream(new BufferedInputStream(fis));
+      // zis.getNextEntry();
+      FullBackup h = importSession(fis, path.toString());
+      // zis.close();
+      return h;
+    } catch (FileNotFoundException e)
+    {
+      throw (new ExceptionLoadingFailed("File not found.",
+              path.toString()));
+    } catch (IOException e)
+    {
+      // TODO Auto-generated catch block
+      throw (new ExceptionLoadingFailed("I/O error while loading session.",
+              path.toString()));
+    }
+  }
+
+  public static FullBackup importSession(InputStream fis, String path)
+          throws ExceptionLoadingFailed
+  {
+    System.setProperty("javax.xml.parsers.SAXParserFactory",
+            "com.sun.org.apache.xerces.internal.jaxp.SAXParserFactoryImpl");
+    SAXParserFactory saxFact = javax.xml.parsers.SAXParserFactory
+            .newInstance();
+    saxFact.setValidating(false);
+    saxFact.setXIncludeAware(false);
+    saxFact.setNamespaceAware(false);
+    try
+    {
+      SAXParser sp = saxFact.newSAXParser();
+      VARNASessionParser sessionData = new VARNASessionParser();
+      sp.parse(fis, sessionData);
+      FullBackup res = new FullBackup(sessionData.getVARNAConfig(),
+              sessionData.getRNA(), "test");
+      return res;
+    } catch (ParserConfigurationException e)
+    {
+      throw new ExceptionLoadingFailed("Bad XML parser configuration",
+              path);
+    } catch (SAXException e)
+    {
+      throw new ExceptionLoadingFailed("XML parser Exception", path);
+    } catch (IOException e)
+    {
+      throw new ExceptionLoadingFailed("I/O error", path);
+    }
+  }
+
+  public void loadFile(File path)
+  {
+    loadFile(path, false);
+  }
+
+  public boolean getDrawBackbone()
+  {
+    return _conf._drawBackbone;
+  }
+
+  public void setDrawBackbone(boolean b)
+  {
+    _conf._drawBackbone = b;
+  }
+
+  public void addHighlightRegion(HighlightRegionAnnotation n)
+  {
+    _RNA.addHighlightRegion(n);
+  }
+
+  public void removeHighlightRegion(HighlightRegionAnnotation n)
+  {
+    _RNA.removeHighlightRegion(n);
+  }
+
+  public void addHighlightRegion(int i, int j)
+  {
+    _RNA.addHighlightRegion(i, j);
+  }
+
+  public void addHighlightRegion(int i, int j, Color fill, Color outline,
+          double radius)
+  {
+    _RNA.addHighlightRegion(i, j, fill, outline, radius);
+  }
+
+  public void loadRNA(String path)
+  {
+    loadRNA(path, false);
+  }
+
+  public void loadRNA(Object path, boolean interpolate)
+  { // BH was String
+    try
+    {
+      Collection<RNA> rnas = (path instanceof File
+              ? RNAFactory.loadSecStr(new FileReader((File) path))
+              : RNAFactory.loadSecStr(path.toString()));
+      if (rnas.isEmpty())
+      {
+        throw new ExceptionFileFormatOrSyntax(
+                "No RNA could be parsed from that source.");
+      }
+      RNA rna = rnas.iterator().next();
+      try
+      {
+        rna.drawRNA(_conf);
+      } catch (ExceptionNAViewAlgorithm e)
+      {
+        e.printStackTrace();
+      }
+      if (!interpolate)
+      {
+        showRNA(rna);
+      }
+      else
+      {
+        this.showRNAInterpolated(rna);
+      }
+
+    } catch (FileNotFoundException e)
+    {
+      e.printStackTrace();
+    } catch (ExceptionFileFormatOrSyntax e)
+    {
+      e.printStackTrace();
+    } catch (Exception e)
+    {
+      e.printStackTrace();
+    }
+  }
+
+  public void loadFile(File path, boolean interpolate)
+  { // was String BH StringJS
+    try
+    {
+      loadSession(path);
+    } catch (Exception e1)
+    {
+      loadRNA(path, interpolate);
+    }
+  }
+
+  public void setConfig(VARNAConfig cfg)
+  {
+    _conf = cfg;
+  }
+
+  public void toggleDrawOutlineBases()
+  {
+    _conf._drawOutlineBases = !_conf._drawOutlineBases;
+  }
+
+  public void toggleFillBases()
+  {
+    _conf._fillBases = !_conf._fillBases;
+  }
+
+  public void setDrawOutlineBases(boolean drawn)
+  {
+    _conf._drawOutlineBases = drawn;
+  }
+
+  public void setFillBases(boolean drawn)
+  {
+    _conf._fillBases = drawn;
+  }
+
+  public void readValues(Reader r)
+  {
+    this._RNA.readValues(r, _conf._cm);
+  }
+
+  public void addVARNAListener(InterfaceVARNAListener v)
+  {
+    _VARNAListeners.add(v);
+  }
+
+  public void fireLayoutChanged()
+  {
+    for (InterfaceVARNAListener v : _VARNAListeners)
+    {
+      v.onStructureRedrawn();
+    }
+  }
+
+  public void fireUINewStructure(RNA r)
+  {
+    for (InterfaceVARNAListener v : _VARNAListeners)
+    {
+      v.onUINewStructure(_conf, r);
+    }
+  }
+
+  public void fireZoomLevelChanged(double d)
+  {
+    for (InterfaceVARNAListener v : _VARNAListeners)
+    {
+      v.onZoomLevelChanged();
+    }
+  }
+
+  public void fireTranslationChanged()
+  {
+    for (InterfaceVARNAListener v2 : _VARNAListeners)
+    {
+      v2.onTranslationChanged();
+    }
+  }
+
+  public void addSelectionListener(InterfaceVARNASelectionListener v)
+  {
+    _selectionListeners.add(v);
+  }
+
+  public void fireSelectionChanged(BaseList mold, BaseList mnew)
+  {
+    BaseList addedBases = mnew.removeAll(mold);
+    BaseList removedBases = mold.removeAll(mnew);
+    for (InterfaceVARNASelectionListener v2 : _selectionListeners)
+    {
+      v2.onSelectionChanged(mnew, addedBases, removedBases);
+    }
+  }
+
+  public void fireHoverChanged(ModeleBase mold, ModeleBase mnew)
+  {
+    for (InterfaceVARNASelectionListener v2 : _selectionListeners)
+    {
+      v2.onHoverChanged(mold, mnew);
+    }
+  }
+
+  public void addRNAListener(InterfaceVARNARNAListener v)
+  {
+    _RNAListeners.add(v);
+  }
+
+  public void addVARNABasesListener(InterfaceVARNABasesListener l)
+  {
+    _basesListeners.add(l);
+  }
+
+  public void fireSequenceChanged(int index, String oldseq, String newseq)
+  {
+    for (InterfaceVARNARNAListener v2 : _RNAListeners)
+    {
+      v2.onSequenceModified(index, oldseq, newseq);
+    }
+  }
+
+  public void fireStructureChanged(Set<ModeleBP> current,
+          Set<ModeleBP> addedBasePairs, Set<ModeleBP> removedBasePairs)
+  {
+    for (InterfaceVARNARNAListener v2 : _RNAListeners)
+    {
+      v2.onStructureModified(current, addedBasePairs, removedBasePairs);
+    }
+  }
+
+  public void fireLayoutChanged(
+          Hashtable<Integer, Point2D.Double> movedPositions)
+  {
+    for (InterfaceVARNARNAListener v2 : _RNAListeners)
+    {
+      v2.onRNALayoutChanged(movedPositions);
+    }
+  }
+
+  public void fireBaseClicked(ModeleBase mb, MouseEvent me)
+  {
+    if (mb != null)
+    {
+      for (InterfaceVARNABasesListener v2 : _basesListeners)
+      {
+        v2.onBaseClicked(mb, me);
+      }
+    }
+  }
+
+  public double getOrientation()
+  {
+    return _RNA.getOrientation();
+  }
+
+  public ModeleBase _hoveredBase = null;
+
+  public void setHoverBase(ModeleBase m)
+  {
+    if (m != _hoveredBase)
+    {
+      ModeleBase bck = _hoveredBase;
+      _hoveredBase = m;
+      repaint();
+      fireHoverChanged(bck, m);
+    }
+  }
+
+  public void toXML(String path)
+  {
+    FileOutputStream fis;
+    try
+    {
+      fis = new FileOutputStream(path);
+      // ZipOutputStream zis = new ZipOutputStream(new
+      // BufferedOutputStream(fis));
+      // ZipEntry entry = new ZipEntry("VARNASession");
+      // zis.putNextEntry(entry);
+      PrintWriter pw = new PrintWriter(fis);
+      toXML(pw);
+      pw.flush();
+      // zis.closeEntry();
+      // zis.close();
+      fis.close();
+    } catch (FileNotFoundException e)
+    {
+      // TODO Auto-generated catch block
+      e.printStackTrace();
+    } catch (IOException e)
+    {
+      // TODO Auto-generated catch block
+      e.printStackTrace();
+    }
+  }
+
+  public void toXML(PrintWriter out)
+  {
+    try
+    {
+
+      // out = new PrintWriter(System.out);
+      StreamResult streamResult = new StreamResult(out);
+      SAXTransformerFactory tf = (SAXTransformerFactory) SAXTransformerFactory
+              .newInstance();
+      // SAX2.0 ContentHandler.
+      TransformerHandler hd = tf.newTransformerHandler();
+      Transformer serializer = hd.getTransformer();
+      serializer.setOutputProperty(OutputKeys.ENCODING, "ISO-8859-1");
+      serializer.setOutputProperty(OutputKeys.DOCTYPE_SYSTEM, "users.dtd");
+      serializer.setOutputProperty(OutputKeys.INDENT, "yes");
+      hd.setResult(streamResult);
+      hd.startDocument();
+      toXML(hd);
+      hd.endDocument();
+    } catch (TransformerConfigurationException e)
+    {
+      // TODO Auto-generated catch block
+      e.printStackTrace();
+    } catch (SAXException e)
+    {
+      // TODO Auto-generated catch block
+      e.printStackTrace();
+    }
+
+  }
+
+  public static String XML_ELEMENT_NAME = "VARNASession";
+
+  public void toXML(TransformerHandler hd) throws SAXException
+  {
+    AttributesImpl atts = new AttributesImpl();
+    hd.startElement("", "", XML_ELEMENT_NAME, atts);
+    _RNA.toXML(hd);
+    _conf.toXML(hd);
+    hd.endElement("", "", XML_ELEMENT_NAME);
+  }
+
+  public TextAnnotation getNearestAnnotation(int x, int y)
+  {
+    TextAnnotation t = null;
+    if (getListeAnnotations().size() != 0)
+    {
+      double dist = Double.MAX_VALUE;
+      double d2;
+      Point2D.Double position;
+      for (TextAnnotation textAnnot : getListeAnnotations())
+      {
+        // calcul de la distance
+        position = textAnnot.getCenterPosition();
+        position = transformCoord(position);
+        d2 = Math.sqrt(Math.pow((position.x - x), 2)
+                + Math.pow((position.y - y), 2));
+        // si la valeur est inferieur au minimum actuel
+        if ((dist > d2) && (d2 < getScaleFactor()
+                * ControleurClicMovement.MIN_SELECTION_DISTANCE))
+        {
+          t = textAnnot;
+          dist = d2;
+        }
+      }
+    }
+    return t;
+  }
+
+  public ModeleBase getNearestBase(int x, int y, boolean always,
+          boolean onlyPaired)
+  {
+    int i = getNearestBaseIndex(x, y, always, onlyPaired);
+    if (i == -1)
+      return null;
+    return getRNA().get_listeBases().get(i);
+  }
+
+  public ModeleBase getNearestBase(int x, int y)
+  {
+    return getNearestBase(x, y, false, false);
+  }
+
+  public int getNearestBaseIndex(int x, int y, boolean always,
+          boolean onlyPaired)
+  {
+    double d2, dist = Double.MAX_VALUE;
+    int mb = -1;
+    for (int i = 0; i < getRealCoords().length; i++)
+    {
+      if (!onlyPaired || (getRNA().get_listeBases().get(i)
+              .getElementStructure() != -1))
+      {
+        d2 = Math.sqrt(Math.pow((getRealCoords()[i].x - x), 2)
+                + Math.pow((getRealCoords()[i].y - y), 2));
+        if ((dist > d2) && ((d2 < getScaleFactor()
+                * ControleurClicMovement.MIN_SELECTION_DISTANCE) || always))
+        {
+          dist = d2;
+          mb = i;
+        }
+      }
+    }
+    return mb;
+  }
+
+  public void globalRescale(double factor)
+  {
+    _RNA.rescale(factor);
+    fireLayoutChanged();
+    repaint();
+  }
+
+  public void setSpaceBetweenBases(double sp)
+  {
+    _conf._spaceBetweenBases = sp;
+  }
+
+  public double getSpaceBetweenBases()
+  {
+    return _conf._spaceBetweenBases;
+  }
 
 }
diff --git a/srcjar/fr/orsay/lri/varna/applications/VARNAEditor.java b/srcjar/fr/orsay/lri/varna/applications/VARNAEditor.java
index 818cfda..1495bcb 100644
--- a/srcjar/fr/orsay/lri/varna/applications/VARNAEditor.java
+++ b/srcjar/fr/orsay/lri/varna/applications/VARNAEditor.java
@@ -2,7 +2,7 @@
  VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases.
  Copyright (C) 2008  Kevin Darty, Alain Denise and Yann Ponty.
  electronic mail : Yann.Ponty@lri.fr
- paper mail : LRI, bat 490 Université Paris-Sud 91405 Orsay Cedex France
+ paper mail : LRI, bat 490 Universit� Paris-Sud 91405 Orsay Cedex France
 
  This file is part of VARNA version 3.1.
  VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License
@@ -86,574 +86,574 @@ import fr.orsay.lri.varna.models.rna.RNA;
 
 public class VARNAEditor extends JFrame implements DropTargetListener, InterfaceVARNAListener, MouseListener {
 
-	/**
-	 * 
-	 */
-//	private static final_long serialVersionUID = -790155708306987257L;
-
-	private static final String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA";
-
-	private static final String DEFAULT_STRUCTURE1 = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...)))))..";
-	private static final String DEFAULT_STRUCTURE2 = "..(((((...(((((...(((((........(((((...(((((.....)))))...)))))..................))))).....)))))...)))))..";
-	// private static final String DEFAULT_STRUCTURE1 = "((((....))))";
-	// private static final String DEFAULT_STRUCTURE2 =
-	// "((((..(((....)))..))))";
-
-	private VARNAPanel _vp;
-
-	private JPanel _tools = new JPanel();
-	private JPanel _input = new JPanel();
-
-	private JPanel _seqPanel = new JPanel();
-	private JPanel _strPanel = new JPanel();
-	private JLabel _info = new JLabel();
-	
-	private JTextField _str = new JTextField(DEFAULT_STRUCTURE1);
-	Object _hoverHighlightStr = null;
-	ArrayList<Object> _selectionHighlightStr = new ArrayList<Object>();
-	
-	private JTextField _seq = new JTextField(DEFAULT_SEQUENCE);
-	Object _hoverHighlightSeq = null;
-	ArrayList<Object> _selectionHighlightSeq = new ArrayList<Object>();
-	
-	
-	private JLabel _strLabel = new JLabel(" Str:");
-	private JLabel _seqLabel = new JLabel(" Seq:");
-	private JButton _deleteButton = new JButton("Delete");
-	private JButton _duplicateButton = new JButton("Duplicate");
-	
-	private JPanel _listPanel = new JPanel();
-	private ReorderableJList _sideList = null;
-
-
-
-	private static String errorOpt = "error";
-	@SuppressWarnings("unused")
-	private boolean _error;
-
-	private Color _backgroundColor = Color.white;
-
-	private static int _nextID = 1;
-	@SuppressWarnings("unused")
-	private int _algoCode;
-	
-	private BackupHolder _rnaList;
-
-
-	public VARNAEditor() {
-		super("VARNA Editor");
-		RNAPanelDemoInit();
-	}
-
-	private void RNAPanelDemoInit() 
-	{
-	    DefaultListModel dlm = new DefaultListModel(); 
-	    
-
-		int marginTools = 40;
-
-	    DefaultListSelectionModel m = new DefaultListSelectionModel();
-	    m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
-	    m.setLeadAnchorNotificationEnabled(false);
-	    
-	    
-		_sideList = new ReorderableJList();
-		_sideList.setModel(dlm);
-		_sideList.addMouseListener(this);
-	    _sideList.setSelectionModel(m);
-	    _sideList.setPreferredSize(new Dimension(100, 0));
-	    _sideList.addListSelectionListener(	new ListSelectionListener(){
-			public void valueChanged(ListSelectionEvent arg0) {
-				//System.out.println(arg0);
-				if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
-				{
-					FullBackup  sel = (FullBackup) _sideList.getSelectedValue();
-					Mapping map = Mapping.DefaultOutermostMapping(_vp.getRNA().getSize(), sel.rna.getSize());
-					_vp.showRNAInterpolated(sel.rna,sel.config,map);
-					_seq.setText(sel.rna.getSeq());
-					_str.setText(sel.rna.getStructDBN(true));
-				}
-			}
-	    });
-
-	    _rnaList = new BackupHolder(dlm,_sideList);
-		RNA _RNA1 = new RNA("User defined 1");
-		RNA _RNA2 = new RNA("User defined 2");
-		try {
-			_vp = new VARNAPanel("0",".");
-			_RNA1.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE1);
-			_RNA1.drawRNARadiate(_vp.getConfig());
-			_RNA2.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE2);
-			_RNA2.drawRNARadiate(_vp.getConfig());
-		} catch (ExceptionNonEqualLength e) {
-			_vp.errorDialog(e);
-		} catch (ExceptionUnmatchedClosingParentheses e2) {
-		e2.printStackTrace();
-		} catch (ExceptionFileFormatOrSyntax e3) {
-		e3.printStackTrace();
-		}
-		_vp.setPreferredSize(new Dimension(400, 400));
-		// 
-		
-		 // BH 2018 this will NOT be a clone in SwingJS
-	    _rnaList.add(_vp.getConfig().clone(),_RNA2,generateDefaultName());
-	    _rnaList.add(_vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
-
-	    JScrollPane listScroller = new JScrollPane(_sideList);
-	    listScroller.setPreferredSize(new Dimension(150, 0));
-
-		setBackground(_backgroundColor);
-		_vp.setBackground(_backgroundColor);
-
-
-		Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
-
-		_seqLabel.setHorizontalTextPosition(JLabel.LEFT);
-		_seqLabel.setPreferredSize(new Dimension(marginTools, 15));
-		_seq.setFont(textFieldsFont);
-		_seq.setText(DEFAULT_SEQUENCE);
-		_seq.setEditable(false);
-		
-
-		_seqPanel.setLayout(new BorderLayout());
-		_seqPanel.add(_seqLabel, BorderLayout.WEST);
-		_seqPanel.add(_seq, BorderLayout.CENTER);
-
-		_strLabel.setPreferredSize(new Dimension(marginTools, 15));
-		_strLabel.setHorizontalTextPosition(JLabel.LEFT);
-		_str.setFont(textFieldsFont);
-		_str.setEditable(false);
-		_strPanel.setLayout(new BorderLayout());
-		_strPanel.add(_strLabel, BorderLayout.WEST);
-		_strPanel.add(_str, BorderLayout.CENTER);
-
-		_input.setLayout(new GridLayout(2, 0));
-		_input.add(_seqPanel);
-		_input.add(_strPanel);
-
-
-		_tools.setLayout(new BorderLayout());
-		_tools.add(_input, BorderLayout.CENTER);
-		_tools.add(_info, BorderLayout.SOUTH);
-
-		_deleteButton.addActionListener(new ActionListener() {
-			public void actionPerformed(ActionEvent e) {
-				_rnaList.removeSelected();
-			}
-		});
-//		_duplicateButton.addActionListener(new ActionListener() {
-//			public void actionPerformed(ActionEvent e) {
-//					_rnaList.add((VARNAConfig)_vp.getConfig().clone(),_vp.getRNA().clone(),_vp.getRNA().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new Date()),true); 
-//			}});
-		
-		JPanel ops = new JPanel();
-		ops.setLayout(new GridLayout(1,2));
-		ops.add(_deleteButton);
-		ops.add(_duplicateButton);
-
-		JLabel j = new JLabel("Structures",JLabel.CENTER);
-		_listPanel.setLayout(new BorderLayout());
-		
-		_listPanel.add(ops,BorderLayout.SOUTH);
-		_listPanel.add(j,BorderLayout.NORTH);
-		_listPanel.add(listScroller,BorderLayout.CENTER);
-
-
-		JSplitPane split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,_vp);
-		getContentPane().setLayout(new BorderLayout());
-		getContentPane().add(split, BorderLayout.CENTER);
-		getContentPane().add(_tools, BorderLayout.NORTH);
-
-		setVisible(true);
-		DropTarget dt = new DropTarget(_vp, this);
-		
-		_vp.addRNAListener(new InterfaceVARNARNAListener(){
-			public void onSequenceModified(int index, String oldseq, String newseq) {
-				_seq.setText(_vp.getRNA().getSeq());
-			}
-
-			public void onStructureModified(Set<ModeleBP> current,
-					Set<ModeleBP> addedBasePairs, Set<ModeleBP> removedBasePairs) {
-				_str.setText(_vp.getRNA().getStructDBN(true));
-			}
-
-			public void onRNALayoutChanged(Hashtable<Integer, Double> previousPositions) {
-			}
-			
-		});
-		
-		_vp.addSelectionListener(new InterfaceVARNASelectionListener(){
-
-			public void onHoverChanged(ModeleBase oldbase, ModeleBase newBase) {
-				if (_hoverHighlightSeq!=null)
-				{
-					_seq.getHighlighter().removeHighlight(_hoverHighlightSeq);
-					_hoverHighlightSeq = null;
-				}
-				if (_hoverHighlightStr!=null)
-				{
-					_str.getHighlighter().removeHighlight(_hoverHighlightStr);
-					_hoverHighlightStr = null;
-				}
-				if (newBase!=null)
-				{
-					try {
-						_hoverHighlightSeq = _seq.getHighlighter().addHighlight(newBase.getIndex(), newBase.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.green) );
-						_hoverHighlightStr = _str.getHighlighter().addHighlight(newBase.getIndex(), newBase.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.green) );
-					} catch (BadLocationException e) {
-						e.printStackTrace();
-					}
-				}
-			}
-
-			public void onSelectionChanged(BaseList selection,
-					BaseList addedBases, BaseList removedBases) {
-				for(Object tag: _selectionHighlightSeq)
-				{
-					_seq.getHighlighter().removeHighlight(tag);
-				}
-				_selectionHighlightSeq.clear();
-				for(Object tag: _selectionHighlightStr)
-				{
-					_str.getHighlighter().removeHighlight(tag);
-				}
-				_selectionHighlightStr.clear();
-				for (ModeleBase m: selection.getBases())
-				{
-					try {
-						_selectionHighlightSeq.add(_seq.getHighlighter().addHighlight(m.getIndex(), m.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.orange) ));
-						_selectionHighlightStr.add(_str.getHighlighter().addHighlight(m.getIndex(), m.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.orange) ));
-					} catch (BadLocationException e) {
-						e.printStackTrace();
-					}
-				}
-			}
-			
-		});
-		
-		_vp.addVARNAListener(this);
-	}
-	
-	public static String generateDefaultName()
-	{
-		return "User file #"+_nextID++;
-	}
-
-	public RNA getRNA() {
-		return (RNA)_sideList.getSelectedValue();
-	}
-
-
-
-	public String[][] getParameterInfo() {
-		String[][] info = {
-				// Parameter Name Kind of Value Description,
-				{ "sequenceDBN", "String", "A raw RNA sequence" },
-				{ "structureDBN", "String",
-						"An RNA structure in dot bracket notation (DBN)" },
-				{ errorOpt, "boolean", "To show errors" }, };
-		return info;
-	}
-
-	public void init() {
-		_vp.setBackground(_backgroundColor);
-		_error = true;
-	}
-
-	@SuppressWarnings("unused")
-	private Color getSafeColor(String col, Color def) {
-		Color result;
-		try {
-			result = Color.decode(col);
-		} catch (Exception e) {
-			try {
-				result = Color.getColor(col, def);
-			} catch (Exception e2) {
-				return def;
-			}
-		}
-		return result;
-	}
-
-	public VARNAPanel get_varnaPanel() {
-		return _vp;
-	}
-
-	public void set_varnaPanel(VARNAPanel surface) {
-		_vp = surface;
-	}
-
-
-	public JTextField get_seq() {
-		return _seq;
-	}
-
-	public void set_seq(JTextField _seq) {
-		this._seq = _seq;
-	}
-
-	public JLabel get_info() {
-		return _info;
-	}
-
-	public void set_info(JLabel _info) {
-		this._info = _info;
-	}
-
-	public static void main(String[] args) {
-		VARNAEditor d = new VARNAEditor();
-		d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
-		d.pack();
-		d.setVisible(true);
-	}
-	
-
-	public void dragEnter(DropTargetDragEvent arg0) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void dragExit(DropTargetEvent arg0) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void dragOver(DropTargetDragEvent arg0) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void drop(DropTargetDropEvent dtde) {
-	    try {
-	        Transferable tr = dtde.getTransferable();
-	        DataFlavor[] flavors = tr.getTransferDataFlavors();
-	        for (int i = 0; i < flavors.length; i++) {
-	    if (flavors[i].isFlavorJavaFileListType()) {
-	      dtde.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
-	      Object ob = tr.getTransferData(flavors[i]);
-	      if (ob instanceof List)
-	      {
-	    	  List list = (List) ob;
-	    	  for (int j = 0; j < list.size(); j++) {
-	    	  Object o = list.get(j);
-	    	  
-	    	  if (dtde.getSource() instanceof DropTarget)
-	    	  {
-	    		  DropTarget dt = (DropTarget) dtde.getSource();
-	    		  Component c = dt.getComponent();
-		    	  if (c instanceof VARNAPanel)
-		    	  {
-					  String path = o.toString();
-		    		  VARNAPanel vp = (VARNAPanel) c;
-					  try{
-		    		  FullBackup bck =  VARNAPanel.importSession((File) o); // BH SwingJS
-		    		  _rnaList.add(bck.config, bck.rna,bck.name,true);
-					  }
-					  catch (ExceptionLoadingFailed e3)
-					  {
-						  Collection<RNA> rnas = RNAFactory.loadSecStr((File) o); // BH SwingJS 
-						  if (rnas.isEmpty())
-						  {
-							  throw new ExceptionFileFormatOrSyntax("No RNA could be parsed from that source.");
-						  }
-						  
-						  int id = 1;
-						  for(RNA r: rnas)
-						  {
-							  r.drawRNA(vp.getConfig());
-							  String name = r.getName();
-							  if (name.equals(""))
-							  { 
-								  name = path.substring(path.lastIndexOf(File.separatorChar)+1);
-							  }
-							  if (rnas.size()>1)
-							  {
-								  name += " - Molecule# "+id++;
-							  }
-							  _rnaList.add(vp.getConfig().clone(),r,name,true);
-						  }
-					  }					  
-		    	  }
-	    	  }
-	    	  }
-	      }
-	      // If we made it this far, everything worked.
-	      dtde.dropComplete(true);
-	      return;
-	    }
-	        }
-	        // Hmm, the user must not have dropped a file list
-	        dtde.rejectDrop();
-	      } catch (Exception e) {
-	        e.printStackTrace();
-	        dtde.rejectDrop();
-	      }
-		
-	}
-
-	public void dropActionChanged(DropTargetDragEvent arg0) {
-	}
-
-	private class BackupHolder{
-		private DefaultListModel _rnaList;
-		private ArrayList<RNA> _rnas = new ArrayList<RNA>();
-		JList _l;
-		
-		public BackupHolder(DefaultListModel rnaList, JList l)
-		{
-			_rnaList = rnaList;
-			_l = l;
-		}
-		
-		public void add(VARNAConfig c, RNA r)
-		{
-			add(c, r, r.getName(),false);
-		}
-
-		public void add(VARNAConfig c, RNA r,boolean select)
-		{
-			add(c, r, r.getName(),select);
-		}
-
-		public void add(VARNAConfig c, RNA r, String name)
-		{
-			add(c, r, name,false);			
-		}
-		public void add(VARNAConfig c, RNA r, String name, boolean select)
-		{
-			if (select){
-				_l.removeSelectionInterval(0, _rnaList.size());
-			}
-			if (name.equals(""))
-			{
-				name = generateDefaultName();
-			}
-			FullBackup bck = new FullBackup(c,r,name);
-			_rnas.add(0, r);
-			_rnaList.add(0,bck);
-			if (select){
-			  _l.setSelectedIndex(0);
-			}
-		}
-
-		public void remove(int i)
-		{
-			_rnas.remove(i);
-			_rnaList.remove(i);
-			
-		}
-		public DefaultListModel getModel()
-		{
-			return _rnaList;
-		}
-		public boolean contains(RNA r)
-		{
-			return _rnas.contains(r);
-		}
-		/*public int getSize()
-		{
-			return _rnaList.getSize();
-		}*/
-		public FullBackup getElementAt(int i)
-		{
-			return (FullBackup) _rnaList.getElementAt(i);
-		}
-		
-		public void removeSelected()
-		{
-			int i = _l.getSelectedIndex();
-			if (i!=-1)
-			{
-			  if (_rnaList.getSize()==1)
-			  {
-				  RNA r = new RNA();
-				  try {
-					r.setRNA(" ", ".");
-				  } catch (ExceptionUnmatchedClosingParentheses e1) {
-				  } catch (ExceptionFileFormatOrSyntax e1) {
-				  }
-				  _vp.showRNA(r);
-				  _vp.repaint();
-			  }
-			  else
-			  {  
-				 int newi = i+1;
-				 if (newi==_rnaList.getSize())
-				 {
-					 newi = _rnaList.getSize()-2;
-				 }
-				 FullBackup bck = (FullBackup) _rnaList.getElementAt(newi);
-				 _l.setSelectedValue(bck,true);
-			  }
-			  _rnaList.remove(i);
-			}
-
-		}
-	}
-
-	public void onStructureRedrawn() {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void onUINewStructure(VARNAConfig v, RNA r) {
-		_rnaList.add(v, r,"",true);
-	}
-
-	public void onWarningEmitted(String s) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void mouseClicked(MouseEvent e) {
-			   if(e.getClickCount() == 2){
-			     int index = _sideList.locationToIndex(e.getPoint());
-			     ListModel dlm = _sideList.getModel();
-			     FullBackup item = (FullBackup) dlm.getElementAt(index);;
-			     _sideList.ensureIndexIsVisible(index);
-			     Object newName = JOptionPane.showInputDialog(
-			    		    this,
-			    		    "Specify a new name for this RNA",
-			    		    "Rename RNA", 
-			    		    JOptionPane.QUESTION_MESSAGE,
-			    		    (Icon)null,
-			    		    null,
-			    		    item.toString());
-			     if (newName!=null)
-			     {
-			    	 item.name = newName.toString();
-			    	 this._sideList.repaint();
-			     }
-			     }
-	}
-
-	public void mouseEntered(MouseEvent arg0) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void mouseExited(MouseEvent arg0) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void mousePressed(MouseEvent arg0) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void mouseReleased(MouseEvent arg0) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void onZoomLevelChanged() {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void onTranslationChanged() {
-		// TODO Auto-generated method stub
-		
-	}
+  /**
+   * 
+   */
+//  private static final_long serialVersionUID = -790155708306987257L;
+
+  private static final String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA";
+
+  private static final String DEFAULT_STRUCTURE1 = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...)))))..";
+  private static final String DEFAULT_STRUCTURE2 = "..(((((...(((((...(((((........(((((...(((((.....)))))...)))))..................))))).....)))))...)))))..";
+  // private static final String DEFAULT_STRUCTURE1 = "((((....))))";
+  // private static final String DEFAULT_STRUCTURE2 =
+  // "((((..(((....)))..))))";
+
+  private VARNAPanel _vp;
+
+  private JPanel _tools = new JPanel();
+  private JPanel _input = new JPanel();
+
+  private JPanel _seqPanel = new JPanel();
+  private JPanel _strPanel = new JPanel();
+  private JLabel _info = new JLabel();
+  
+  private JTextField _str = new JTextField(DEFAULT_STRUCTURE1);
+  Object _hoverHighlightStr = null;
+  ArrayList<Object> _selectionHighlightStr = new ArrayList<Object>();
+  
+  private JTextField _seq = new JTextField(DEFAULT_SEQUENCE);
+  Object _hoverHighlightSeq = null;
+  ArrayList<Object> _selectionHighlightSeq = new ArrayList<Object>();
+  
+  
+  private JLabel _strLabel = new JLabel(" Str:");
+  private JLabel _seqLabel = new JLabel(" Seq:");
+  private JButton _deleteButton = new JButton("Delete");
+  private JButton _duplicateButton = new JButton("Duplicate");
+  
+  private JPanel _listPanel = new JPanel();
+  private ReorderableJList _sideList = null;
+
+
+
+  private static String errorOpt = "error";
+  @SuppressWarnings("unused")
+  private boolean _error;
+
+  private Color _backgroundColor = Color.white;
+
+  private static int _nextID = 1;
+  @SuppressWarnings("unused")
+  private int _algoCode;
+  
+  private BackupHolder _rnaList;
+
+
+  public VARNAEditor() {
+    super("VARNA Editor");
+    RNAPanelDemoInit();
+  }
+
+  private void RNAPanelDemoInit() 
+  {
+      DefaultListModel dlm = new DefaultListModel(); 
+      
+
+    int marginTools = 40;
+
+      DefaultListSelectionModel m = new DefaultListSelectionModel();
+      m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
+      m.setLeadAnchorNotificationEnabled(false);
+      
+      
+    _sideList = new ReorderableJList();
+    _sideList.setModel(dlm);
+    _sideList.addMouseListener(this);
+      _sideList.setSelectionModel(m);
+      _sideList.setPreferredSize(new Dimension(100, 0));
+      _sideList.addListSelectionListener( new ListSelectionListener(){
+      public void valueChanged(ListSelectionEvent arg0) {
+        //System.out.println(arg0);
+        if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
+        {
+          FullBackup  sel = (FullBackup) _sideList.getSelectedValue();
+          Mapping map = Mapping.DefaultOutermostMapping(_vp.getRNA().getSize(), sel.rna.getSize());
+          _vp.showRNAInterpolated(sel.rna,sel.config,map);
+          _seq.setText(sel.rna.getSeq());
+          _str.setText(sel.rna.getStructDBN(true));
+        }
+      }
+      });
+
+      _rnaList = new BackupHolder(dlm,_sideList);
+    RNA _RNA1 = new RNA("User defined 1");
+    RNA _RNA2 = new RNA("User defined 2");
+    try {
+      _vp = new VARNAPanel("0",".");
+      _RNA1.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE1);
+      _RNA1.drawRNARadiate(_vp.getConfig());
+      _RNA2.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE2);
+      _RNA2.drawRNARadiate(_vp.getConfig());
+    } catch (ExceptionNonEqualLength e) {
+      _vp.errorDialog(e);
+    } catch (ExceptionUnmatchedClosingParentheses e2) {
+    e2.printStackTrace();
+    } catch (ExceptionFileFormatOrSyntax e3) {
+    e3.printStackTrace();
+    }
+    _vp.setPreferredSize(new Dimension(400, 400));
+    // 
+    
+     // BH 2018 this will NOT be a clone in SwingJS
+      _rnaList.add(_vp.getConfig().clone(),_RNA2,generateDefaultName());
+      _rnaList.add(_vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
+
+      JScrollPane listScroller = new JScrollPane(_sideList);
+      listScroller.setPreferredSize(new Dimension(150, 0));
+
+    setBackground(_backgroundColor);
+    _vp.setBackground(_backgroundColor);
+
+
+    Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
+
+    _seqLabel.setHorizontalTextPosition(JLabel.LEFT);
+    _seqLabel.setPreferredSize(new Dimension(marginTools, 15));
+    _seq.setFont(textFieldsFont);
+    _seq.setText(DEFAULT_SEQUENCE);
+    _seq.setEditable(false);
+    
+
+    _seqPanel.setLayout(new BorderLayout());
+    _seqPanel.add(_seqLabel, BorderLayout.WEST);
+    _seqPanel.add(_seq, BorderLayout.CENTER);
+
+    _strLabel.setPreferredSize(new Dimension(marginTools, 15));
+    _strLabel.setHorizontalTextPosition(JLabel.LEFT);
+    _str.setFont(textFieldsFont);
+    _str.setEditable(false);
+    _strPanel.setLayout(new BorderLayout());
+    _strPanel.add(_strLabel, BorderLayout.WEST);
+    _strPanel.add(_str, BorderLayout.CENTER);
+
+    _input.setLayout(new GridLayout(2, 0));
+    _input.add(_seqPanel);
+    _input.add(_strPanel);
+
+
+    _tools.setLayout(new BorderLayout());
+    _tools.add(_input, BorderLayout.CENTER);
+    _tools.add(_info, BorderLayout.SOUTH);
+
+    _deleteButton.addActionListener(new ActionListener() {
+      public void actionPerformed(ActionEvent e) {
+        _rnaList.removeSelected();
+      }
+    });
+//    _duplicateButton.addActionListener(new ActionListener() {
+//      public void actionPerformed(ActionEvent e) {
+//          _rnaList.add((VARNAConfig)_vp.getConfig().clone(),_vp.getRNA().clone(),_vp.getRNA().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new Date()),true); 
+//      }});
+    
+    JPanel ops = new JPanel();
+    ops.setLayout(new GridLayout(1,2));
+    ops.add(_deleteButton);
+    ops.add(_duplicateButton);
+
+    JLabel j = new JLabel("Structures",JLabel.CENTER);
+    _listPanel.setLayout(new BorderLayout());
+    
+    _listPanel.add(ops,BorderLayout.SOUTH);
+    _listPanel.add(j,BorderLayout.NORTH);
+    _listPanel.add(listScroller,BorderLayout.CENTER);
+
+
+    JSplitPane split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,_vp);
+    getContentPane().setLayout(new BorderLayout());
+    getContentPane().add(split, BorderLayout.CENTER);
+    getContentPane().add(_tools, BorderLayout.NORTH);
+
+    setVisible(true);
+    DropTarget dt = new DropTarget(_vp, this);
+    
+    _vp.addRNAListener(new InterfaceVARNARNAListener(){
+      public void onSequenceModified(int index, String oldseq, String newseq) {
+        _seq.setText(_vp.getRNA().getSeq());
+      }
+
+      public void onStructureModified(Set<ModeleBP> current,
+          Set<ModeleBP> addedBasePairs, Set<ModeleBP> removedBasePairs) {
+        _str.setText(_vp.getRNA().getStructDBN(true));
+      }
+
+      public void onRNALayoutChanged(Hashtable<Integer, Double> previousPositions) {
+      }
+      
+    });
+    
+    _vp.addSelectionListener(new InterfaceVARNASelectionListener(){
+
+      public void onHoverChanged(ModeleBase oldbase, ModeleBase newBase) {
+        if (_hoverHighlightSeq!=null)
+        {
+          _seq.getHighlighter().removeHighlight(_hoverHighlightSeq);
+          _hoverHighlightSeq = null;
+        }
+        if (_hoverHighlightStr!=null)
+        {
+          _str.getHighlighter().removeHighlight(_hoverHighlightStr);
+          _hoverHighlightStr = null;
+        }
+        if (newBase!=null)
+        {
+          try {
+            _hoverHighlightSeq = _seq.getHighlighter().addHighlight(newBase.getIndex(), newBase.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.green) );
+            _hoverHighlightStr = _str.getHighlighter().addHighlight(newBase.getIndex(), newBase.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.green) );
+          } catch (BadLocationException e) {
+            e.printStackTrace();
+          }
+        }
+      }
+
+      public void onSelectionChanged(BaseList selection,
+          BaseList addedBases, BaseList removedBases) {
+        for(Object tag: _selectionHighlightSeq)
+        {
+          _seq.getHighlighter().removeHighlight(tag);
+        }
+        _selectionHighlightSeq.clear();
+        for(Object tag: _selectionHighlightStr)
+        {
+          _str.getHighlighter().removeHighlight(tag);
+        }
+        _selectionHighlightStr.clear();
+        for (ModeleBase m: selection.getBases())
+        {
+          try {
+            _selectionHighlightSeq.add(_seq.getHighlighter().addHighlight(m.getIndex(), m.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.orange) ));
+            _selectionHighlightStr.add(_str.getHighlighter().addHighlight(m.getIndex(), m.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.orange) ));
+          } catch (BadLocationException e) {
+            e.printStackTrace();
+          }
+        }
+      }
+      
+    });
+    
+    _vp.addVARNAListener(this);
+  }
+  
+  public static String generateDefaultName()
+  {
+    return "User file #"+_nextID++;
+  }
+
+  public RNA getRNA() {
+    return (RNA)_sideList.getSelectedValue();
+  }
+
+
+
+  public String[][] getParameterInfo() {
+    String[][] info = {
+        // Parameter Name Kind of Value Description,
+        { "sequenceDBN", "String", "A raw RNA sequence" },
+        { "structureDBN", "String",
+            "An RNA structure in dot bracket notation (DBN)" },
+        { errorOpt, "boolean", "To show errors" }, };
+    return info;
+  }
+
+  public void init() {
+    _vp.setBackground(_backgroundColor);
+    _error = true;
+  }
+
+  @SuppressWarnings("unused")
+  private Color getSafeColor(String col, Color def) {
+    Color result;
+    try {
+      result = Color.decode(col);
+    } catch (Exception e) {
+      try {
+        result = Color.getColor(col, def);
+      } catch (Exception e2) {
+        return def;
+      }
+    }
+    return result;
+  }
+
+  public VARNAPanel get_varnaPanel() {
+    return _vp;
+  }
+
+  public void set_varnaPanel(VARNAPanel surface) {
+    _vp = surface;
+  }
+
+
+  public JTextField get_seq() {
+    return _seq;
+  }
+
+  public void set_seq(JTextField _seq) {
+    this._seq = _seq;
+  }
+
+  public JLabel get_info() {
+    return _info;
+  }
+
+  public void set_info(JLabel _info) {
+    this._info = _info;
+  }
+
+  public static void main(String[] args) {
+    VARNAEditor d = new VARNAEditor();
+    d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
+    d.pack();
+    d.setVisible(true);
+  }
+  
+
+  public void dragEnter(DropTargetDragEvent arg0) {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void dragExit(DropTargetEvent arg0) {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void dragOver(DropTargetDragEvent arg0) {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void drop(DropTargetDropEvent dtde) {
+      try {
+          Transferable tr = dtde.getTransferable();
+          DataFlavor[] flavors = tr.getTransferDataFlavors();
+          for (int i = 0; i < flavors.length; i++) {
+      if (flavors[i].isFlavorJavaFileListType()) {
+        dtde.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
+        Object ob = tr.getTransferData(flavors[i]);
+        if (ob instanceof List)
+        {
+          List list = (List) ob;
+          for (int j = 0; j < list.size(); j++) {
+          Object o = list.get(j);
+          
+          if (dtde.getSource() instanceof DropTarget)
+          {
+            DropTarget dt = (DropTarget) dtde.getSource();
+            Component c = dt.getComponent();
+            if (c instanceof VARNAPanel)
+            {
+            String path = o.toString();
+              VARNAPanel vp = (VARNAPanel) c;
+            try{
+              FullBackup bck =  VARNAPanel.importSession((File) o); // BH SwingJS
+              _rnaList.add(bck.config, bck.rna,bck.name,true);
+            }
+            catch (ExceptionLoadingFailed e3)
+            {
+              Collection<RNA> rnas = RNAFactory.loadSecStr((File) o); // BH SwingJS 
+              if (rnas.isEmpty())
+              {
+                throw new ExceptionFileFormatOrSyntax("No RNA could be parsed from that source.");
+              }
+              
+              int id = 1;
+              for(RNA r: rnas)
+              {
+                r.drawRNA(vp.getConfig());
+                String name = r.getName();
+                if (name.equals(""))
+                { 
+                  name = path.substring(path.lastIndexOf(File.separatorChar)+1);
+                }
+                if (rnas.size()>1)
+                {
+                  name += " - Molecule# "+id++;
+                }
+                _rnaList.add(vp.getConfig().clone(),r,name,true);
+              }
+            }           
+            }
+          }
+          }
+        }
+        // If we made it this far, everything worked.
+        dtde.dropComplete(true);
+        return;
+      }
+          }
+          // Hmm, the user must not have dropped a file list
+          dtde.rejectDrop();
+        } catch (Exception e) {
+          e.printStackTrace();
+          dtde.rejectDrop();
+        }
+    
+  }
+
+  public void dropActionChanged(DropTargetDragEvent arg0) {
+  }
+
+  private class BackupHolder{
+    private DefaultListModel _rnaList;
+    private ArrayList<RNA> _rnas = new ArrayList<RNA>();
+    JList _l;
+    
+    public BackupHolder(DefaultListModel rnaList, JList l)
+    {
+      _rnaList = rnaList;
+      _l = l;
+    }
+    
+    public void add(VARNAConfig c, RNA r)
+    {
+      add(c, r, r.getName(),false);
+    }
+
+    public void add(VARNAConfig c, RNA r,boolean select)
+    {
+      add(c, r, r.getName(),select);
+    }
+
+    public void add(VARNAConfig c, RNA r, String name)
+    {
+      add(c, r, name,false);      
+    }
+    public void add(VARNAConfig c, RNA r, String name, boolean select)
+    {
+      if (select){
+        _l.removeSelectionInterval(0, _rnaList.size());
+      }
+      if (name.equals(""))
+      {
+        name = generateDefaultName();
+      }
+      FullBackup bck = new FullBackup(c,r,name);
+      _rnas.add(0, r);
+      _rnaList.add(0,bck);
+      if (select){
+        _l.setSelectedIndex(0);
+      }
+    }
+
+    public void remove(int i)
+    {
+      _rnas.remove(i);
+      _rnaList.remove(i);
+      
+    }
+    public DefaultListModel getModel()
+    {
+      return _rnaList;
+    }
+    public boolean contains(RNA r)
+    {
+      return _rnas.contains(r);
+    }
+    /*public int getSize()
+    {
+      return _rnaList.getSize();
+    }*/
+    public FullBackup getElementAt(int i)
+    {
+      return (FullBackup) _rnaList.getElementAt(i);
+    }
+    
+    public void removeSelected()
+    {
+      int i = _l.getSelectedIndex();
+      if (i!=-1)
+      {
+        if (_rnaList.getSize()==1)
+        {
+          RNA r = new RNA();
+          try {
+          r.setRNA(" ", ".");
+          } catch (ExceptionUnmatchedClosingParentheses e1) {
+          } catch (ExceptionFileFormatOrSyntax e1) {
+          }
+          _vp.showRNA(r);
+          _vp.repaint();
+        }
+        else
+        {  
+         int newi = i+1;
+         if (newi==_rnaList.getSize())
+         {
+           newi = _rnaList.getSize()-2;
+         }
+         FullBackup bck = (FullBackup) _rnaList.getElementAt(newi);
+         _l.setSelectedValue(bck,true);
+        }
+        _rnaList.remove(i);
+      }
+
+    }
+  }
+
+  public void onStructureRedrawn() {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void onUINewStructure(VARNAConfig v, RNA r) {
+    _rnaList.add(v, r,"",true);
+  }
+
+  public void onWarningEmitted(String s) {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void mouseClicked(MouseEvent e) {
+         if(e.getClickCount() == 2){
+           int index = _sideList.locationToIndex(e.getPoint());
+           ListModel dlm = _sideList.getModel();
+           FullBackup item = (FullBackup) dlm.getElementAt(index);;
+           _sideList.ensureIndexIsVisible(index);
+           Object newName = JOptionPane.showInputDialog(
+                  this,
+                  "Specify a new name for this RNA",
+                  "Rename RNA", 
+                  JOptionPane.QUESTION_MESSAGE,
+                  (Icon)null,
+                  null,
+                  item.toString());
+           if (newName!=null)
+           {
+             item.name = newName.toString();
+             this._sideList.repaint();
+           }
+           }
+  }
+
+  public void mouseEntered(MouseEvent arg0) {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void mouseExited(MouseEvent arg0) {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void mousePressed(MouseEvent arg0) {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void mouseReleased(MouseEvent arg0) {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void onZoomLevelChanged() {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void onTranslationChanged() {
+    // TODO Auto-generated method stub
+    
+  }
 }
diff --git a/srcjar/fr/orsay/lri/varna/applications/VARNAGUI.java b/srcjar/fr/orsay/lri/varna/applications/VARNAGUI.java
index e62503f..80075f9 100644
--- a/srcjar/fr/orsay/lri/varna/applications/VARNAGUI.java
+++ b/srcjar/fr/orsay/lri/varna/applications/VARNAGUI.java
@@ -2,7 +2,7 @@
  VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases.
  Copyright (C) 2008  Kevin Darty, Alain Denise and Yann Ponty.
  electronic mail : Yann.Ponty@lri.fr
- paper mail : LRI, bat 490 Université Paris-Sud 91405 Orsay Cedex France
+ paper mail : LRI, bat 490 Universit� Paris-Sud 91405 Orsay Cedex France
 
  This file is part of VARNA version 3.1.
  VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License
@@ -94,698 +94,698 @@ import fr.orsay.lri.varna.models.rna.RNA;
 
 public class VARNAGUI extends JFrame implements DropTargetListener, InterfaceVARNAListener, MouseListener, AdjustmentListener {
 
-	/**
-	 * 
-	 */
-	private static final long serialVersionUID = -790155708306987257L;
-
-	private static final String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA";
-
-	private static final String DEFAULT_STRUCTURE1 = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...)))))..";
-	private static final String DEFAULT_STRUCTURE2 = "..(((((...(((((...(((((........(((((...(((((.....)))))...)))))..................))))).....)))))...)))))..";
-	// private static final String DEFAULT_STRUCTURE1 = "((((....))))";
-	// private static final String DEFAULT_STRUCTURE2 =
-	// "((((..(((....)))..))))";
-
-	private VARNAPanel _vp;
-
-	private JPanel _tools = new JPanel();
-	private JPanel _input = new JPanel();
-
-	private JPanel _seqPanel = new JPanel();
-	private JPanel _strPanel = new JPanel();
-	private JLabel _info = new JLabel();
-	
-	private JTextField _str = new JTextField(DEFAULT_STRUCTURE1);
-	Object _hoverHighlightStr = null;
-	ArrayList<Object> _selectionHighlightStr = new ArrayList<Object>();
-	
-	private JTextField _seq = new JTextField(DEFAULT_SEQUENCE);
-	Object _hoverHighlightSeq = null;
-	ArrayList<Object> _selectionHighlightSeq = new ArrayList<Object>();
-	
-	
-	private ZoomWindow _zoomWindow;
-	private JLabel _strLabel = new JLabel(" Str:");
-	private JLabel _seqLabel = new JLabel(" Seq:");
-	private JButton _createButton = new JButton("Create");
-	private JButton _deleteButton = new JButton("Delete");
-	private JButton _duplicateButton = new JButton("Snapshot");
-	
-	private JPanel _listPanel = new JPanel();
-	private ReorderableJList _sideList = null;
-
-
-	private static String errorOpt = "error";
-	@SuppressWarnings("unused")
-	private boolean _error;
-
-	private Color _backgroundColor = Color.white;
-	
-	private JScrollBar _vert = new JScrollBar(JScrollBar.VERTICAL);
-	private JScrollBar _horiz = new JScrollBar(JScrollBar.HORIZONTAL);
-
-	private static int _nextID = 1;
-	@SuppressWarnings("unused")
-	private int _algoCode;
-	
-	private BackupHolder _rnaList;
-
-
-	public VARNAGUI() {
-		super("VARNA GUI");
-		RNAPanelDemoInit();
-	}
-
-	private void RNAPanelDemoInit() 
-	{
-	    DefaultListModel dlm = new DefaultListModel(); 
-	    
-
-		int marginTools = 40;
-
-	    DefaultListSelectionModel m = new DefaultListSelectionModel();
-	    m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
-	    m.setLeadAnchorNotificationEnabled(false);
-	    
-	    
-		_sideList = new ReorderableJList();
-		_sideList.setModel(dlm);
-		_sideList.addMouseListener(this);
-	    _sideList.setSelectionModel(m);
-	    _sideList.setPreferredSize(null);
-	    
-	    _sideList.addListSelectionListener(	new ListSelectionListener(){
-			public void valueChanged(ListSelectionEvent arg0) {
-				//System.out.println(arg0);
-				if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
-				{
-					FullBackup  sel = (FullBackup) _sideList.getSelectedValue();
-					_vp.setConfig(sel.config);
-					showRNA(sel.rna);
-					_seq.setText(sel.rna.getSeq());
-					_str.setText(sel.rna.getStructDBN(true));
-				}
-			}
-	    });
-
-	    _rnaList = new BackupHolder(dlm,_sideList);
-		RNA _RNA1 = new RNA("User defined 1");
-		RNA _RNA2 = new RNA("User defined 2");
-		try {
-			_vp = new VARNAPanel("0",".");
-			_zoomWindow = new ZoomWindow(_vp);
-			_RNA1.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE1);
-			_RNA1.drawRNARadiate(_vp.getConfig());
-			_RNA2.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE2);
-			_RNA2.drawRNARadiate(_vp.getConfig());
-		} catch (ExceptionNonEqualLength e) {
-			_vp.errorDialog(e);
-		} catch (ExceptionUnmatchedClosingParentheses e2) {
-		e2.printStackTrace();
-		} catch (ExceptionFileFormatOrSyntax e3) {
-		e3.printStackTrace();
-		}
-		_vp.setPreferredSize(new Dimension(400, 400));
-	    _rnaList.add(_vp.getConfig().clone(),_RNA2,generateDefaultName());
-	    _rnaList.add(_vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
-	    
-
-	    JScrollPane listScroller = new JScrollPane(_sideList);//,JScrollPane.VERTICAL_SCROLLBAR_ALWAYS,JScrollPane.HORIZONTAL_SCROLLBAR_AS_NEEDED);
-	    listScroller.setPreferredSize(new Dimension(150, 0));
-
-		setBackground(_backgroundColor);
-		_vp.setBackground(_backgroundColor);
-
-
-		Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
-
-		_seqLabel.setHorizontalTextPosition(JLabel.LEFT);
-		_seqLabel.setPreferredSize(new Dimension(marginTools, 15));
-		_seq.setFont(textFieldsFont);
-		_seq.setText(DEFAULT_SEQUENCE);
-
-		_createButton.addActionListener(new ActionListener() {
-			public void actionPerformed(ActionEvent e) {
-				try {
-				RNA nRNA = new RNA(generateDefaultName());
-				nRNA.setRNA(_seq.getText(), _str.getText());
-				nRNA.drawRNARadiate(_vp.getConfig());
-				_rnaList.add(new VARNAConfig(),nRNA,true);
-				} catch (ExceptionUnmatchedClosingParentheses e1) {
-					JOptionPane.showMessageDialog(_vp, e1.getMessage(),"Error", JOptionPane.ERROR_MESSAGE);
-				} catch (ExceptionFileFormatOrSyntax e1) {
-					JOptionPane.showMessageDialog(_vp, e1.getMessage(),"Error", JOptionPane.ERROR_MESSAGE);
-				}
-			}
-		});
-
-
-		_seqPanel.setLayout(new BorderLayout());
-		_seqPanel.add(_seqLabel, BorderLayout.WEST);
-		_seqPanel.add(_seq, BorderLayout.CENTER);
-
-		_strLabel.setPreferredSize(new Dimension(marginTools, 15));
-		_strLabel.setHorizontalTextPosition(JLabel.LEFT);
-		_str.setFont(textFieldsFont);
-		_strPanel.setLayout(new BorderLayout());
-		_strPanel.add(_strLabel, BorderLayout.WEST);
-		_strPanel.add(_str, BorderLayout.CENTER);
-
-		_input.setLayout(new GridLayout(2, 0));
-		_input.add(_seqPanel);
-		_input.add(_strPanel);
-
-		JPanel goPanel = new JPanel();
-		goPanel.setLayout(new BorderLayout());
-
-		_tools.setLayout(new BorderLayout());
-		_tools.add(_input, BorderLayout.CENTER);
-		_tools.add(_info, BorderLayout.SOUTH);
-		_tools.add(goPanel, BorderLayout.EAST);
-
-		_deleteButton.addActionListener(new ActionListener() {
-			public void actionPerformed(ActionEvent e) {
-				_rnaList.removeSelected();
-			}
-		});
-		// BH 2018 SwingJS can't clone, as it does not implement serialization 
-		if (/** @j2sNative false && */ true)
-		  _duplicateButton.addActionListener(new ActionListener() {
-			public void actionPerformed(ActionEvent e) {
-					_rnaList.add((VARNAConfig)_vp.getConfig().clone(),_vp.getRNA().clone(),_vp.getRNA().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new Date()),true); 
-			}});
-		
-		JPanel ops = new JPanel();
-		ops.setLayout(new GridLayout(1,2));
-		ops.add(_deleteButton);
+  /**
+   * 
+   */
+  private static final long serialVersionUID = -790155708306987257L;
+
+  private static final String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA";
+
+  private static final String DEFAULT_STRUCTURE1 = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...)))))..";
+  private static final String DEFAULT_STRUCTURE2 = "..(((((...(((((...(((((........(((((...(((((.....)))))...)))))..................))))).....)))))...)))))..";
+  // private static final String DEFAULT_STRUCTURE1 = "((((....))))";
+  // private static final String DEFAULT_STRUCTURE2 =
+  // "((((..(((....)))..))))";
+
+  private VARNAPanel _vp;
+
+  private JPanel _tools = new JPanel();
+  private JPanel _input = new JPanel();
+
+  private JPanel _seqPanel = new JPanel();
+  private JPanel _strPanel = new JPanel();
+  private JLabel _info = new JLabel();
+  
+  private JTextField _str = new JTextField(DEFAULT_STRUCTURE1);
+  Object _hoverHighlightStr = null;
+  ArrayList<Object> _selectionHighlightStr = new ArrayList<Object>();
+  
+  private JTextField _seq = new JTextField(DEFAULT_SEQUENCE);
+  Object _hoverHighlightSeq = null;
+  ArrayList<Object> _selectionHighlightSeq = new ArrayList<Object>();
+  
+  
+  private ZoomWindow _zoomWindow;
+  private JLabel _strLabel = new JLabel(" Str:");
+  private JLabel _seqLabel = new JLabel(" Seq:");
+  private JButton _createButton = new JButton("Create");
+  private JButton _deleteButton = new JButton("Delete");
+  private JButton _duplicateButton = new JButton("Snapshot");
+  
+  private JPanel _listPanel = new JPanel();
+  private ReorderableJList _sideList = null;
+
+
+  private static String errorOpt = "error";
+  @SuppressWarnings("unused")
+  private boolean _error;
+
+  private Color _backgroundColor = Color.white;
+  
+  private JScrollBar _vert = new JScrollBar(JScrollBar.VERTICAL);
+  private JScrollBar _horiz = new JScrollBar(JScrollBar.HORIZONTAL);
+
+  private static int _nextID = 1;
+  @SuppressWarnings("unused")
+  private int _algoCode;
+  
+  private BackupHolder _rnaList;
+
+
+  public VARNAGUI() {
+    super("VARNA GUI");
+    RNAPanelDemoInit();
+  }
+
+  private void RNAPanelDemoInit() 
+  {
+      DefaultListModel dlm = new DefaultListModel(); 
+      
+
+    int marginTools = 40;
+
+      DefaultListSelectionModel m = new DefaultListSelectionModel();
+      m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
+      m.setLeadAnchorNotificationEnabled(false);
+      
+      
+    _sideList = new ReorderableJList();
+    _sideList.setModel(dlm);
+    _sideList.addMouseListener(this);
+      _sideList.setSelectionModel(m);
+      _sideList.setPreferredSize(null);
+      
+      _sideList.addListSelectionListener( new ListSelectionListener(){
+      public void valueChanged(ListSelectionEvent arg0) {
+        //System.out.println(arg0);
+        if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
+        {
+          FullBackup  sel = (FullBackup) _sideList.getSelectedValue();
+          _vp.setConfig(sel.config);
+          showRNA(sel.rna);
+          _seq.setText(sel.rna.getSeq());
+          _str.setText(sel.rna.getStructDBN(true));
+        }
+      }
+      });
+
+      _rnaList = new BackupHolder(dlm,_sideList);
+    RNA _RNA1 = new RNA("User defined 1");
+    RNA _RNA2 = new RNA("User defined 2");
+    try {
+      _vp = new VARNAPanel("0",".");
+      _zoomWindow = new ZoomWindow(_vp);
+      _RNA1.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE1);
+      _RNA1.drawRNARadiate(_vp.getConfig());
+      _RNA2.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE2);
+      _RNA2.drawRNARadiate(_vp.getConfig());
+    } catch (ExceptionNonEqualLength e) {
+      _vp.errorDialog(e);
+    } catch (ExceptionUnmatchedClosingParentheses e2) {
+    e2.printStackTrace();
+    } catch (ExceptionFileFormatOrSyntax e3) {
+    e3.printStackTrace();
+    }
+    _vp.setPreferredSize(new Dimension(400, 400));
+      _rnaList.add(_vp.getConfig().clone(),_RNA2,generateDefaultName());
+      _rnaList.add(_vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
+      
+
+      JScrollPane listScroller = new JScrollPane(_sideList);//,JScrollPane.VERTICAL_SCROLLBAR_ALWAYS,JScrollPane.HORIZONTAL_SCROLLBAR_AS_NEEDED);
+      listScroller.setPreferredSize(new Dimension(150, 0));
+
+    setBackground(_backgroundColor);
+    _vp.setBackground(_backgroundColor);
+
+
+    Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
+
+    _seqLabel.setHorizontalTextPosition(JLabel.LEFT);
+    _seqLabel.setPreferredSize(new Dimension(marginTools, 15));
+    _seq.setFont(textFieldsFont);
+    _seq.setText(DEFAULT_SEQUENCE);
+
+    _createButton.addActionListener(new ActionListener() {
+      public void actionPerformed(ActionEvent e) {
+        try {
+        RNA nRNA = new RNA(generateDefaultName());
+        nRNA.setRNA(_seq.getText(), _str.getText());
+        nRNA.drawRNARadiate(_vp.getConfig());
+        _rnaList.add(new VARNAConfig(),nRNA,true);
+        } catch (ExceptionUnmatchedClosingParentheses e1) {
+          JOptionPane.showMessageDialog(_vp, e1.getMessage(),"Error", JOptionPane.ERROR_MESSAGE);
+        } catch (ExceptionFileFormatOrSyntax e1) {
+          JOptionPane.showMessageDialog(_vp, e1.getMessage(),"Error", JOptionPane.ERROR_MESSAGE);
+        }
+      }
+    });
+
+
+    _seqPanel.setLayout(new BorderLayout());
+    _seqPanel.add(_seqLabel, BorderLayout.WEST);
+    _seqPanel.add(_seq, BorderLayout.CENTER);
+
+    _strLabel.setPreferredSize(new Dimension(marginTools, 15));
+    _strLabel.setHorizontalTextPosition(JLabel.LEFT);
+    _str.setFont(textFieldsFont);
+    _strPanel.setLayout(new BorderLayout());
+    _strPanel.add(_strLabel, BorderLayout.WEST);
+    _strPanel.add(_str, BorderLayout.CENTER);
+
+    _input.setLayout(new GridLayout(2, 0));
+    _input.add(_seqPanel);
+    _input.add(_strPanel);
+
+    JPanel goPanel = new JPanel();
+    goPanel.setLayout(new BorderLayout());
+
+    _tools.setLayout(new BorderLayout());
+    _tools.add(_input, BorderLayout.CENTER);
+    _tools.add(_info, BorderLayout.SOUTH);
+    _tools.add(goPanel, BorderLayout.EAST);
+
+    _deleteButton.addActionListener(new ActionListener() {
+      public void actionPerformed(ActionEvent e) {
+        _rnaList.removeSelected();
+      }
+    });
+    // BH 2018 SwingJS can't clone, as it does not implement serialization 
+    if (/** @j2sNative false && */ true)
+      _duplicateButton.addActionListener(new ActionListener() {
+      public void actionPerformed(ActionEvent e) {
+          _rnaList.add((VARNAConfig)_vp.getConfig().clone(),_vp.getRNA().clone(),_vp.getRNA().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new Date()),true); 
+      }});
+    
+    JPanel ops = new JPanel();
+    ops.setLayout(new GridLayout(1,2));
+    ops.add(_deleteButton);
                 if (/** @j2sNative false && */ true)
                   ops.add(_duplicateButton);
-		
-		JPanel opspanel = new JPanel(new BorderLayout());
-		opspanel.add(ops,BorderLayout.NORTH);
-		opspanel.add(_zoomWindow,BorderLayout.SOUTH);
-		
-		_zoomWindow.setPreferredSize(new Dimension(-1,200));
-		
-
-		JLabel j = new JLabel("Structure Manager",JLabel.CENTER);
-		_listPanel.setLayout(new BorderLayout());
-		
-		_listPanel.add(opspanel,BorderLayout.SOUTH);
-		_listPanel.add(j,BorderLayout.NORTH);
-		_listPanel.add(listScroller,BorderLayout.CENTER);
-
-		goPanel.add(_createButton, BorderLayout.CENTER);
-
-		JPanel vpScroll = new JPanel();
-		vpScroll.setLayout(new BorderLayout());
-		_horiz.setVisible(false);
-		_horiz.addAdjustmentListener(this);
-		_vert.setVisible(false);
-		_vert.addAdjustmentListener(this);
-		vpScroll.add(_horiz,BorderLayout.SOUTH);
-		vpScroll.add(_vert,BorderLayout.EAST);
-		vpScroll.add(_vp,BorderLayout.CENTER);
-		JSplitPane split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,vpScroll);
-		getContentPane().setLayout(new BorderLayout());
-		getContentPane().add(split, BorderLayout.CENTER);
-		getContentPane().add(_tools, BorderLayout.NORTH);
-		
-
-		setVisible(true);
-		DropTarget dt = new DropTarget(_vp, this);
-		
-		_vp.addRNAListener(new InterfaceVARNARNAListener(){
-			public void onSequenceModified(int index, String oldseq, String newseq) {
-				//System.out.println("Sequence changed: Index:"+index+" ["+oldseq+"]=>["+newseq+"]");
-			}
-
-			public void onStructureModified(Set<ModeleBP> current,
-					Set<ModeleBP> addedBasePairs, Set<ModeleBP> removedBasePairs) {
-				String result = "";
-				//System.out.println("Structure changed: ");
-				for (ModeleBP s:addedBasePairs)
-				{  result +=s;  }
-				//System.out.println("     Added: "+result);
-				result = "";
-				for (ModeleBP s:removedBasePairs)
-				{  result +=s;  }
-				//System.out.println("   Removed: "+result);
-			}
-
-			public void onRNALayoutChanged(Hashtable<Integer, Double> previousPositions) {
-				//System.out.print("Layout changed, bases#: ");
-				String result = "";
-				for (Integer s:previousPositions.keySet())
-				{  result +=s+" ";  }				
-				//System.out.println(result);
-			}
-			
-		});
-		
-		_vp.addSelectionListener(new InterfaceVARNASelectionListener(){
-
-			public void onHoverChanged(ModeleBase oldbase, ModeleBase newBase) {
-				if (_hoverHighlightSeq!=null)
-				{
-					_seq.getHighlighter().removeHighlight(_hoverHighlightSeq);
-					_hoverHighlightSeq = null;
-				}
-				if (_hoverHighlightStr!=null)
-				{
-					_str.getHighlighter().removeHighlight(_hoverHighlightStr);
-					_hoverHighlightStr = null;
-				}
-				if (newBase!=null)
-				{
-					try {
-						int i = newBase.getIndex();
-						int[] shifts = _vp.getRNA().getStrandShifts();
-						_hoverHighlightSeq = _seq.getHighlighter().addHighlight(i+shifts[i], i+shifts[i]+1, new DefaultHighlighter.DefaultHighlightPainter(Color.green) );
-						_hoverHighlightStr = _str.getHighlighter().addHighlight(i+shifts[i], i+shifts[i]+1, new DefaultHighlighter.DefaultHighlightPainter(Color.green) );
-					} catch (BadLocationException e) {
-						e.printStackTrace();
-					}
-				}
-			}
-
-			public void onSelectionChanged(BaseList selection,
-					BaseList addedBases, BaseList removedBases) {
-				for(Object tag: _selectionHighlightSeq)
-				{
-					_seq.getHighlighter().removeHighlight(tag);
-				}
-				_selectionHighlightSeq.clear();
-				for(Object tag: _selectionHighlightStr)
-				{
-					_str.getHighlighter().removeHighlight(tag);
-				}
-				_selectionHighlightStr.clear();
-				int[] shifts = _vp.getRNA().getStrandShifts();
-				for (ModeleBase m: selection.getBases())
-				{
-					try {
-						int i = m.getIndex();
-						_selectionHighlightSeq.add(_seq.getHighlighter().addHighlight(i+shifts[i], i+shifts[i]+1, new DefaultHighlighter.DefaultHighlightPainter(Color.orange) ));
-						_selectionHighlightStr.add(_str.getHighlighter().addHighlight(i+shifts[i], i+shifts[i]+1, new DefaultHighlighter.DefaultHighlightPainter(Color.orange) ));
-					} catch (BadLocationException e) {
-						e.printStackTrace();
-					}
-				}
-			}
-			
-		});
-		
-		_vp.addVARNAListener(this);
-		
-		new Thread(_zoomWindow).start();   
-	}
-	
-	protected void showRNA(RNA rna) {
-		_vp.showRNAInterpolated(rna);
-		_zoomWindow.repaint();
-	}
-
-
-	public void addRNA(RNA r, VARNAConfig cfg)
-	{
-		_rnaList.add(cfg,r); 
-	}
-	
-	public static String generateDefaultName()
-	{
-		return "User file #"+_nextID++;
-	}
-
-	public RNA getRNA() {
-		return (RNA)_sideList.getSelectedValue();
-	}
-
-
-
-	public String[][] getParameterInfo() {
-		String[][] info = {
-				// Parameter Name Kind of Value Description,
-				{ "sequenceDBN", "String", "A raw RNA sequence" },
-				{ "structureDBN", "String",
-						"An RNA structure in dot bracket notation (DBN)" },
-				{ errorOpt, "boolean", "To show errors" }, };
-		return info;
-	}
-
-	public void init() {
-		_vp.setBackground(_backgroundColor);
-		_error = true;
-	}
-
-	@SuppressWarnings("unused")
-	private Color getSafeColor(String col, Color def) {
-		Color result;
-		try {
-			result = Color.decode(col);
-		} catch (Exception e) {
-			try {
-				result = Color.getColor(col, def);
-			} catch (Exception e2) {
-				return def;
-			}
-		}
-		return result;
-	}
-
-	public VARNAPanel get_varnaPanel() {
-		return _vp;
-	}
-
-	public void set_varnaPanel(VARNAPanel surface) {
-		_vp = surface;
-	}
-
-
-	public JTextField get_seq() {
-		return _seq;
-	}
-
-	public void set_seq(JTextField _seq) {
-		this._seq = _seq;
-	}
-
-	public JLabel get_info() {
-		return _info;
-	}
-
-	public void set_info(JLabel _info) {
-		this._info = _info;
-	}
-
-	public static void main(String[] args) {
-		List<Image> icons = new ArrayList<Image>();
-		//JOptionPane.showMessageDialog(null, ""+Toolkit.getDefaultToolkit().getImage("./VARNA16x16.png"), "Check", JOptionPane.INFORMATION_MESSAGE);
-		icons.add(Toolkit.getDefaultToolkit().getImage("./VARNA16x16.png"));
-		icons.add(Toolkit.getDefaultToolkit().getImage("./VARNA32x32.png"));
-		icons.add(Toolkit.getDefaultToolkit().getImage("./VARNA64x64.png"));
-		VARNAGUI d = new VARNAGUI();
-		d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
-		d.pack();
-		d.setIconImages(icons);
-		d.setVisible(true);
-	}
-	
-
-	public void dragEnter(DropTargetDragEvent arg0) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void dragExit(DropTargetEvent arg0) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void dragOver(DropTargetDragEvent arg0) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void drop(DropTargetDropEvent dtde) {
-	    try {
-	        Transferable tr = dtde.getTransferable();
-	        DataFlavor[] flavors = tr.getTransferDataFlavors();
-	        for (int i = 0; i < flavors.length; i++) {
-	    if (flavors[i].isFlavorJavaFileListType()) {
-	      dtde.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
-	      Object ob = tr.getTransferData(flavors[i]);
-	      if (ob instanceof List)
-	      {
-	    	  List list = (List) ob;
-	    	  for (int j = 0; j < list.size(); j++) {
-	    	  Object o = list.get(j);
-	    	  
-	    	  if (dtde.getSource() instanceof DropTarget)
-	    	  {
-	    		  DropTarget dt = (DropTarget) dtde.getSource();
-	    		  Component c = dt.getComponent();
-		    	  if (c instanceof VARNAPanel)
-		    	  {
-					  String path = o.toString();
-		    		  VARNAPanel vp = (VARNAPanel) c;
-					  try{
-		    		  FullBackup bck =  VARNAPanel.importSession((File) o);  // BH SwingJS
-		    		  _rnaList.add(bck.config, bck.rna,bck.name,true);
-					  }
-					  catch (ExceptionLoadingFailed e3)
-					  {
-						  ArrayList<RNA> rnas = RNAFactory.loadSecStr((File) o); // BH SwingJS
-	 					  if (rnas.isEmpty())
-						  {
-							  throw new ExceptionFileFormatOrSyntax("No RNA could be parsed from that source.");
-						  }
-						  
-					      dtde.dropComplete(true);
-						  _vp.getVARNAUI().UIChooseRNAs(rnas);
-					      return;
-						  /*
-						  for(RNA r: rnas)
-						  {
-							  r.drawRNA(vp.getConfig());
-							  String name = r.getName();
-							  if (name.equals(""))
-							  { 
-								  name = path.substring(path.lastIndexOf(File.separatorChar)+1);
-							  }
-							  if (rnas.size()>1)
-							  {
-								  name += " - Molecule# "+id++;
-							  }
-							  _rnaList.add(vp.getConfig().clone(),r,name,true);
-						  }*/
-					  }					  
-		    	  }
-	    	  }
-	    	  }
-	      }
-	      // If we made it this far, everything worked.
-	      dtde.dropComplete(true);
-	      return;
-	    }
-	        }
-	        // Hmm, the user must not have dropped a file list
-	        dtde.rejectDrop();
-	      } catch (Exception e) {
-	        e.printStackTrace();
-	        dtde.rejectDrop();
-	      }
-		
-	}
-
-	public void dropActionChanged(DropTargetDragEvent arg0) {
-	}
-
-	private class BackupHolder{
-		private DefaultListModel _rnaList;
-		private ArrayList<RNA> _rnas = new ArrayList<RNA>();
-		JList _l;
-		
-		public BackupHolder(DefaultListModel rnaList, JList l)
-		{
-			_rnaList = rnaList;
-			_l = l;
-		}
-		
-		public void add(VARNAConfig c, RNA r)
-		{
-			add(c, r, r.getName(),false);
-		}
-
-		public void add(VARNAConfig c, RNA r,boolean select)
-		{
-			add(c, r, r.getName(),select);
-		}
-
-		public void add(VARNAConfig c, RNA r, String name)
-		{
-			add(c, r, name,false);			
-		}
-		public void add(VARNAConfig c, RNA r, String name, boolean select)
-		{
-			if (!_rnas.contains(r))
-			{
-			if (select){
-				_l.removeSelectionInterval(0, _rnaList.size());
-			}
-			if (name.equals(""))
-			{
-				name = generateDefaultName();
-			}
-			FullBackup bck = new FullBackup(c,r,name);
-			_rnas.add(0, r);
-			_rnaList.add(0,bck);
-			_l.doLayout();
-			if (select){
-			  _l.setSelectedIndex(0);
-			}
-			}
-		}
-
-		public void remove(int i)
-		{
-			_rnas.remove(i);
-			_rnaList.remove(i);
-			
-		}
-		public DefaultListModel getModel()
-		{
-			return _rnaList;
-		}
-		public boolean contains(RNA r)
-		{
-			return _rnas.contains(r);
-		}
-		/*public int getSize()
-		{
-			return _rnaList.getSize();
-		}*/
-		public FullBackup getElementAt(int i)
-		{
-			return (FullBackup) _rnaList.getElementAt(i);
-		}
-		
-		public void removeSelected()
-		{
-			int i = _l.getSelectedIndex();
-			if (i!=-1)
-			{
-			  if (_rnaList.getSize()==1)
-			  {
-				  RNA r = new RNA();
-				  try {
-					r.setRNA(" ", ".");
-				  } catch (ExceptionUnmatchedClosingParentheses e1) {
-				  } catch (ExceptionFileFormatOrSyntax e1) {
-				  }
-				  showRNA(r);
-			  }
-			  else
-			  {  
-				 int newi = i+1;
-				 if (newi==_rnaList.getSize())
-				 {
-					 newi = _rnaList.getSize()-2;
-				 }
-				 FullBackup bck = (FullBackup) _rnaList.getElementAt(newi);
-				 _l.setSelectedValue(bck,true);
-			  }
-			  _rnaList.remove(i);
-			}
-
-		}
-	}
-
-	public void onStructureRedrawn() {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void onUINewStructure(VARNAConfig v, RNA r) {
-		_rnaList.add(v, r,r.getName(),true);
-		onZoomLevelChanged();
-	}
-
-	public void onWarningEmitted(String s) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void mouseClicked(MouseEvent e) {
-			   if(e.getClickCount() == 2){
-			     int index = _sideList.locationToIndex(e.getPoint());
-			     ListModel dlm = _sideList.getModel();
-			     FullBackup item = (FullBackup) dlm.getElementAt(index);;
-			     _sideList.ensureIndexIsVisible(index);
-			     Object newName = JOptionPane.showInputDialog(
-			    		    this,
-			    		    "Specify a new name for this RNA",
-			    		    "Rename RNA", 
-			    		    JOptionPane.QUESTION_MESSAGE,
-			    		    (Icon)null,
-			    		    null,
-			    		    item.toString());
-			     if (newName!=null)
-			     {
-			    	 item.name = newName.toString();
-			    	 this._sideList.repaint();
-			     }
-			     }
-	}
-
-	public void mouseEntered(MouseEvent arg0) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void mouseExited(MouseEvent arg0) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void mousePressed(MouseEvent arg0) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void mouseReleased(MouseEvent arg0) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void onZoomLevelChanged() {
-		if (_vp.getZoom()>1.02)
-		{
-		  Rectangle r = _vp.getZoomedInTranslationBox();
-		  _horiz.setMinimum(r.x);
-		  _horiz.setMaximum(r.x+r.width+_vp.getWidth());
-		  _horiz.getModel().setExtent(_vp.getWidth());
-		  _horiz.getModel().setValue(_vp.getTranslation().x);		  
-		  _horiz.doLayout();
-		  _horiz.setVisible(true);
-		  
-		  _vert.setMinimum(r.y);
-		  _vert.setMaximum(r.y+r.height+_vp.getHeight());
-		  _vert.getModel().setExtent(_vp.getHeight());
-		  _vert.getModel().setValue(_vp.getTranslation().y);		  
-		  _vert.doLayout();
-		  _vert.setVisible(true);
-		}
-		else
-		{
-		  _horiz.setVisible(false);
-		  _vert.setVisible(false);
-		}
-	}
-
-	public void onTranslationChanged() {
-		if (_vp.getZoom()>1.02)
-		{
-			int nx = _horiz.getMaximum()-(_vp.getTranslation().x-_horiz.getMinimum())-_vp.getWidth();
-			int ny = _vert.getMaximum()-(_vp.getTranslation().y-_vert.getMinimum())-_vp.getHeight();
-			_horiz.getModel().setValue(nx);
-			_horiz.doLayout();
-			_vert.getModel().setValue(ny);
-			_vert.doLayout();
-		}
-	}
-
-	public void adjustmentValueChanged(AdjustmentEvent arg0) {
-		if (arg0.getSource()==_horiz)
-		{
-			_vp.setTranslation(new Point(_horiz.getMaximum()-(arg0.getValue()-_horiz.getMinimum())-_vp.getWidth(),_vp.getTranslation().y));
-			_vp.repaint();
-		}
-		else if (arg0.getSource()==_vert)
-		{
-			_vp.setTranslation(new Point(_vp.getTranslation().x,_vert.getMaximum()-(arg0.getValue()-_vert.getMinimum())-_vp.getHeight()));
-			_vp.repaint();
-		}
-	}
+    
+    JPanel opspanel = new JPanel(new BorderLayout());
+    opspanel.add(ops,BorderLayout.NORTH);
+    opspanel.add(_zoomWindow,BorderLayout.SOUTH);
+    
+    _zoomWindow.setPreferredSize(new Dimension(-1,200));
+    
+
+    JLabel j = new JLabel("Structure Manager",JLabel.CENTER);
+    _listPanel.setLayout(new BorderLayout());
+    
+    _listPanel.add(opspanel,BorderLayout.SOUTH);
+    _listPanel.add(j,BorderLayout.NORTH);
+    _listPanel.add(listScroller,BorderLayout.CENTER);
+
+    goPanel.add(_createButton, BorderLayout.CENTER);
+
+    JPanel vpScroll = new JPanel();
+    vpScroll.setLayout(new BorderLayout());
+    _horiz.setVisible(false);
+    _horiz.addAdjustmentListener(this);
+    _vert.setVisible(false);
+    _vert.addAdjustmentListener(this);
+    vpScroll.add(_horiz,BorderLayout.SOUTH);
+    vpScroll.add(_vert,BorderLayout.EAST);
+    vpScroll.add(_vp,BorderLayout.CENTER);
+    JSplitPane split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,vpScroll);
+    getContentPane().setLayout(new BorderLayout());
+    getContentPane().add(split, BorderLayout.CENTER);
+    getContentPane().add(_tools, BorderLayout.NORTH);
+    
+
+    setVisible(true);
+    DropTarget dt = new DropTarget(_vp, this);
+    
+    _vp.addRNAListener(new InterfaceVARNARNAListener(){
+      public void onSequenceModified(int index, String oldseq, String newseq) {
+        //System.out.println("Sequence changed: Index:"+index+" ["+oldseq+"]=>["+newseq+"]");
+      }
+
+      public void onStructureModified(Set<ModeleBP> current,
+          Set<ModeleBP> addedBasePairs, Set<ModeleBP> removedBasePairs) {
+        String result = "";
+        //System.out.println("Structure changed: ");
+        for (ModeleBP s:addedBasePairs)
+        {  result +=s;  }
+        //System.out.println("     Added: "+result);
+        result = "";
+        for (ModeleBP s:removedBasePairs)
+        {  result +=s;  }
+        //System.out.println("   Removed: "+result);
+      }
+
+      public void onRNALayoutChanged(Hashtable<Integer, Double> previousPositions) {
+        //System.out.print("Layout changed, bases#: ");
+        String result = "";
+        for (Integer s:previousPositions.keySet())
+        {  result +=s+" ";  }       
+        //System.out.println(result);
+      }
+      
+    });
+    
+    _vp.addSelectionListener(new InterfaceVARNASelectionListener(){
+
+      public void onHoverChanged(ModeleBase oldbase, ModeleBase newBase) {
+        if (_hoverHighlightSeq!=null)
+        {
+          _seq.getHighlighter().removeHighlight(_hoverHighlightSeq);
+          _hoverHighlightSeq = null;
+        }
+        if (_hoverHighlightStr!=null)
+        {
+          _str.getHighlighter().removeHighlight(_hoverHighlightStr);
+          _hoverHighlightStr = null;
+        }
+        if (newBase!=null)
+        {
+          try {
+            int i = newBase.getIndex();
+            int[] shifts = _vp.getRNA().getStrandShifts();
+            _hoverHighlightSeq = _seq.getHighlighter().addHighlight(i+shifts[i], i+shifts[i]+1, new DefaultHighlighter.DefaultHighlightPainter(Color.green) );
+            _hoverHighlightStr = _str.getHighlighter().addHighlight(i+shifts[i], i+shifts[i]+1, new DefaultHighlighter.DefaultHighlightPainter(Color.green) );
+          } catch (BadLocationException e) {
+            e.printStackTrace();
+          }
+        }
+      }
+
+      public void onSelectionChanged(BaseList selection,
+          BaseList addedBases, BaseList removedBases) {
+        for(Object tag: _selectionHighlightSeq)
+        {
+          _seq.getHighlighter().removeHighlight(tag);
+        }
+        _selectionHighlightSeq.clear();
+        for(Object tag: _selectionHighlightStr)
+        {
+          _str.getHighlighter().removeHighlight(tag);
+        }
+        _selectionHighlightStr.clear();
+        int[] shifts = _vp.getRNA().getStrandShifts();
+        for (ModeleBase m: selection.getBases())
+        {
+          try {
+            int i = m.getIndex();
+            _selectionHighlightSeq.add(_seq.getHighlighter().addHighlight(i+shifts[i], i+shifts[i]+1, new DefaultHighlighter.DefaultHighlightPainter(Color.orange) ));
+            _selectionHighlightStr.add(_str.getHighlighter().addHighlight(i+shifts[i], i+shifts[i]+1, new DefaultHighlighter.DefaultHighlightPainter(Color.orange) ));
+          } catch (BadLocationException e) {
+            e.printStackTrace();
+          }
+        }
+      }
+      
+    });
+    
+    _vp.addVARNAListener(this);
+    
+    new Thread(_zoomWindow).start();   
+  }
+  
+  protected void showRNA(RNA rna) {
+    _vp.showRNAInterpolated(rna);
+    _zoomWindow.repaint();
+  }
+
+
+  public void addRNA(RNA r, VARNAConfig cfg)
+  {
+    _rnaList.add(cfg,r); 
+  }
+  
+  public static String generateDefaultName()
+  {
+    return "User file #"+_nextID++;
+  }
+
+  public RNA getRNA() {
+    return (RNA)_sideList.getSelectedValue();
+  }
+
+
+
+  public String[][] getParameterInfo() {
+    String[][] info = {
+        // Parameter Name Kind of Value Description,
+        { "sequenceDBN", "String", "A raw RNA sequence" },
+        { "structureDBN", "String",
+            "An RNA structure in dot bracket notation (DBN)" },
+        { errorOpt, "boolean", "To show errors" }, };
+    return info;
+  }
+
+  public void init() {
+    _vp.setBackground(_backgroundColor);
+    _error = true;
+  }
+
+  @SuppressWarnings("unused")
+  private Color getSafeColor(String col, Color def) {
+    Color result;
+    try {
+      result = Color.decode(col);
+    } catch (Exception e) {
+      try {
+        result = Color.getColor(col, def);
+      } catch (Exception e2) {
+        return def;
+      }
+    }
+    return result;
+  }
+
+  public VARNAPanel get_varnaPanel() {
+    return _vp;
+  }
+
+  public void set_varnaPanel(VARNAPanel surface) {
+    _vp = surface;
+  }
+
+
+  public JTextField get_seq() {
+    return _seq;
+  }
+
+  public void set_seq(JTextField _seq) {
+    this._seq = _seq;
+  }
+
+  public JLabel get_info() {
+    return _info;
+  }
+
+  public void set_info(JLabel _info) {
+    this._info = _info;
+  }
+
+  public static void main(String[] args) {
+    List<Image> icons = new ArrayList<Image>();
+    //JOptionPane.showMessageDialog(null, ""+Toolkit.getDefaultToolkit().getImage("./VARNA16x16.png"), "Check", JOptionPane.INFORMATION_MESSAGE);
+    icons.add(Toolkit.getDefaultToolkit().getImage("./VARNA16x16.png"));
+    icons.add(Toolkit.getDefaultToolkit().getImage("./VARNA32x32.png"));
+    icons.add(Toolkit.getDefaultToolkit().getImage("./VARNA64x64.png"));
+    VARNAGUI d = new VARNAGUI();
+    d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
+    d.pack();
+    d.setIconImages(icons);
+    d.setVisible(true);
+  }
+  
+
+  public void dragEnter(DropTargetDragEvent arg0) {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void dragExit(DropTargetEvent arg0) {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void dragOver(DropTargetDragEvent arg0) {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void drop(DropTargetDropEvent dtde) {
+      try {
+          Transferable tr = dtde.getTransferable();
+          DataFlavor[] flavors = tr.getTransferDataFlavors();
+          for (int i = 0; i < flavors.length; i++) {
+      if (flavors[i].isFlavorJavaFileListType()) {
+        dtde.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
+        Object ob = tr.getTransferData(flavors[i]);
+        if (ob instanceof List)
+        {
+          List list = (List) ob;
+          for (int j = 0; j < list.size(); j++) {
+          Object o = list.get(j);
+          
+          if (dtde.getSource() instanceof DropTarget)
+          {
+            DropTarget dt = (DropTarget) dtde.getSource();
+            Component c = dt.getComponent();
+            if (c instanceof VARNAPanel)
+            {
+            String path = o.toString();
+              VARNAPanel vp = (VARNAPanel) c;
+            try{
+              FullBackup bck =  VARNAPanel.importSession((File) o);  // BH SwingJS
+              _rnaList.add(bck.config, bck.rna,bck.name,true);
+            }
+            catch (ExceptionLoadingFailed e3)
+            {
+              ArrayList<RNA> rnas = RNAFactory.loadSecStr((File) o); // BH SwingJS
+              if (rnas.isEmpty())
+              {
+                throw new ExceptionFileFormatOrSyntax("No RNA could be parsed from that source.");
+              }
+              
+                dtde.dropComplete(true);
+              _vp.getVARNAUI().UIChooseRNAs(rnas);
+                return;
+              /*
+              for(RNA r: rnas)
+              {
+                r.drawRNA(vp.getConfig());
+                String name = r.getName();
+                if (name.equals(""))
+                { 
+                  name = path.substring(path.lastIndexOf(File.separatorChar)+1);
+                }
+                if (rnas.size()>1)
+                {
+                  name += " - Molecule# "+id++;
+                }
+                _rnaList.add(vp.getConfig().clone(),r,name,true);
+              }*/
+            }           
+            }
+          }
+          }
+        }
+        // If we made it this far, everything worked.
+        dtde.dropComplete(true);
+        return;
+      }
+          }
+          // Hmm, the user must not have dropped a file list
+          dtde.rejectDrop();
+        } catch (Exception e) {
+          e.printStackTrace();
+          dtde.rejectDrop();
+        }
+    
+  }
+
+  public void dropActionChanged(DropTargetDragEvent arg0) {
+  }
+
+  private class BackupHolder{
+    private DefaultListModel _rnaList;
+    private ArrayList<RNA> _rnas = new ArrayList<RNA>();
+    JList _l;
+    
+    public BackupHolder(DefaultListModel rnaList, JList l)
+    {
+      _rnaList = rnaList;
+      _l = l;
+    }
+    
+    public void add(VARNAConfig c, RNA r)
+    {
+      add(c, r, r.getName(),false);
+    }
+
+    public void add(VARNAConfig c, RNA r,boolean select)
+    {
+      add(c, r, r.getName(),select);
+    }
+
+    public void add(VARNAConfig c, RNA r, String name)
+    {
+      add(c, r, name,false);      
+    }
+    public void add(VARNAConfig c, RNA r, String name, boolean select)
+    {
+      if (!_rnas.contains(r))
+      {
+      if (select){
+        _l.removeSelectionInterval(0, _rnaList.size());
+      }
+      if (name.equals(""))
+      {
+        name = generateDefaultName();
+      }
+      FullBackup bck = new FullBackup(c,r,name);
+      _rnas.add(0, r);
+      _rnaList.add(0,bck);
+      _l.doLayout();
+      if (select){
+        _l.setSelectedIndex(0);
+      }
+      }
+    }
+
+    public void remove(int i)
+    {
+      _rnas.remove(i);
+      _rnaList.remove(i);
+      
+    }
+    public DefaultListModel getModel()
+    {
+      return _rnaList;
+    }
+    public boolean contains(RNA r)
+    {
+      return _rnas.contains(r);
+    }
+    /*public int getSize()
+    {
+      return _rnaList.getSize();
+    }*/
+    public FullBackup getElementAt(int i)
+    {
+      return (FullBackup) _rnaList.getElementAt(i);
+    }
+    
+    public void removeSelected()
+    {
+      int i = _l.getSelectedIndex();
+      if (i!=-1)
+      {
+        if (_rnaList.getSize()==1)
+        {
+          RNA r = new RNA();
+          try {
+          r.setRNA(" ", ".");
+          } catch (ExceptionUnmatchedClosingParentheses e1) {
+          } catch (ExceptionFileFormatOrSyntax e1) {
+          }
+          showRNA(r);
+        }
+        else
+        {  
+         int newi = i+1;
+         if (newi==_rnaList.getSize())
+         {
+           newi = _rnaList.getSize()-2;
+         }
+         FullBackup bck = (FullBackup) _rnaList.getElementAt(newi);
+         _l.setSelectedValue(bck,true);
+        }
+        _rnaList.remove(i);
+      }
+
+    }
+  }
+
+  public void onStructureRedrawn() {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void onUINewStructure(VARNAConfig v, RNA r) {
+    _rnaList.add(v, r,r.getName(),true);
+    onZoomLevelChanged();
+  }
+
+  public void onWarningEmitted(String s) {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void mouseClicked(MouseEvent e) {
+         if(e.getClickCount() == 2){
+           int index = _sideList.locationToIndex(e.getPoint());
+           ListModel dlm = _sideList.getModel();
+           FullBackup item = (FullBackup) dlm.getElementAt(index);;
+           _sideList.ensureIndexIsVisible(index);
+           Object newName = JOptionPane.showInputDialog(
+                  this,
+                  "Specify a new name for this RNA",
+                  "Rename RNA", 
+                  JOptionPane.QUESTION_MESSAGE,
+                  (Icon)null,
+                  null,
+                  item.toString());
+           if (newName!=null)
+           {
+             item.name = newName.toString();
+             this._sideList.repaint();
+           }
+           }
+  }
+
+  public void mouseEntered(MouseEvent arg0) {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void mouseExited(MouseEvent arg0) {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void mousePressed(MouseEvent arg0) {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void mouseReleased(MouseEvent arg0) {
+    // TODO Auto-generated method stub
+    
+  }
+
+  public void onZoomLevelChanged() {
+    if (_vp.getZoom()>1.02)
+    {
+      Rectangle r = _vp.getZoomedInTranslationBox();
+      _horiz.setMinimum(r.x);
+      _horiz.setMaximum(r.x+r.width+_vp.getWidth());
+      _horiz.getModel().setExtent(_vp.getWidth());
+      _horiz.getModel().setValue(_vp.getTranslation().x);     
+      _horiz.doLayout();
+      _horiz.setVisible(true);
+      
+      _vert.setMinimum(r.y);
+      _vert.setMaximum(r.y+r.height+_vp.getHeight());
+      _vert.getModel().setExtent(_vp.getHeight());
+      _vert.getModel().setValue(_vp.getTranslation().y);      
+      _vert.doLayout();
+      _vert.setVisible(true);
+    }
+    else
+    {
+      _horiz.setVisible(false);
+      _vert.setVisible(false);
+    }
+  }
+
+  public void onTranslationChanged() {
+    if (_vp.getZoom()>1.02)
+    {
+      int nx = _horiz.getMaximum()-(_vp.getTranslation().x-_horiz.getMinimum())-_vp.getWidth();
+      int ny = _vert.getMaximum()-(_vp.getTranslation().y-_vert.getMinimum())-_vp.getHeight();
+      _horiz.getModel().setValue(nx);
+      _horiz.doLayout();
+      _vert.getModel().setValue(ny);
+      _vert.doLayout();
+    }
+  }
+
+  public void adjustmentValueChanged(AdjustmentEvent arg0) {
+    if (arg0.getSource()==_horiz)
+    {
+      _vp.setTranslation(new Point(_horiz.getMaximum()-(arg0.getValue()-_horiz.getMinimum())-_vp.getWidth(),_vp.getTranslation().y));
+      _vp.repaint();
+    }
+    else if (arg0.getSource()==_vert)
+    {
+      _vp.setTranslation(new Point(_vp.getTranslation().x,_vert.getMaximum()-(arg0.getValue()-_vert.getMinimum())-_vp.getHeight()));
+      _vp.repaint();
+    }
+  }
 }
diff --git a/srcjar/fr/orsay/lri/varna/applications/VARNAcmd.java b/srcjar/fr/orsay/lri/varna/applications/VARNAcmd.java
index 7b16c61..f3b8999 100644
--- a/srcjar/fr/orsay/lri/varna/applications/VARNAcmd.java
+++ b/srcjar/fr/orsay/lri/varna/applications/VARNAcmd.java
@@ -479,6 +479,7 @@ public class VARNAcmd implements InterfaceParameterLoader {
 				BufferedImage.TYPE_INT_RGB);
 		Graphics2D g2 = myImage.createGraphics();
 		vp.paintComponent(g2);
+		g2.dispose();
 		try {
 			FileImageOutputStream out = new FileImageOutputStream(new File(filename));
 			ImageWriter writer = ImageIO.getImageWritersByFormatName("jpeg").next();
@@ -492,7 +493,6 @@ public class VARNAcmd implements InterfaceParameterLoader {
 		} catch (IOException e) {
 			throw new ExceptionExportFailed(e.getMessage(), filename);
 		}
-
 	}
 
 	public void saveToPNG(String filename, VARNAPanel vp)
diff --git a/srcjar/fr/orsay/lri/varna/controlers/ControleurInterpolator.java b/srcjar/fr/orsay/lri/varna/controlers/ControleurInterpolator.java
index a77bac6..f26a6a4 100644
--- a/srcjar/fr/orsay/lri/varna/controlers/ControleurInterpolator.java
+++ b/srcjar/fr/orsay/lri/varna/controlers/ControleurInterpolator.java
@@ -2,7 +2,7 @@
  VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases.
  Copyright (C) 2008  Kevin Darty, Alain Denise and Yann Ponty.
  electronic mail : Yann.Ponty@lri.fr
- paper mail : LRI, bat 490 Université Paris-Sud 91405 Orsay Cedex France
+ paper mail : LRI, bat 490 Universit� Paris-Sud 91405 Orsay Cedex France
 
  This file is part of VARNA version 3.1.
  VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License
@@ -576,17 +576,12 @@ public class ControleurInterpolator extends Thread implements ActionListener {
 			_d.addLast(d);
 			
 			@SuppressWarnings("unused")
+			// BH SwingJS no notify()
 			Runnable interpolator = ControleurInterpolator.this;
-			/**
-			 * BH SwingJS no notify()
-			 * @j2sNative 
-			 * 
-			 * interpolator.run$();
-			 * 
-			 */
-			{
-			notify();
-			}
+			if (/** @j2sNative 1?true:*/false) 
+			  interpolator.run();
+			else 
+			  notify();
 		}
 
 		public synchronized TargetsHolder get() {
diff --git a/srcjar/fr/orsay/lri/varna/views/VueUI.java b/srcjar/fr/orsay/lri/varna/views/VueUI.java
index e8d7fd1..addffdc 100644
--- a/srcjar/fr/orsay/lri/varna/views/VueUI.java
+++ b/srcjar/fr/orsay/lri/varna/views/VueUI.java
@@ -1194,9 +1194,9 @@ public class VueUI {
 				BufferedImage myImage = new BufferedImage((int) Math.round(_vp.getWidth() * scale),
 						(int) Math.round(_vp.getHeight() * scale), BufferedImage.TYPE_INT_ARGB);
 				// BH j2s SwingJS: was BufferedImage.TRANSLUCENT, which is TYPE_INT_ARGB_PRE ?? no transparent background?
-				Graphics2D g2 = myImage.createGraphics();
 				AffineTransform AF = new AffineTransform();
 				AF.setToScale(scale, scale);
+				Graphics2D g2 = myImage.createGraphics();
 				g2.setTransform(AF);
 				_vp.paintComponent(g2, !_vp.getConfig()._drawBackground);
 				g2.dispose();
@@ -1223,19 +1223,16 @@ public class VueUI {
 					scale = 1. / 100.;
 				else
 					scale = jpeg.getScaleSlider().getValue() / 100.;
-			BufferedImage myImage = new BufferedImage((int) Math.round(_vp
-					.getWidth() * scale), (int) Math.round(_vp.getHeight()
-					* scale), BufferedImage.TYPE_INT_RGB);
-				Graphics2D g2 = myImage.createGraphics();
+				BufferedImage myImage = new BufferedImage((int) Math.round(_vp.getWidth() * scale),
+						(int) Math.round(_vp.getHeight() * scale), BufferedImage.TYPE_INT_RGB);
 				AffineTransform AF = new AffineTransform();
 				AF.setToScale(scale, scale);
+				Graphics2D g2 = myImage.createGraphics();
 				g2.setTransform(AF);
 				_vp.paintComponent(g2);
 				try {
-				FileImageOutputStream out = new FileImageOutputStream(new File(
-						filename));
-				ImageWriter writer = ImageIO
-						.getImageWritersByFormatName("jpeg").next();
+					FileImageOutputStream out = new FileImageOutputStream(new File(filename));
+					ImageWriter writer = ImageIO.getImageWritersByFormatName("jpeg").next();
 					ImageWriteParam params = writer.getDefaultWriteParam();
 					params.setCompressionMode(ImageWriteParam.MODE_EXPLICIT);
 					params.setCompressionQuality(jpeg.getQualitySlider().getValue() / 100.0f);