From: gmungoc <g.m.carstairs@dundee.ac.uk>
Date: Mon, 11 Apr 2016 14:57:56 +0000 (+0100)
Subject: JAL-391 help for reverse / complement options
X-Git-Tag: Release_2_10_0~266^2
X-Git-Url: http://source.jalview.org/gitweb/?a=commitdiff_plain;h=caa95ef9ea2580b9f7331d48fab0c2ad26babae6;hp=20ee237bee8261a2e14299a90d97a88701d47733;p=jalview.git

JAL-391 help for reverse / complement options
---

diff --git a/help/helpTOC.xml b/help/helpTOC.xml
index 9ae45b9..2594738 100755
--- a/help/helpTOC.xml
+++ b/help/helpTOC.xml
@@ -151,7 +151,7 @@
 				<tocitem text="Annotations Menu" target="alwAnnotations" />
 				<tocitem text="Format Menu" target="alwFormat" />
 				<tocitem text="Colour Menu" target="alwColour" />
-				<tocitem text="Calculation Menu" target="alwCalc" />
+				<tocitem text="Calculate Menu" target="alwCalc" />
 				<tocitem text="Web Service Menu" target="wsMenu" />
 				<tocitem text="Annotation Panel Menu" target="annotPanelMenu" />
 				<tocitem text="Popup Menu" target="popMenu" />
diff --git a/help/html/menus/alwcalculate.html b/help/html/menus/alwcalculate.html
index 2e9ea0c..34e8d75 100755
--- a/help/html/menus/alwcalculate.html
+++ b/help/html/menus/alwcalculate.html
@@ -102,6 +102,14 @@
         action on the whole alignment, or selected rows, columns, or
         regions.
     </em> <br></li>
+    <li><strong>Reverse, Reverse Complement</strong> (not applet)<br>
+    <em>These options are visible for nucleotide alignments. Selecting them adds the reverse (or reverse complement)
+    of the sequences (or selected region) as new sequences in the alignment. To try this out, add this sequence and
+    perform 'Reverse Complement' followed by 'Translate as cDNA':
+    <br><small>
+    Seq GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC
+    TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG</small>
+    </em> <br></li>
     <li><strong>Get Cross-References</strong> (not applet)<br>
     <em>This option is visible where sequences have
         cross-references to other standard databases; for example, an