BioJSON in Jalviwe

-def alf = Jalview.getAlignframes(); +def alf = Jalview.getAlignFrames(); print alf[0].getTitle(); def alignment = alf[0].viewport.alignment; def seq = alignment.getSequenceAt(0); diff --git a/doc/building.html b/doc/building.html index 3a39691..ecde4d8 100755 --- a/doc/building.html +++ b/doc/building.html @@ -26,13 +26,12 @@

You will need the following (hopefully):

Java development kit (JDK1.6 is the recommended platform for developing with Jalview, although JDK1.7 seems to work too!).
Ant (we think 1.5.4 is quite sufficient to use the simple build -file supplied, and it seems to work with later versions e.g. 1.7).
Java development kit (JDK1.8 is now the recommended platform for developing with Jalview.
Ant (1.7 or later will be needed for some of the jarsigning tools).

With any luck, after setting your paths and JAVA_HOME correctly, you just need to change to the Jalview directory and run ant (this works -from JBuilder and eclipse too, but NetBeans is a bit trickier). +from eclipse too, but NetBeans is a bit trickier).

ant

@@ -46,23 +45,24 @@ build target in ant to make the signed jar files in a directory called dist. But first you need to make your own key:

Making your own key

The ant 'makefulldist' target assumes that a keystore exists in a -directory 'keys'. To make a key accessible using the default settings -in the build.xml file then make the keys directory and add the -jarsigner key with the following : -

-mkdir keys
-keytool -genkey -keystore keys/.keystore -keypass alignmentisfun
--storepass alignmentisfun -alias jalview
- (you will have to answer some personal questions here)
-ant makedist
- (should eventually generate a Jalview.jnlp file
-  in ./dist along with a set of signed jars using the jalview
-  key)
-

- -

The ant 'makefulldist' target assumes that a keystore exists in + a directory 'keys'. To make a key accessible using the default + settings in the build.xml file then make the keys directory and add + the jarsigner key with the following :

mkdir keys

keytool -genkey -keystore keys/.keystore -keypass alignmentisfun
+  -storepass alignmentisfun -sigalg SHA1withRSA -keyalg RSA -alias jalview

+ (you will have to answer some personal questions here) +

ant makedist -DWebStartLocation="file://.pathtojalviewsource./dist" -Dapplication.codebase="*"

This should eventually generate a jalview.jnlp file in ./dist + along with a set of signed jars using the jalview key). In order to + test locally via webstart you'll now need to add 'file:/' to your + java webstart security exception list. Then:

javaws file://.pathtojalviewsource./dist/jalview.jnlp

Please remember to remove that entry afterwards, since it will leave + your system vulnerable to malicious code. +

Building the JalviewLite applet
The JalviewLite applet is compiled using a subset of the packages in the src directory (specifically: MCView, and jalview.{datamodel, diff --git a/examples/appletDeployment.html b/examples/appletDeployment.html index a7653ed..7fcca00 100644 --- a/examples/appletDeployment.html +++ b/examples/appletDeployment.html @@ -18,30 +18,83 @@ --> -

+ -

Notes on applet deployment

Package all your data files into a single (or multiple) zip / jar - files. This is very useful to reduce download time of large data files. - The applet archive tag can take multiple entries separated by commas, - eg
-

<applet code="jalview.bin.JalviewLite" 
-            archive="jalviewApplet.jar, mydata.zip">
-

Use Jalview for input to a HTML form. For an example of how to - code this using Javascript, click here. -
-
Embed Jalview into the web page, without the "Start Jalview" - button by setting the embed parameter to true;
- <param name="embedded" - value="true">
View full list of supported parameters here.

- -

**NEW FEATURES** in Jalview 2.9

Notes on applet deployment

+ + + + + + + + + + + + + + + + + + + + + + +

Required Dependency Downloads
Dependency	Description
JalviewApplet.jar	Main Jalview Applet Jar
JmolApplet-14.2.14_2015.06.11.jar	Jmol Applet Jar
java-json.jar	Required for BioJSON Generation
json_simple-1.1.jar	Required for BioJSON Generation

+ +

To run Jalview applet in your web page download the Jars listed above. The snippet below shows a minimal code for embedding Jalview applet into a web page. +


+<applet code="jalview.bin.JalviewLite" width="756" height="560" archive="jalviewApplet.jar,JmolApplet-14.2.14_2015.06.11.jar,java-json.jar,json_simple-1.1.jar">
+	<param name="permissions" value="sandbox" />
+	<param name="file" value="plantfdx.fa" />
+	<param name="features" value="plantfdx.features" />
+	<param name="userDefinedColour" value="C=yellow; R,K,H=FF5555; D,E=5555FF" />
+	<param name="showFullId" value="false" />
+	<param name="embedded" value="true" />
+	<param name="linkLabel_1" value="Uniprot" />
+	<param name="linkUrl_1"	value="http://www.uniprot.org/uniprot/$SEQUENCE_ID$" />
+	<param name="linkLabel_2" value="EMBL-EBI Search" />
+	<param name="linkUrl_2"	value="http://www.ebi.ac.uk/ebisearch/search.ebi?db=allebi&query=$SEQUENCE_ID$" />
+	<param name="APPLICATION_URL" value="http://www.jalview.org/services/launchApp" />
+</applet>
+

+ + + + +

View full list of supported applet parameters here.
Package all your data files into a single (or multiple) zip / + jar files. This is very useful to reduce download time of large data + files. The applet archive tag can take multiple entries separated by + commas, eg
```
<applet code="jalview.bin.JalviewLite" archive="jalviewApplet.jar, mydata.zip">
+            
```
+
Use Jalview for input to a HTML form. For an example of how to + code this using Javascript, click here.
+
Embed Jalview into the web page, without the "Start + Jalview" button by setting the embed parameter to true;
+ <param name="embedded" value="true"> +
For more examples, see the links to the left.

+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +

Applet Release History
Release	New Features / required changes
2.9 (Latest)	Split Views for cDNA and Protein alignments Specify second alignment with 'file2' parameter, and set cDNA/Protein column scaling with scaleProteinAsCdna @@ -54,9 +107,11 @@ archive="jalviewApplet.jar,JmolApplet-14.2.14_2015.06.11.jar,java-json.jar,json_simple-1.1.jar" - - NEW FEATURES in Jalview 2.8 - +
2.8	Normalised sequence logo display RNA secondary structure annotation row @@ -71,9 +126,11 @@ original Jalview structure viewer will still be available. - - NEW FEATURES in Jalview 2.7 - +
2.7	Javascript callbacks capabilities oninit parameter and methods for registering javascript handlers for selections, mouseovers and linking to Jmol applets on the page. To use javascript callbacks, ensure the applet tag includes the 'mayscript' attribute - either as a parameter (<param name="mayscript" value="true"/;gt;) or as a bare attribute in the applet html tag). @@ -86,13 +143,17 @@ the Jmol binary distribution available at the Jmol Sourceforge site, or download the Jmol applet from here Minimum recommended version of Java runtime for the applet is now 1.5 (JalviewLite v2.6 without the Jmol viewer may work ok on earlier Java environments but compatibility can no-longer be guaranteed). - - NEW FEATURES in Jalview 2.5 - - New parameters to control display of tree annotation, width of alignment columns, and to disable the jalview button and check for Jmol on startup. - - NEW FEATURES in Jalview 2.4 - +
2.5	+ New parameters to control display of tree annotation, width of alignment columns, and to disable the jalview button and check for Jmol on startup. +
2.4	New applet API methods for feature display control, views, and obtaining current selection via javascript. Group show and hide parameters: "showfeaturegroups" and @@ -104,9 +165,11 @@ "debug" parameter to control verbosity of the applet's console output. "showbutton" parameter to disable launch button and open JalviewLite immediatly. "nojmol" parameter to disable check for Jmol classes. - - NEW FEATURES in Jalview 2.3 - +
2.3	Note that Parameter "PDBFile" now takes the PDB file followed by a space separated list of alignment sequence ids to associate the structure to. It is also possible to associate @@ -126,11 +189,12 @@ Note parameter "PDBSeq" is no longer required. Jalview 2.3 was updated to work with Jmol 11. See the versions archive if you want to download the old Jmol applet. - - - - NEW FEATURES in Jalview 2.1 - + +
2.1	Jalview Applet can read and display JNet secondary structure annotation directly via the jnetfile parameter. @@ -158,5 +222,9 @@ <param name="sequence2" value="FER1_PEA/14-29 TSFLRTQPMPMSVTTT"> (All the usual Jalview File formats are valid, however each new line in an alignment file must be entered as a parameter) - +

+ + diff --git a/examples/appletParameters.html b/examples/appletParameters.html index 433f5a9..cc95ecb 100644 --- a/examples/appletParameters.html +++ b/examples/appletParameters.html @@ -28,7 +28,7 @@ which are described below. Once initialised, the applet can be interacted with via its Javascript API.

Issues arising from tightening of Java Security default settings
JalviewLite is provided as a signed applet with 'sandbox' permissions and wildcards that allow it to be run from any website. Unfortunately, earlier versions of Java may not be compatible with these settings.

For additional deployment notes, see below.

For additional deployment notes, see Applet Deployment.

Applet Parameters

The applet takes the following initialisation parameters.

diff --git a/examples/applets.html b/examples/applets.html index 34118b8..1f65565 100644 --- a/examples/applets.html +++ b/examples/applets.html @@ -22,19 +22,14 @@

Quick Links to jars for example:
jalviewApplet.jar and JmolApplet.jar -

JalviewLite Button Examples

-Try out JalviewLite by pressing one of the buttons below.
- For more information on how to use the applet in your website, see the applet parameters and other documentation in the links to the left.

+Try out JalviewLite by pressing one of the buttons below. + View the source for the examples below here (If the link doesn't work on your browser try going to this page and viewing the page source manually).
+ For more information on how to use the applet in your website, see the applet deployment,applet parameters, and other documentation in the links to the left.

Ferredoxins, chloroplast precursor related UniRef50 diff --git a/examples/embedded.html b/examples/embedded.html index aa67325..0d5ddf3 100644 --- a/examples/embedded.html +++ b/examples/embedded.html @@ -23,9 +23,6 @@

-
-
Quick Links to jars for example:
jalviewApplet.jar and JmolApplet.jar -

@@ -40,6 +37,7 @@
plantfdx.annotations - Jalview Alignment Annotations File
+ View the source code for this example here (If the link doesn't work on your browser try going to this page and viewing the page source manually).
diff --git a/examples/embeddedWJmol.html b/examples/embeddedWJmol.html index f629312..1ecff58 100644 --- a/examples/embeddedWJmol.html +++ b/examples/embeddedWJmol.html @@ -260,11 +260,7 @@ jmolInitialize("","JmolApplet-14.2.14_2015.06.11.jar"); modeltofiles+="1gaq.txt";
-
-
-
Quick Links to jars for example:
jalviewApplet.jar and JmolApplet.jar -
-
+
diff --git a/examples/exampleFeatures.txt b/examples/exampleFeatures.txt index dfadb50..c0098a9 100755 --- a/examples/exampleFeatures.txt +++ b/examples/exampleFeatures.txt @@ -1,5 +1,5 @@ ST-TURN-IIL blue|255,0,255|absolute|20.0|95.0|below|66.0 -GAMMA-TURN-CLASSIC red|0,255,255|20.0|95.0|below|66.0 +GAMMA-TURN-CLASSIC red|0,255,255|20.0|95.0|below|66.0 BETA-TURN-IR 9a6a94 BETA-TURN-IL d6a6ca BETA-BULGE 1dc451 @@ -26,73 +26,74 @@ BETA-TURN-IIL 8b5b50 ST-MOTIF ac25a1 STARTGROUP uniprot +Pfam family FER_CAPAA -1 0 0 Pfam Iron-sulfur (2Fe-2S) FER_CAPAA -1 39 39 METAL Iron-sulfur (2Fe-2S) FER_CAPAA -1 44 44 METAL Iron-sulfur (2Fe-2S) FER_CAPAA -1 47 47 METAL Iron-sulfur (2Fe-2S) FER_CAPAA -1 77 77 METAL -Fer2 Status: True Positive Pfam 8_8 FER_CAPAA -1 8 83 Pfam +Fer2 Status: True Positive Pfam 8_8 FER_CAPAA -1 8 83 Pfam Ferredoxin_fold Status: True Positive FER_CAPAA -1 3 93 Cath Iron-sulfur (2Fe-2S) FER_CAPAN -1 86 86 METAL Iron-sulfur (2Fe-2S) FER_CAPAN -1 91 91 METAL Iron-sulfur (2Fe-2S) FER_CAPAN -1 94 94 METAL Iron-sulfur (2Fe-2S) FER_CAPAN -1 124 124 METAL -Fer2 Status: True Positive Pfam 55_13 FER_CAPAN -1 55 130 Pfam +Fer2 Status: True Positive Pfam 55_13 FER_CAPAN -1 55 130 Pfam Ferredoxin_fold Status: True Positive FER_CAPAN -1 45 140 Cath Iron-sulfur (2Fe-2S) FER1_SOLLC -1 86 86 METAL Iron-sulfur (2Fe-2S) FER1_SOLLC -1 91 91 METAL Iron-sulfur (2Fe-2S) FER1_SOLLC -1 94 94 METAL Iron-sulfur (2Fe-2S) FER1_SOLLC -1 124 124 METAL -Fer2 Status: True Positive Pfam 55_13 FER1_SOLLC -1 55 130 Pfam +Fer2 Status: True Positive Pfam 55_13 FER1_SOLLC -1 55 130 Pfam Ferredoxin_fold Status: True Positive FER1_SOLLC -1 45 140 Cath -Fer2 Status: True Positive Pfam 55_13 Q93XJ9_SOLTU -1 55 130 Pfam +Fer2 Status: True Positive Pfam 55_13 Q93XJ9_SOLTU -1 55 130 Pfam Ferredoxin_fold Status: True Positive Q93XJ9_SOLTU -1 45 140 Cath Iron-sulfur (2Fe-2S) FER1_PEA -1 91 91 METAL Iron-sulfur (2Fe-2S) FER1_PEA -1 96 96 METAL Iron-sulfur (2Fe-2S) FER1_PEA -1 99 99 METAL Iron-sulfur (2Fe-2S) FER1_PEA -1 129 129 METAL -Fer2 Status: True Positive Pfam 60_13 FER1_PEA -1 60 135 Pfam +Fer2 Status: True Positive Pfam 60_13 FER1_PEA -1 60 135 Pfam Ferredoxin_fold Status: True Positive FER1_PEA -1 50 145 Cath -Fer2 Status: True Positive Pfam 63_13 Q7XA98_TRIPR -1 63 138 Pfam +Fer2 Status: True Positive Pfam 63_13 Q7XA98_TRIPR -1 63 138 Pfam Ferredoxin_fold Status: True Positive Q7XA98_TRIPR -1 53 148 Cath Iron-sulfur (2Fe-2S) FER1_MESCR -1 90 90 METAL Iron-sulfur (2Fe-2S) FER1_MESCR -1 95 95 METAL Iron-sulfur (2Fe-2S) FER1_MESCR -1 98 98 METAL Iron-sulfur (2Fe-2S) FER1_MESCR -1 128 128 METAL -Fer2 Status: True Positive Pfam 59_13 FER1_MESCR -1 59 134 Pfam +Fer2 Status: True Positive Pfam 59_13 FER1_MESCR -1 59 134 Pfam Ferredoxin_fold Status: True Positive FER1_MESCR -1 49 144 Cath Iron-sulfur (2Fe-2S) FER1_SPIOL -1 89 89 METAL Iron-sulfur (2Fe-2S) FER1_SPIOL -1 94 94 METAL Iron-sulfur (2Fe-2S) FER1_SPIOL -1 97 97 METAL Iron-sulfur (2Fe-2S) FER1_SPIOL -1 127 127 METAL -Fer2 Status: True Positive Pfam 58_13 FER1_SPIOL -1 58 133 Pfam +Fer2 Status: True Positive Pfam 58_13 FER1_SPIOL -1 58 133 Pfam Ferredoxin_fold Status: True Positive FER1_SPIOL -1 48 143 Cath Iron-sulfur (2Fe-2S) FER3_RAPSA -1 39 39 METAL Iron-sulfur (2Fe-2S) FER3_RAPSA -1 44 44 METAL Iron-sulfur (2Fe-2S) FER3_RAPSA -1 47 47 METAL Iron-sulfur (2Fe-2S) FER3_RAPSA -1 77 77 METAL -Fer2 Status: True Positive Pfam 8_8 FER3_RAPSA -1 8 83 Pfam +Fer2 Status: True Positive Pfam 8_8 FER3_RAPSA -1 8 83 Pfam Ferredoxin_fold Status: True Positive FER3_RAPSA -1 3 93 Cath Iron-sulfur (2Fe-2S) FER_BRANA -1 39 39 METAL Iron-sulfur (2Fe-2S) FER_BRANA -1 44 44 METAL Iron-sulfur (2Fe-2S) FER_BRANA -1 47 47 METAL Iron-sulfur (2Fe-2S) FER_BRANA -1 77 77 METAL -Fer2 Status: True Positive Pfam 8_8 FER_BRANA -1 8 83 Pfam +Fer2 Status: True Positive Pfam 8_8 FER_BRANA -1 8 83 Pfam Ferredoxin_fold Status: True Positive FER_BRANA -1 2 96 Cath Iron-sulfur (2Fe-2S) FER2_ARATH -1 91 91 METAL Iron-sulfur (2Fe-2S) FER2_ARATH -1 96 96 METAL Iron-sulfur (2Fe-2S) FER2_ARATH -1 99 99 METAL Iron-sulfur (2Fe-2S) FER2_ARATH -1 129 129 METAL -Fer2 Status: True Positive Pfam 60_13 FER2_ARATH -1 60 135 Pfam +Fer2 Status: True Positive Pfam 60_13 FER2_ARATH -1 60 135 Pfam Ferredoxin_fold Status: True Positive FER2_ARATH -1 50 145 Cath -Fer2 Status: True Positive Pfam 60_11 Q93Z60_ARATH -1 60 118 Pfam +Fer2 Status: True Positive Pfam 60_11 Q93Z60_ARATH -1 60 118 Pfam Ferredoxin_fold Status: True Positive Q93Z60_ARATH -1 52 118 Cath Iron-sulfur (2Fe-2S) FER1_MAIZE -1 91 91 METAL Iron-sulfur (2Fe-2S) FER1_MAIZE -1 96 96 METAL Iron-sulfur (2Fe-2S) FER1_MAIZE -1 99 99 METAL Iron-sulfur (2Fe-2S) FER1_MAIZE -1 129 129 METAL -Fer2 Status: True Positive Pfam 60_13 FER1_MAIZE -1 60 135 Pfam +Fer2 Status: True Positive Pfam 60_13 FER1_MAIZE -1 60 135 Pfam Ferredoxin_fold Status: True Positive FER1_MAIZE -1 50 145 Cath -Fer2 Status: True Positive Pfam 52_12 O80429_MAIZE -1 52 127 Pfam +Fer2 Status: True Positive Pfam 52_12 O80429_MAIZE -1 52 127 Pfam Ferredoxin_fold Status: True Positive O80429_MAIZE -1 42 137 Cath ENDGROUP uniprot diff --git a/examples/formComplete.html b/examples/formComplete.html index 91d94f8..9e89990 100644 --- a/examples/formComplete.html +++ b/examples/formComplete.html @@ -24,9 +24,7 @@

-
-
Quick Links to jars for example:
jalviewApplet.jar and JmolApplet.jar -
+

@@ -35,7 +33,7 @@
Using the Javascript API to fill out forms using data from JalviewLite
Click the Javascript buttons below to interact with the Applet instance on the page.
-View the source in your browser to see how it has been done.
+ View the source here to see how it has been done (If the link doesn't work on your browser try going to this page and viewing the page source manually).
View the full JalviewLite API documentation. diff --git a/examples/groovy/featureCounter.groovy b/examples/groovy/featureCounter.groovy index 08d038d..42d3187 100644 --- a/examples/groovy/featureCounter.groovy +++ b/examples/groovy/featureCounter.groovy @@ -5,6 +5,9 @@ import jalview.workers.AlignmentAnnotationFactory; * Example script that registers two alignment annotation calculators * - one that counts residues in a column with Pfam annotation * - one that counts only charged residues with Pfam annotation + * To try this, first load uniref50.fa from the examples folder, then load features + * from examples/exampleFeatures.txt, before running this script from the Groovy console. + * Modify this example as required to count by column any desired value that can be * derived from the residue and sequence features at each position of an alignment. / @@ -49,7 +52,7 @@ def hasPfam = { features -> - a closure (groovy function) that tests whether to include a residue * - a closure that tests whether to increment count based on sequence features / -def getColumnCounter = { name, desc, residueTester, featureCounter -> +def getColumnCounter = { name, desc, acceptResidue, acceptFeatures -> [ getName: { name }, getDescription: { desc }, @@ -58,9 +61,9 @@ def getColumnCounter = { name, desc, residueTester, featureCounter -> count: { res, feats -> def c = 0 - if (residueTester.call(res)) + if (acceptResidue.call(res)) { - if (featureCounter.call(feats)) + if (acceptFeatures.call(feats)) { c++ } @@ -71,12 +74,12 @@ def getColumnCounter = { name, desc, residueTester, featureCounter -> } / - * Define annotation that counts any residue with Pfam domain annotation + * Define an annotation that counts any residue with Pfam domain annotation / def pfamAnnotation = getColumnCounter("Pfam", "Count of residues with Pfam domain annotation", {true}, hasPfam) / - * Define annotation that counts charged residues with Pfam domain annotation + * Define an annotation that counts charged residues with Pfam domain annotation / def chargedPfamAnnotation = getColumnCounter("Pfam charged", "Count of charged residues with Pfam domain annotation", isCharged, hasPfam) diff --git a/examples/groovy/printtitle.groovy b/examples/groovy/printtitle.groovy index 813df63..b3387ea 100644 --- a/examples/groovy/printtitle.groovy +++ b/examples/groovy/printtitle.groovy @@ -19,14 +19,17 @@ The Jalview Authors are detailed in the 'AUTHORS' file. / // do something groovy in jalview -print "Hello World.\n"; -def alf = Jalview.getAlignFrames(); +println "Hello World.\n" +println "First sequence is " + currentAlFrame.viewport.alignment.getSequenceAt(0).getDisplayId(true) + +def alf = Jalview.getAlignFrames() for (ala in alf) { // ala is an jalview.gui.AlignFrame object - print ala.getTitle()+"\n"; + println ala.getTitle() // get the parent jalview.datamodel.Alignment from the alignment viewport - def alignment = ala.viewport.alignment; + def alignment = ala.viewport.alignment // get the first sequence from the jalview.datamodel.Alignment object - def seq = alignment.getSequenceAt(0); + def seq = alignment.getSequenceAt(0) } +Jalview.quit() diff --git a/examples/javascriptLaunch.html b/examples/javascriptLaunch.html index e161ad6..35b1d81 100644 --- a/examples/javascriptLaunch.html +++ b/examples/javascriptLaunch.html @@ -21,12 +21,7 @@
-
-
-
Quick Links to jars for example:
jalviewApplet.jar and JmolApplet.jar -
-

@@ -120,7 +115,7 @@ archive="jalviewApplet.jar,JmolApplet-14.2.14_2015.06.11.jar,java-json.jar,json_ -
Javascript Launch Button
The button below demonstrates how JalviewLite can be launched via a javascript action.
+
Javascript Launch Button
The button below demonstrates how JalviewLite can be launched via a javascript action. View the source here to see how it has been done (If the link doesn't work on your browser try going to this page and viewing the page source manually).
diff --git a/examples/linkedapplets_ng.html b/examples/linkedapplets_ng.html index 0449c0b..5890515 100644 --- a/examples/linkedapplets_ng.html +++ b/examples/linkedapplets_ng.html @@ -22,9 +22,7 @@

-
-
Quick Links to jars for example:
jalviewApplet.jar and JmolApplet.jar -
+

@@ -36,7 +34,7 @@
JalviewLite Linked Applets Demo

The two applets below use JalviewLite's javascript API to exchange events about the currently selected region and mouse position in the alignment. -
+ View the source here to see how it has been done (If the link doesn't work on your browser try going to this page and viewing the page source manually).
Description: Fer2 Status: True Positive Pfam 8_83 FER_CAPAA -1 8 83 Pfam +Description: Fer2 Status: True Positive Pfam 8_83 FER_CAPAA -1 8 83 Pfam Chloroplast FER_CAPAN -1 1 47 TRANSIT Iron-sulfur (2Fe-2S) FER_CAPAN -1 86 86 METAL Iron-sulfur (2Fe-2S) FER_CAPAN -1 91 91 METAL Iron-sulfur (2Fe-2S) FER_CAPAN -1 94 94 METAL Iron-sulfur (2Fe-2S) FER_CAPAN -1 124 124 METAL Phosphothreonine FER_CAPAN -1 136 136 MOD_RES -Description: Fer2 Status: True Positive Pfam 55_130 FER_CAPAN -1 55 130 Pfam +Description: Fer2 Status: True Positive Pfam 55_130 FER_CAPAN -1 55 130 Pfam Chloroplast FER1_SOLLC -1 1 47 TRANSIT Iron-sulfur (2Fe-2S) FER1_SOLLC -1 86 86 METAL Iron-sulfur (2Fe-2S) FER1_SOLLC -1 91 91 METAL Iron-sulfur (2Fe-2S) FER1_SOLLC -1 94 94 METAL Iron-sulfur (2Fe-2S) FER1_SOLLC -1 124 124 METAL -Description: Fer2 Status: True Positive Pfam 55_130 FER1_SOLLC -1 55 130 Pfam +Description: Fer2 Status: True Positive Pfam 55_130 FER1_SOLLC -1 55 130 Pfam Evidence: EI4 Q93XJ9_SOLTU -1 1 48 SIGNAL -Description: Fer2 Status: True Positive Pfam 55_130 Q93XJ9_SOLTU -1 55 130 Pfam +Description: Fer2 Status: True Positive Pfam 55_130 Q93XJ9_SOLTU -1 55 130 Pfam Chloroplast FER1_PEA -1 1 52 TRANSIT L -> I (in strain: cv. Onward) FER1_PEA -1 59 59 VARIANT I -> L (in strain: cv. Onward) FER1_PEA -1 85 85 VARIANT @@ -38,14 +38,14 @@ Iron-sulfur (2Fe-2S) FER1_PEA -1 96 96 METAL Iron-sulfur (2Fe-2S) FER1_PEA -1 99 99 METAL Iron-sulfur (2Fe-2S) FER1_PEA -1 129 129 METAL YPTS -> PPPA (in Ref. 2) FER1_PEA -1 132 135 CONFLICT -Description: Fer2 Status: True Positive Pfam 60_135 FER1_PEA -1 60 135 Pfam -Description: Fer2 Status: True Positive Pfam 63_138 Q7XA98_TRIPR -1 63 138 Pfam +Description: Fer2 Status: True Positive Pfam 60_135 FER1_PEA -1 60 135 Pfam +Description: Fer2 Status: True Positive Pfam 63_138 Q7XA98_TRIPR -1 63 138 Pfam Chloroplast FER1_MESCR -1 1 51 TRANSIT Iron-sulfur (2Fe-2S) FER1_MESCR -1 90 90 METAL Iron-sulfur (2Fe-2S) FER1_MESCR -1 95 95 METAL Iron-sulfur (2Fe-2S) FER1_MESCR -1 98 98 METAL Iron-sulfur (2Fe-2S) FER1_MESCR -1 128 128 METAL -Description: Fer2 Status: True Positive Pfam 59_134 FER1_MESCR -1 59 134 Pfam +Description: Fer2 Status: True Positive Pfam 59_134 FER1_MESCR -1 59 134 Pfam Chloroplast FER1_SPIOL -1 1 50 TRANSIT STRAND FER1_SPIOL -1 52 59 STRAND TURN FER1_SPIOL -1 60 61 TURN @@ -68,7 +68,7 @@ Iron-sulfur (2Fe-2S) FER1_SPIOL -1 127 127 METAL STRAND FER1_SPIOL -1 130 133 STRAND STRAND FER1_SPIOL -1 135 138 STRAND HELIX FER1_SPIOL -1 142 144 HELIX -Description: Fer2 Status: True Positive Pfam 58_133 FER1_SPIOL -1 58 133 Pfam +Description: Fer2 Status: True Positive Pfam 58_133 FER1_SPIOL -1 58 133 Pfam I -> V FER3_RAPSA -1 8 8 VARIANT Iron-sulfur (2Fe-2S) FER3_RAPSA -1 39 39 METAL Iron-sulfur (2Fe-2S) FER3_RAPSA -1 44 44 METAL @@ -77,25 +77,25 @@ S -> T FER3_RAPSA -1 55 55 VARIANT Iron-sulfur (2Fe-2S) FER3_RAPSA -1 77 77 METAL R -> K FER3_RAPSA -1 91 91 VARIANT M -> V FER3_RAPSA -1 95 95 VARIANT -Description: Fer2 Status: True Positive Pfam 8_83 FER3_RAPSA -1 8 83 Pfam +Description: Fer2 Status: True Positive Pfam 8_83 FER3_RAPSA -1 8 83 Pfam Chloroplast FER1_ARATH -1 1 52 TRANSIT Iron-sulfur (2Fe-2S) FER1_ARATH -1 91 91 METAL Iron-sulfur (2Fe-2S) FER1_ARATH -1 96 96 METAL Iron-sulfur (2Fe-2S) FER1_ARATH -1 99 99 METAL Iron-sulfur (2Fe-2S) FER1_ARATH -1 129 129 METAL -Description: Fer2 Status: True Positive Pfam 60_135 FER1_ARATH -1 60 135 Pfam +Description: Fer2 Status: True Positive Pfam 60_135 FER1_ARATH -1 60 135 Pfam Iron-sulfur (2Fe-2S) FER_BRANA -1 39 39 METAL Iron-sulfur (2Fe-2S) FER_BRANA -1 44 44 METAL Iron-sulfur (2Fe-2S) FER_BRANA -1 47 47 METAL Iron-sulfur (2Fe-2S) FER_BRANA -1 77 77 METAL -Description: Fer2 Status: True Positive Pfam 8_83 FER_BRANA -1 8 83 Pfam +Description: Fer2 Status: True Positive Pfam 8_83 FER_BRANA -1 8 83 Pfam Chloroplast FER2_ARATH -1 1 52 TRANSIT Iron-sulfur (2Fe-2S) FER2_ARATH -1 91 91 METAL Iron-sulfur (2Fe-2S) FER2_ARATH -1 96 96 METAL Iron-sulfur (2Fe-2S) FER2_ARATH -1 99 99 METAL Iron-sulfur (2Fe-2S) FER2_ARATH -1 129 129 METAL -Description: Fer2 Status: True Positive Pfam 60_135 FER2_ARATH -1 60 135 Pfam -Description: Fer2 Status: True Positive Pfam 60_118 Q93Z60_ARATH -1 60 118 Pfam +Description: Fer2 Status: True Positive Pfam 60_135 FER2_ARATH -1 60 135 Pfam +Description: Fer2 Status: True Positive Pfam 60_118 Q93Z60_ARATH -1 60 118 Pfam Chloroplast FER1_MAIZE -1 1 52 TRANSIT STRAND FER1_MAIZE -1 57 59 STRAND STRAND FER1_MAIZE -1 72 74 STRAND @@ -113,6 +113,6 @@ Iron-sulfur (2Fe-2S) FER1_MAIZE -1 129 129 METAL STRAND FER1_MAIZE -1 132 135 STRAND STRAND FER1_MAIZE -1 137 141 STRAND TURN FER1_MAIZE -1 142 142 TURN -Description: Fer2 Status: True Positive Pfam 60_135 FER1_MAIZE -1 60 135 Pfam -Description: Fer2 Status: True Positive Pfam 52_127 O80429_MAIZE -1 52 127 Pfam +Description: Fer2 Status: True Positive Pfam 60_135 FER1_MAIZE -1 60 135 Pfam +Description: Fer2 Status: True Positive Pfam 52_127 O80429_MAIZE -1 52 127 Pfam ENDGROUP uniprot diff --git a/examples/testdata/simpleGff3.gff b/examples/testdata/simpleGff3.gff index 34b64ee..614b440 100644 --- a/examples/testdata/simpleGff3.gff +++ b/examples/testdata/simpleGff3.gff @@ -24,4 +24,3 @@ seq1 exonerate:protein2genome:local similarity 9 11 3652 - . alignment_id 0 ; Qu ACTACGACACGACGACGACGACG >seq2 CDEQEATGTQDAQEQAQC - diff --git a/examples/testdata/test.html b/examples/testdata/test.html index 229596c..1e41232 100644 --- a/examples/testdata/test.html +++ b/examples/testdata/test.html @@ -26,4 +26,4 @@ subCatContainer.scroll( function() { subCatContainer.scrollTop($(this).scrollTop()); }); - \ No newline at end of file + diff --git a/help/html/calculations/consensus.html b/help/html/calculations/consensus.html index 0a0214e..c870887 100644 --- a/help/html/calculations/consensus.html +++ b/help/html/calculations/consensus.html @@ -55,6 +55,11 @@ Normalise Consensus Logo to scale all columns of the logo to the same height. +
+ Group Consensus
+ If sequence groups have been defined, then selecting option 'Group Consensus' in the Annotations menu will + result in Consensus being calculated for each group, as well as the alignment as a whole. +

cDNA Consensus
diff --git a/help/html/calculations/conservation.html b/help/html/calculations/conservation.html index df8b5ff..9cb8ce1 100755 --- a/help/html/calculations/conservation.html +++ b/help/html/calculations/conservation.html @@ -65,11 +65,16 @@ (e.g. !proline).

- Colouring an alignment by conservation*
+ Colouring an alignment by conservation
Conservation scores can be used to colour an alignment. This is explained further in the help page for conservation colouring.
+
+ Group conservation
+ If sequence groups have been defined, then selecting option 'Group Conservation' in the Annotations menu will + result in Conservation being calculated for each group, as well as the alignment as a whole. +
diff --git a/help/html/features/annotation.html b/help/html/features/annotation.html index a645630..7e52c46 100755 --- a/help/html/features/annotation.html +++ b/help/html/features/annotation.html @@ -48,6 +48,25 @@ alignment window or loaded from the alignment's file menu. href="../webServices/proteinDisorder.html">disordered region prediction methods.
+
Sequence Group Annotation +
+
+ If sequence groups are defined, Conservation + and Consensus annotation can be enabled + for each group from the Annotations menu, or can + be imported from a Jalview Annotations file. +
+
Sequence Selection from Annotation +
+
+ Sequences associated with sequence (or sequence group) annotations can be selected by + double-clicking the annotation label with these key combinations: +
+
double-click - Select associated sequences (replaces current selection)
+
shift double-click - add sequences to selection
+
Ctrl (Mac CMD) double-click - toggles inclusion of associated sequences in the current selection
+
+ Note this also works in combination with manual sequence selection in the alignment.
Interactive Alignment Annotation

Annotation rows are added using the Annotation Label diff --git a/help/html/features/annotationsFormat.html b/help/html/features/annotationsFormat.html index 545f0c1..744370b 100755 --- a/help/html/features/annotationsFormat.html +++ b/help/html/features/annotationsFormat.html @@ -110,7 +110,7 @@ followed by a description for the row, which is shown in a tooltip when the user mouses over the annotation row's label. Since Jalview 2.7, the description field may also contain HTML tags (in - the same way as a sequence feature's + the same way as a sequence feature's label), providing the text is enclosed in an <html/> tag.
Please note: URL links embedded in HTML descriptions are diff --git a/help/html/features/bioJsonFormat.html b/help/html/features/bioJsonFormat.html index f8f87dc..cb7ccc0 100644 --- a/help/html/features/bioJsonFormat.html +++ b/help/html/features/bioJsonFormat.html @@ -20,7 +20,7 @@ * The Jalview Authors are detailed in the 'AUTHORS' file. --> -BioJSON in Jalviwe +BioJSON in Jalview
diff --git a/help/html/features/featuresettings.html b/help/html/features/featuresettings.html index 9164afd..200fc8f 100755 --- a/help/html/features/featuresettings.html +++ b/help/html/features/featuresettings.html @@ -104,7 +104,7 @@ the bottom of the list is rendered below a feature higher up in the list.
You can change the order of a feature by dragging it up and down the list with - the mouse. + the mouse (not applet).

The Optimise order button (currently only diff --git a/help/html/features/groovy.html b/help/html/features/groovy.html index 9aa341b..a2bc627 100644 --- a/help/html/features/groovy.html +++ b/help/html/features/groovy.html @@ -56,6 +56,9 @@

+ Executing a groovy script on a particular alignment
+ +
Access to Jalview's functions from Groovy Scripts
There is as yet no properly defined scripting interface to Jalview, but all the public methods of the jalview class hierarchy can be diff --git a/help/html/features/mmcif.html b/help/html/features/mmcif.html new file mode 100644 index 0000000..6df0fd4 --- /dev/null +++ b/help/html/features/mmcif.html @@ -0,0 +1,28 @@ + + + + +mmCIF File Format + + + mmCIF File Format +
The mmCIF file format (macromolecular Crystallographic + Information) was developed under the auspices of the International Union of Crystallography (IUCr) to extend the Crystallographic Information + File (CIF) data representation used for describing small molecule + structures and associated diffraction experiments.
+ Merits of mmCIF file format +
+
Large structures (containing >62 chains and/or 99999 ATOM + records) that cannot be fully represented in the PDB file format are + available in the PDB archive as single PDBx/mmCIF files.
+
PDBx/mmCIF file format provides richer data annotation
+
PDBx/mmCIF became the standard PDB archive format in 2014. + Since 2016 the PDB File Format is no longer being modified or + extended to support new content. +
+
+ + mmCIF file format support for importing 3D structure data from + flat file and EMBL-PDBe via mmCIF was added in Jalview 2.9.1 + + \ No newline at end of file diff --git a/help/html/features/seqmappings.html b/help/html/features/seqmappings.html index ac63c9e..60ac6ab 100644 --- a/help/html/features/seqmappings.html +++ b/help/html/features/seqmappings.html @@ -42,5 +42,7 @@ retrieved by the Sequence Fetcher, and allows sequence features to be mapped directly from Uniprot das sources to their coding region on EMBL sequence records. +
+
In Jalview 2.9.1 SIFTS Mapping was added as a better means for explicitly identifying the coordinates corresponding to a displayed sequence when viewing a PDB structure associated with a sequence
diff --git a/help/html/features/sifts_mapping_output.png b/help/html/features/sifts_mapping_output.png new file mode 100644 index 0000000..3c28b81 Binary files /dev/null and b/help/html/features/sifts_mapping_output.png differ diff --git a/help/html/features/siftsmapping.html b/help/html/features/siftsmapping.html new file mode 100644 index 0000000..c344a20 --- /dev/null +++ b/help/html/features/siftsmapping.html @@ -0,0 +1,45 @@ + + + + +SIFTS Mapping + + + +
SIFTS Mapping
+ +
+ SIFTS (Structure integration with function, taxonomy + and sequences) provides an up-to-date resource for residue-level + mapping between Uniprot and PDB entries. The information is updated and + released weekly simultaneously with the release of new PDB entries. + SIFTS Entries are published as XML files and made publicly available via an FTP + site hosted at the European Bioinformatics Institute. +
+ +
+ At the point of viewing a PDB structure, Jalview downloads a SIFTS file + for the target entry and uses it to accurately map the sequence residues with the + structure residue. Prior to SIFTS integration, Jalview uses Needleman and Wunsch + Alignment algorithm to map sequence residues to structure residues, and that may not + always result to a correct mapping since it is computational determined. +
+ +
+ The default method for 'Sequence ↔ Structure' mapping can be configured + in the Structure tab in the Tools → Preferences dialog box. When 'SIFTS' + is enabled as the default, all mappings between 'Sequence ↔ Structure' is + performed via SIFTS provided that there is a valid SIFTS entry for PDB structure. If no + valid SIFTS resource is available, then the 'Sequence ↔ Structure' mapping falls + back to Needleman and Wunsch Alignment algorithm. +
+ +
To verify the mapping method used, you can view the mapping output via the structure viewer menu File → View mapping. A sample mapping output can be seen in the screenshot below. The highlighted position shows the method used.
+
+ +
+ +
SIFTS Mapping integration was added in Jalview 2.9.1
+ + + \ No newline at end of file diff --git a/help/html/features/splitView.html b/help/html/features/splitView.html index ed5bef3..1c36abd 100644 --- a/help/html/features/splitView.html +++ b/help/html/features/splitView.html @@ -53,7 +53,7 @@
On selecting rows, columns or regions in one alignment, the corresponding selection is made in the other

Sequence ordering in one alignment (using the cursor, or "Calculate→Sort") is also applied to the other

Editing (gap insertion / deletion) in the protein alignment @@ -75,7 +75,7 @@ panels.

Panel heights are adjusted dragging the divider between them using the mouse
-
"View→New +
"View→New View / Expand Views / Gather Views" behave as for a normal alignment window, but always create new views as Split Frames

diff --git a/help/html/features/uniprotqueryfields.html b/help/html/features/uniprotqueryfields.html new file mode 100644 index 0000000..376180a --- /dev/null +++ b/help/html/features/uniprotqueryfields.html @@ -0,0 +1,599 @@ + + + +UniProtKB query fields + + + +
+ UniProtKB query fields +
+
Supported query fields for searching specific data in UniProtKB (see also query syntax).
+ +

+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +

Field	Example	Description
accession	+ `accession:P62988` +	+ Lists all entries with the primary or secondary + accession number P62988. +
active	+ `active:no` +	+ Lists all obsolete entries. +
annotation	+ `+ annotation:(type:non-positional) + + annotation:(type:positional) + + annotation:(type:mod_res "Pyrrolidone carboxylic acid" evidence:experimental) +` +	+ Lists all entries with: + + any general annotation (comments [CC]) + any sequence annotation (features [FT]) + at least one amino acid modified with a Pyrrolidone carboxylic acid group + +
author	+ `+ author:ashburner +` +	+ Lists all entries with at least one reference co-authored by Michael Ashburner. +
cdantigen	+ `+ cdantigen:CD233 +` +	+ Lists all entries whose cluster of differentiation number is CD233. +
citation	+ `+ citation:("intracellular structural proteins") + + citation:(author:ashburner journal:nature) + citation:9169874 +` +	+ Lists all entries with a literature citation: + + containing the phrase "intracellular structural proteins" in either title or abstract + co-authored by Michael Ashburner and published in Nature + with the PubMed identifier 9169874 + +
cluster	+ `+ cluster:UniRef90_A5YMT3 +` +	+ Lists all entries in the UniRef 90% identity cluster whose + representative sequence is UniProtKB entry A5YMT3. +
count	+ `+ annotation:(type:transmem count:5) + annotation:(type:transmem count:[5 TO ]) + annotation:(type:cofactor count:[3 TO ]) +` +	Lists all entries with: + + exactly 5 transmembrane regions + 5 or more transmembrane regions + 3 or more Cofactor comments + +
created	+ `+ created:[20121001 TO ] + reviewed:yes AND created:[current TO ] +` +	+ Lists all entries created since October 1st 2012. + Lists all new UniProtKB/Swiss-Prot entries in the last release. +
database	+ `+ database:(type:pfam) + + database:(type:pdb 1aut) +` +	+ Lists all entries with: + + a cross-reference to the Pfam database + a cross-reference to the PDB database entry 1aut + + +
domain	+ `+ domain:VWFA +` +	+ Lists all entries with a Von Willebrand factor type A domain described + in the 'Family and Domains' section. +
ec	+ `+ ec:3.2.1.23 +` +	+ Lists all beta-galactosidases. +
evidence	+ `+ annotation:(type:signal evidence:ECO_0000269) + (type:mod_res phosphoserine evidence:ECO_0000269) + annotation:(type:function AND evidence:ECO_0000255) +` +	Lists all entries with: + + a signal sequence whose positions have been experimentally proven + experimentally proven phosphoserine sites + a function manually asserted according to rules + +
family	+ `+ family:serpin +` +	+ Lists all entries belonging to the Serpin family of proteins. +
fragment	+ `+ fragment:yes +` +	+ Lists all entries with an incomplete sequence. +
gene	+ `+ gene:HSPC233 +` +	+ Lists all entries for proteins encoded by gene HSPC233. +
go	+ `+ go:cytoskeleton + + go:0015629 +` +	+ Lists all entries associated with: + + a GO term containing the word "cytoskeleton" + the GO term Actin cytoskeleton and any subclasses + +
host	+ `+ host:mouse + + host:10090 + + host:40674 +` +	+ Lists all entries for viruses infecting: + + organisms with a name containing the word "mouse" + Mus musculus (Mouse) + all mammals (all taxa classified under the taxonomy node for Mammalia) + +
id	+ `id:P00750` +	+ Returns the entry with the primary + accession number P00750. +
inn	+ `+ inn:Anakinra +` +	+ Lists all entries whose "International Nonproprietary Name" is Anakinra. +
interactor	+ `+ interactor:P00520 +` +	+ Lists all entries describing interactions with the protein described by + entry P00520. +
keyword	+ `+ keyword:toxin +` +	+ Lists all entries associated with the keyword Toxin. +
length	+ `+ length:[500 TO 700] +` +	+ Lists all entries describing sequences of length between 500 and 700 residues. +
lineage	+	+ This field is a synonym for the field `taxonomy`. +
mass	+ `+ mass:[500000 TO *] +` +	+ Lists all entries describing sequences with a mass of at least 500,000 Da. +
method	+ `+ method:maldi + + method:xray +` +	+ Lists all entries for proteins identified by: matrix-assisted laser + desorption/ionization (MALDI), crystallography (X-Ray). The + `method` field searches names of physico-chemical + identification methods in the 'Biophysicochemical properties' subsection of the 'Function' section, the 'Publications' and + 'Cross-references' sections. +
mnemonic	+ `+ mnemonic:ATP6_HUMAN +` +	+ Lists all entries with entry name (ID) ATP6_HUMAN. Searches also + obsolete entry names. +
modified	+ `+ modified:[20120101 TO 20120301] + reviewed:yes AND modified:[current TO *] +` +	+ Lists all entries that were last modified between January and March 2012. + Lists all UniProtKB/Swiss-Prot entries modified in the last release. +
name	+ `+ name:"prion protein" +` +	+ Lists all entries for prion proteins. +
organelle	+ `+ organelle:Mitochondrion +` +	+ Lists all entries for proteins encoded by a gene of the mitochondrial + chromosome. +
organism	+ `+ organism:"Ovis aries" + + organism:9940 + + organism:sheep + +` +	+ Lists all entries for proteins expressed in sheep (first 2 examples) and + organisms whose name contains the term "sheep". +
plasmid	+ `+ plasmid:ColE1 +` +	+ Lists all entries for proteins encoded by a gene of plasmid ColE1. +
proteome	+ `+ proteome:UP000005640 +` +	+ Lists all entries from the human proteome. +
proteomecomponent	+ `+ proteomecomponent:"chromosome 1" and organism:9606 +` +	+ Lists all entries from the human chromosome 1. +
replaces	+ `+ replaces:P02023 +` +	+ Lists all entries that were created from a merge with entry P02023. +
reviewed	+ `+ reviewed:yes +` +	+ Lists all UniProtKB/Swiss-Prot entries. +
scope	+ `+ scope:mutagenesis +` +	+ Lists all entries containing a reference that was used to gather + information about mutagenesis. +
sequence	+ `+ sequence:P05067-9 +` +	+ Lists all entries containing a link to isoform 9 of the sequence + described in entry P05067. Allows searching by specific sequence + identifier. +
sequence_modified	+ `+ sequence_modified:[20120101 TO 20120301] + reviewed:yes AND sequence_modified:[current TO *] +` +	+ Lists all entries whose sequences were last modified between January and March 2012. + Lists all UniProtKB/Swiss-Prot entries whose sequences were modified in the last release. +
source	+ `+ source:intact +` +	+ Lists all entries containing a GO term whose annotation source is the + IntAct database. +
strain	+ `+ strain:wistar +` +	+ Lists all entries containing a reference relevant to strain wistar. +
taxonomy	+ `+ taxonomy:40674 +` +	+ Lists all entries for proteins expressed in Mammals. This field is used to retrieve + entries for all organisms classified below a given taxonomic node taxonomy classification). +
tissue	+ `+ tissue:liver +` +	+ Lists all entries containing a reference describing the protein sequence + obtained from a clone isolated from liver. +
web	+ `+ web:wikipedia +` +	+ Lists all entries for proteins that are described in Wikipedia. +

+ + + \ No newline at end of file diff --git a/help/html/features/uniprotseqfetcher.png b/help/html/features/uniprotseqfetcher.png new file mode 100644 index 0000000..a592e8e Binary files /dev/null and b/help/html/features/uniprotseqfetcher.png differ diff --git a/help/html/features/uniprotsequencefetcher.html b/help/html/features/uniprotsequencefetcher.html new file mode 100644 index 0000000..9b2e3fa --- /dev/null +++ b/help/html/features/uniprotsequencefetcher.html @@ -0,0 +1,161 @@ + + + +The Uniprot Free Text Search Interface + + + + The Uniprot Free Text Search Interface +
+ Jalview provides a specialised interface that allows fast and + efficient discovery and retrieval of data from the Uniprot database. + It allows + interactive querying of Uniprot metadata with free text and structured + queries, so sequences can be located without prior knowledge of + their database accessions, or via manual cross-referencing + from Uniprot or other bioinformatics websites. +
+
+ To open the UniProt Sequence Fetcher, select UniProt as the database from + any Sequence Fetcher dialog (opened via + "File →Fetch Sequences"). +
+
+ +
+ +
+ Searching the Uniprot Database +
+
+ To search the Uniprot, begin typing in the text box. The results of your + query are shown in the search results tab, which queries Uniprot after 1.5secs every time + you type in the search text box. You can sort results according to + the displayed columns, and select entries with the mouse or + keyboard. Once you have selected one or more entries, hit the OK + button to retrieve and visualise the sequences in Jalview Alignment interface. +
+
+
Searching a specific Uniprot field If you + want to find sequences based on a specific Uniprot metadata field, + you can select it from the drop-down menu.
+ + +
Bulk Uniprot retrieval
+ Firstly, switch the search target to Uniprot Id, then enter multiple IDs by separating them with a semi-colon. + e.g. fila_human; mnt_human; mnt_mouse.
Hitting Return or OK will automatically + fetch those IDs, like the default Sequence Fetcher interface.
+ +
Advanced / Custom querying + The table below provides a brief overview of the supported Uniprot query syntax (see query fields for UniProtKB): + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
human antigen All entries containing both terms.
human AND antigen
human && antigen
"human antigen" All entries containing both terms in the exact order.
human -antigen All entries containing the term human + but not antigen. +
human NOT antigen
human ! antigen
human OR mouse All entries containing either term.
human || mouse
antigen AND (human OR mouse) Using parentheses to override boolean precedence rules.
anti* All entries containing terms starting with anti. + Asterisks can also be used at the beginning and within terms. Note: + Terms starting with an asterisk or a single letter followed by an + asterisk can slow down queries considerably. +
author:Tiger* Citations that have an author whose name starts with Tiger. + To search in a specific field of a dataset, you must prefix your + search term with the field name and a colon. To discover what + fields can be queried explicitly, observe the query hints that are + shown after submitting a query or use the query builder (see + below). +
length:[100 TO *] All entries with a sequence of at least 100 amino acids.
citation:(author:Arai author:Chung) All entries with a publication that was coauthored by two + specific authors.
+
+
+
+ Result pagination +
+ The query results returned from the Uniprot server are paginated for performance optimisation. + The button labelled ' << ' and ' >> ' can be used to navigate to the next or previous result page respectively. + The page range is shown on the title bar of the Free Text Search interface. Jalview's pagination implementation supports multiple selection of entries across multiple pages. + + +
+ Customising The Uniprot Sequence Fetcher +
+
+ To change the displayed meta-data in the search result, click the + 'Customise Displayed Options' tab, and select the fields you'd like + to displayed or remove. +
+
+ The Uniprot Free Test Search Interface was introduced in + Jalview 2.9.1 +
+ + \ No newline at end of file diff --git a/help/html/features/viewingpdbs.html b/help/html/features/viewingpdbs.html index 4d35516..d4819f1 100755 --- a/help/html/features/viewingpdbs.html +++ b/help/html/features/viewingpdbs.html @@ -121,6 +121,19 @@

+ Importing PDB Entries or files in mmCIF format
+ mmCIF file format provides an alternative means for + importing 3D structure data from flat file and EMBL-PDBe + web-service. To enable mmCIF as the default format for + importing PBD sequences from the PDB sequence fetcher, add or modify the + property + DEFAULT_STRUCTURE_FORMAT=mmCIF in Jalview properties file. + Once this is done, the steps followed in retrieving PDB format files above can + be followed to obtain the same data with mmCIF. mmCIF format file support was added in Jalview 2.9.1.
+ + + +
Associating a large number of PDB files to sequences in an alignment
It is often the case when working with structure alignments that you will have a directory of PDB diff --git a/help/html/keys.html b/help/html/keys.html index a477457..f129551 100755 --- a/help/html/keys.html +++ b/help/html/keys.html @@ -159,7 +159,7 @@ Both Cuts the (fully) selected sequences from the alignment. +columns are selected, you should use the Hide Regions feature instead.--> diff --git a/help/html/menus/desktopMenu.html b/help/html/menus/desktopMenu.html index 15c94ce..edbd1e9 100755 --- a/help/html/menus/desktopMenu.html +++ b/help/html/menus/desktopMenu.html @@ -82,8 +82,7 @@ Jalview News dialog box.

`human antigen`	All entries containing both terms.
`human AND antigen`
`human && antigen`
`"human antigen"`	All entries containing both terms in the exact order.
`human -antigen`	All entries containing the term `human` + but not `antigen`. +
`human NOT antigen`
`human ! antigen`
`human OR mouse`	All entries containing either term.
`human \|\| mouse`	All entries containing either term.
`antigen AND (human OR mouse)`	Using parentheses to override boolean precedence rules.
`anti*`	All entries containing terms starting with `anti`. + Asterisks can also be used at the beginning and within terms. Note: + Terms starting with an asterisk or a single letter followed by an + asterisk can slow down queries considerably. +
`author:Tiger*`	Citations that have an author whose name starts with `Tiger`. + To search in a specific field of a dataset, you must prefix your + search term with the field name and a colon. To discover what + fields can be queried explicitly, observe the query hints that are + shown after submitting a query or use the query builder (see + below). +
`length:[100 TO *]`	All entries with a sequence of at least 100 amino acids.
`citation:(author:Arai author:Chung)`	All entries with a publication that was coauthored by two + specific authors.