From caa95ef9ea2580b9f7331d48fab0c2ad26babae6 Mon Sep 17 00:00:00 2001 From: gmungoc Date: Mon, 11 Apr 2016 15:57:56 +0100 Subject: [PATCH] JAL-391 help for reverse / complement options --- help/helpTOC.xml | 2 +- help/html/menus/alwcalculate.html | 8 ++++++++ 2 files changed, 9 insertions(+), 1 deletion(-) diff --git a/help/helpTOC.xml b/help/helpTOC.xml index 9ae45b9..2594738 100755 --- a/help/helpTOC.xml +++ b/help/helpTOC.xml @@ -151,7 +151,7 @@ - + diff --git a/help/html/menus/alwcalculate.html b/help/html/menus/alwcalculate.html index 2e9ea0c..34e8d75 100755 --- a/help/html/menus/alwcalculate.html +++ b/help/html/menus/alwcalculate.html @@ -102,6 +102,14 @@ action on the whole alignment, or selected rows, columns, or regions.
+
  • Reverse, Reverse Complement (not applet)
    + These options are visible for nucleotide alignments. Selecting them adds the reverse (or reverse complement) + of the sequences (or selected region) as new sequences in the alignment. To try this out, add this sequence and + perform 'Reverse Complement' followed by 'Translate as cDNA': +
    + Seq GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC + TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG +

  • Get Cross-References (not applet)
    This option is visible where sequences have cross-references to other standard databases; for example, an -- 1.7.10.2