##gff-version 2
# exonerate output in gff2 format; not gff3 because
#   - 'similarity' is not a Sequence Ontology term
#   - attributes' name/values are separated by space ' ' not equals '='
##source-version exonerate:protein2genome:local 2.2.0
##date 2015-01-16
##type DNA
#
# exonerate run with --showtargetgff generates 'features on the target' i.e. mappings to the query
# tab-delimited
# seqname source feature start end score strand frame attributes
#
seq1	exonerate:protein2genome:local	gene	8	11	3652	-	.	gene_id 0 ; sequence seq2 ; gene_orientation .
seq1	exonerate:protein2genome:local	cds	9	11	.	-	.	
seq1	exonerate:protein2genome:local	exon	9	11	.	-	.	insertions 3 ; deletions 6
#seq1	exonerate:protein2genome:local	similarity	8	11	3652	-	.	alignment_id 0 ; Query seq2 ; Align 11 1 3
seq1	exonerate:protein2genome:local	similarity	9	11	3652	-	.	alignment_id 0 ; Query seq2 ; Align 11 1 3
#
# appending FASTA sequences is strictly a GFF3 format feature
# but Jalview is able to handle this mixture of GFF2 / GFF3 :-)
#
##FASTA
>seq1
ACTACGACACGACGACGACGACG
>seq2
CDEQEATGTQDAQEQAQC