exception.invocation_target_calling_url = InvocationTargetException while calling openURL: {0}
exception.illegal_access_calling_url = IllegalAccessException while calling openURL: {0}
exception.interrupted_launching_browser = InterruptedException while launching browser: {0}
-exception.ebiembl_retrieval_failed_on = EBI EMBL XML retrieval failed on {0}:{1}
exception.no_pdb_records_for_chain = No PDB Records for {0} chain {1}
exception.unexpected_handling_rnaml_translation_for_pdb = Unexpected exception when handling RNAML translation of PDB data
exception.couldnt_recover_sequence_properties_for_alignment = Couldn't recover sequence properties for alignment
exception.invocation_target_calling_url = InvocationTargetException mientras se invocaba openURL: {0}
exception.illegal_access_calling_url = IllegalAccessException mientras se invocaba openURL: {0}
exception.interrupted_launching_browser = InterruptedException mientras se lanzaba el navegador: {0}
-exception.ebiembl_retrieval_failed_on = La recuperación de datos EBI EMBL XML ha fallado en {0}:{1}
exception.no_pdb_records_for_chain = No se han encontrado registros {0} para la cadena {1}
exception.unexpected_handling_rnaml_translation_for_pdb = Excepcion inesperada cuando se traducían a RNAML los datos PDB
exception.couldnt_recover_sequence_properties_for_alignment = No es posible recuperar las propiedades de la secuencia para el alineamiento
--- /dev/null
+package jalview.io;
+
+import java.io.IOException;
+import java.text.ParseException;
+import java.util.ArrayList;
+import java.util.Hashtable;
+import java.util.List;
+import java.util.Map;
+import java.util.Map.Entry;
+
+import jalview.bin.Cache;
+import jalview.datamodel.DBRefEntry;
+import jalview.datamodel.DBRefSource;
+import jalview.datamodel.FeatureProperties;
+import jalview.datamodel.Sequence;
+import jalview.datamodel.SequenceFeature;
+import jalview.datamodel.SequenceI;
+import jalview.util.DnaUtils;
+import jalview.util.MappingUtils;
+
+/**
+ * A class that provides selective parsing of the EMBL flatfile format.
+ * <p>
+ * The initial implementation is limited to extracting fields used by Jalview
+ * after fetching an EMBL or EMBLCDS entry:
+ *
+ * <pre>
+ * accession, version, sequence, xref
+ * and (for CDS feature) location, protein_id, product, codon_start, translation
+ * </pre>
+ *
+ * For a complete parser, it may be best to adopt that provided in
+ * https://github.com/enasequence/sequencetools/tree/master/src/main/java/uk/ac/ebi/embl/flatfile
+ * (but note this has a dependency on the Apache Commons library)
+ *
+ * @author gmcarstairs
+ * @see ftp://ftp.ebi.ac.uk/pub/databases/ena/sequence/release/doc/usrman.txt
+ * @see ftp://ftp.ebi.ac.uk/pub/databases/embl/doc/FT_current.html
+ */
+public class EmblFlatFile extends AlignFile // FileParse
+{
+ private static final String WHITESPACE = "\\s+";
+
+ private String sourceDb;
+
+ /*
+ * values parsed from the EMBL flatfile record
+ */
+ private String accession; // from ID (first token)
+
+ private String version; // from ID (second token)
+
+ private int length = 128; // from ID (7th token), with usable default
+
+ private List<DBRefEntry> dbrefs; // from DR and also CDS /db_xref qualifiers
+
+ private String sequenceString; // from SQ lines
+
+ private String translation; // from CDS feature /translation
+
+ private String cdsLocation; // CDS /location raw value
+
+ private int codonStart = 1; // from CDS /codon_start
+
+ private String proteinName; // from CDS /product
+
+ private String proteinId; // from CDS /protein_id
+
+ private Map<String, String> cdsProps; // CDS other qualifiers e.g. 'note'
+
+ /**
+ * Constructor
+ * @param fp
+ * @param sourceId
+ * @throws IOException
+ */
+ public EmblFlatFile(FileParse fp, String sourceId) throws IOException
+ {
+ super(false, fp); // don't parse immediately
+ this.sourceDb = sourceId;
+ dbrefs = new ArrayList<>();
+ cdsProps = new Hashtable<>();
+ }
+
+ /**
+ * Parses the flatfile, and if successful, saves as an annotated sequence
+ * which may be retrieved by calling {@code getSequence()}
+ *
+ * @throws IOException
+ */
+ public void parse() throws IOException
+ {
+ String line = nextLine();
+ while (line != null)
+ {
+ if (line.startsWith("ID"))
+ {
+ line = processID(line);
+ }
+ else if (line.startsWith("DR"))
+ {
+ line = processDR(line);
+ }
+ else if (line.startsWith("SQ"))
+ {
+ line = processSQ();
+ }
+ else if (line.startsWith("FT"))
+ {
+ line = processFT(line);
+ }
+ else
+ {
+ line = nextLine();
+ }
+ }
+ assembleSequence();
+ }
+
+ /**
+ * Extracts and saves the primary accession and version (SV value) from an ID
+ * line, or null if not found. Returns the next line after the one processed.
+ *
+ * @param line
+ * @throws IOException
+ */
+ String processID(String line) throws IOException
+ {
+ String[] tokens = line.substring(2).split(";");
+
+ /*
+ * first is primary accession
+ */
+ String token = tokens[0].trim();
+ if (!token.isEmpty())
+ {
+ this.accession = token;
+ }
+
+ /*
+ * second token is 'SV versionNo'
+ */
+ if (tokens.length > 1)
+ {
+ token = tokens[1].trim();
+ if (token.startsWith("SV"))
+ {
+ String[] bits = token.trim().split(WHITESPACE);
+ this.version = bits[bits.length - 1];
+ }
+ }
+
+ /*
+ * seventh token is 'length BP'
+ */
+ if (tokens.length > 6)
+ {
+ token = tokens[6].trim();
+ String[] bits = token.trim().split(WHITESPACE);
+ try
+ {
+ this.length = Integer.valueOf(bits[0]);
+ } catch (NumberFormatException e)
+ {
+ Cache.log.error("bad length read in flatfile, line: " + line);
+ }
+ }
+
+ return nextLine();
+ }
+
+ /**
+ * Processes one DR line and saves as a DBRefEntry cross-reference. Returns
+ * the line following the line processed.
+ *
+ * @param line
+ * @throws IOException
+ */
+ String processDR(String line) throws IOException
+ {
+ String[] tokens = line.substring(2).split(";");
+ if (tokens.length > 1)
+ {
+ String db = tokens[0].trim();
+ String acc = tokens[1].trim();
+ if (acc.endsWith("."))
+ {
+ acc = acc.substring(0, acc.length() - 1);
+ }
+ this.dbrefs.add(new DBRefEntry(db, "0", acc));
+ }
+
+ return nextLine();
+ }
+
+ /**
+ * Reads and saves the sequence, read from the lines following the SQ line.
+ * Whitespace and position counters are discarded. Returns the next line
+ * following the sequence data (the next line that doesn't start with
+ * whitespace).
+ *
+ * @throws IOException
+ */
+ String processSQ() throws IOException
+ {
+ StringBuilder sb = new StringBuilder(this.length);
+ String line = nextLine();
+ while (line != null && line.startsWith(" "))
+ {
+ line = line.trim();
+ String[] blocks = line.split(WHITESPACE);
+
+ /*
+ * omit the last block (position counter) on each line
+ */
+ for (int i = 0; i < blocks.length - 1; i++)
+ {
+ sb.append(blocks[i]);
+ }
+ line = nextLine();
+ }
+ this.sequenceString = sb.toString();
+
+ return line;
+ }
+
+ /**
+ * Processes an FT line. If it declares a feature type of interest (currently,
+ * only CDS is processed), processes all of the associated lines (feature
+ * qualifiers), and returns the next line after that, otherwise simply returns
+ * the next line.
+ *
+ * @param line
+ * @return
+ * @throws IOException
+ */
+ String processFT(String line) throws IOException
+ {
+ String[] tokens = line.split(WHITESPACE);
+ if (tokens.length < 3 || !"CDS".equals(tokens[1]))
+ {
+ return nextLine();
+ }
+
+ this.cdsLocation = tokens[2];
+
+ while ((line = nextLine()) != null)
+ {
+ if (!line.startsWith("FT ")) // 4 spaces
+ {
+ // e.g. start of next feature "FT source..."
+ break;
+ }
+
+ /*
+ * extract qualifier, e.g. FT /protein_id="CAA37824.1"
+ */
+ int slashPos = line.indexOf('/');
+ if (slashPos == -1)
+ {
+ Cache.log.error("Unexpected EMBL line ignored: " + line);
+ continue;
+ }
+ int eqPos = line.indexOf('=', slashPos + 1);
+ if (eqPos == -1)
+ {
+ Cache.log.error("Unexpected EMBL line ignored: " + line);
+ continue;
+ }
+ String qualifier = line.substring(slashPos + 1, eqPos);
+ String value = line.substring(eqPos + 1);
+ if (value.startsWith("\"") && value.endsWith("\""))
+ {
+ value = value.substring(1, value.length() - 1);
+ }
+
+ if ("protein_id".equals(qualifier))
+ {
+ proteinId = value;
+ }
+ else if ("codon_start".equals(qualifier))
+ {
+ try
+ {
+ codonStart = Integer.parseInt(value.trim());
+ } catch (NumberFormatException e)
+ {
+ Cache.log.error("Invalid codon_start in XML for " + this.accession
+ + ": " + e.getMessage());
+ }
+ }
+ else if ("product".equals(qualifier))
+ {
+ // sometimes name is returned e.g. for V00488
+ proteinName = value;
+ }
+ else if ("translation".equals(qualifier))
+ {
+ line = readTranslation(value);
+ }
+ else if (!"".equals(value))
+ {
+ // throw anything else into the additional properties hash
+ cdsProps.put(qualifier, value);
+ }
+ }
+
+ return line;
+ }
+
+ /**
+ * Reads and saves the CDS translation from one or more lines of the file, and
+ * returns the next line after that
+ *
+ * @param value
+ * the first line of the translation (likely quoted)
+ * @return
+ * @throws IOException
+ */
+ String readTranslation(String value) throws IOException
+ {
+ StringBuilder sb = new StringBuilder(this.length / 3 + 1);
+ sb.append(value.replace("\"", ""));
+
+ String line;
+ while ((line = nextLine()) != null)
+ {
+ if (!line.startsWith("FT "))
+ {
+ break; // reached next feature or other input line
+ }
+ String[] tokens = line.split(WHITESPACE);
+ if (tokens.length < 2)
+ {
+ Cache.log.error("Ignoring bad EMBL line: " + line);
+ break;
+ }
+ if (tokens[1].startsWith("/"))
+ {
+ break; // next feature qualifier
+ }
+ sb.append(tokens[1].replace("\"", ""));
+ }
+
+ return sb.toString();
+ }
+
+ /**
+ * Processes the parsed CDS feature data to
+ * <ul>
+ * <li>add a CDS feature to the sequence for each CDS start-end range</li>
+ * <li>create a protein product sequence for the translation</li>
+ * <li>create a cross-reference to protein with mapping from dna</li>
+ * <li>add any CDS dbrefs to the sequence and to the protein product</li>
+ * </ul>
+ * @param SequenceI dna
+ */
+ void processCDS(SequenceI dna)
+ {
+ /*
+ * parse location into a list of [start, end, start, end] positions
+ */
+ int[] exons = getCdsRanges(this.accession, this.cdsLocation);
+ int exonNumber = 0;
+
+ for (int xint = 0; exons != null
+ && xint < exons.length - 1; xint += 2)
+ {
+ int exonStart = exons[xint];
+ int exonEnd = exons[xint + 1];
+ int begin = Math.min(exonStart, exonEnd);
+ int end = Math.max(exonStart, exonEnd);
+ exonNumber++;
+ String desc = String.format("Exon %d for protein EMBLCDS:%s",
+ exonNumber, proteinId);
+
+ SequenceFeature sf = new SequenceFeature("CDS", desc, begin, end, this.sourceDb);
+ if (!cdsProps.isEmpty())
+ {
+ for (Entry<String, String> val : cdsProps.entrySet())
+ {
+ sf.setValue(val.getKey(), val.getValue());
+ }
+ }
+
+ sf.setEnaLocation(this.cdsLocation);
+ boolean forwardStrand = exonStart <= exonEnd;
+ sf.setStrand(forwardStrand ? "+" : "-");
+ sf.setPhase(String.valueOf(codonStart - 1));
+ sf.setValue(FeatureProperties.EXONPOS, exonNumber);
+ sf.setValue(FeatureProperties.EXONPRODUCT, proteinName);
+
+ dna.addSequenceFeature(sf);
+ }
+ }
+
+ /**
+ * Constructs and saves the sequence from parsed components
+ */
+ void assembleSequence()
+ {
+ String name = this.accession;
+ if (this.sourceDb != null)
+ {
+ name = this.sourceDb + "|" + name;
+ }
+ SequenceI seq = new Sequence(name, this.sequenceString);
+ for (DBRefEntry dbref : this.dbrefs)
+ {
+ seq.addDBRef(dbref);
+ }
+
+ processCDS(seq);
+ seq.deriveSequence();
+
+ addSequence(seq);
+ }
+
+ /**
+ * Output (print) is not implemented for EMBL flat file format
+ */
+ @Override
+ public String print(SequenceI[] seqs, boolean jvsuffix)
+ {
+ return null;
+ }
+
+ /**
+ * Returns the CDS location as a single array of [start, end, start, end...]
+ * positions. If on the reverse strand, these will be in descending order.
+ *
+ * @param accession
+ * @param location
+ * @return
+ */
+ protected int[] getCdsRanges(String accession, String location)
+ {
+ if (location == null)
+ {
+ return new int[] {};
+ }
+
+ try
+ {
+ List<int[]> ranges = DnaUtils.parseLocation(location);
+ return MappingUtils.listToArray(ranges);
+ } catch (ParseException e)
+ {
+ Cache.log.warn(
+ String.format("Not parsing inexact CDS location %s in ENA %s",
+ location, accession));
+ return new int[] {};
+ }
+ }
+}
}
}
}
+
+ /**
+ * Converts a list of [start, end] ranges to a single array of [start, end,
+ * start, end ...]
+ *
+ * @param ranges
+ * @return
+ */
+ public static int[] listToArray(List<int[]> ranges)
+ {
+ int[] result = new int[ranges.size() * 2];
+ int i = 0;
+ for (int[] range : ranges)
+ {
+ result[i++] = range[0];
+ result[i++] = range[1];
+ }
+ return result;
+ }
}
*/
package jalview.ws.dbsources;
+import com.stevesoft.pat.Regex;
+
import jalview.datamodel.AlignmentI;
import jalview.datamodel.DBRefSource;
-import com.stevesoft.pat.Regex;
-
-public class EmblCdsSource extends EmblXmlSource
+public class EmblCdsSource extends /*EmblXmlSource */ EmblFlatfileSource
{
public EmblCdsSource()
}
@Override
- public String getAccessionSeparator()
- {
- return null;
- }
-
- @Override
- public Regex getAccessionValidator()
- {
- return new Regex("^[A-Z]+[0-9]+");
- }
-
- @Override
public String getDbSource()
{
return DBRefSource.EMBLCDS;
}
@Override
- public String getDbVersion()
- {
- return "0"; // TODO : this is dynamically set for a returned record - not
- // tied to proxy
- }
-
- @Override
public AlignmentI getSequenceRecords(String queries) throws Exception
{
if (queries.indexOf(".") > -1)
return getEmblSequenceRecords(DBRefSource.EMBLCDS, queries);
}
- @Override
- public boolean isValidReference(String accession)
- {
- // most embl CDS refs look like ..
- // TODO: improve EMBLCDS regex
- return (accession == null || accession.length() < 2) ? false
- : getAccessionValidator().search(accession);
- }
-
/**
* cDNA for LDHA_CHICK swissprot sequence
*/
return "EMBL (CDS)";
}
- @Override
- public int getTier()
- {
- return 0;
- }
-
}
--- /dev/null
+package jalview.ws.dbsources;
+
+import java.io.File;
+import java.io.IOException;
+
+import com.stevesoft.pat.Regex;
+
+import jalview.bin.Cache;
+import jalview.datamodel.Alignment;
+import jalview.datamodel.AlignmentI;
+import jalview.datamodel.SequenceI;
+import jalview.io.DataSourceType;
+import jalview.io.EmblFlatFile;
+import jalview.io.FileParse;
+import jalview.ws.ebi.EBIFetchClient;
+
+/**
+ * A class that does partial parsing of an EMBL flatfile.
+ *
+ * @author gmcarstairs
+ *
+ */
+public abstract class EmblFlatfileSource extends EbiFileRetrievedProxy
+{
+ private static final Regex ACCESSION_REGEX = new Regex("^[A-Z]+[0-9]+");
+
+ @Override
+ public String getDbVersion()
+ {
+ return "0";
+ }
+
+ @Override
+ public String getAccessionSeparator()
+ {
+ return null;
+ }
+
+ @Override
+ public Regex getAccessionValidator()
+ {
+ return ACCESSION_REGEX;
+ }
+
+ @Override
+ public boolean isValidReference(String accession)
+ {
+ if (accession == null || accession.length() < 2)
+ {
+ return false;
+ }
+ return getAccessionValidator().search(accession);
+ }
+
+ @Override
+ public AlignmentI getSequenceRecords(String queries) throws Exception
+ {
+ return null;
+ }
+
+ @Override
+ public int getTier()
+ {
+ return 0;
+ }
+
+ protected AlignmentI getEmblSequenceRecords(String dbName, String query)
+ throws Exception
+ {
+ startQuery();
+ EBIFetchClient dbFetch = new EBIFetchClient();
+ File reply;
+ try
+ {
+ reply = dbFetch.fetchDataAsFile(
+ dbName.toLowerCase() + ":" + query.trim(), null, "txt");
+ } catch (Exception e)
+ {
+ stopQuery();
+ throw new Exception(
+ String.format("EBI EMBL XML retrieval failed for %s:%s",
+ dbName.toLowerCase(), query.trim()),
+ e);
+ }
+ return getEmblSequenceRecords(dbName, query, reply);
+ }
+
+ private AlignmentI getEmblSequenceRecords(String dbName, String query,
+ File reply) throws IOException
+ {
+ AlignmentI al = null;
+
+ if (reply != null && reply.exists())
+ {
+ file = reply.getAbsolutePath();
+ FileParse fp = new FileParse(file, DataSourceType.FILE);
+ EmblFlatFile emblParser = new EmblFlatFile(fp, getDbSource());
+ emblParser.parse();
+ SequenceI[] seqs = emblParser.getSeqsAsArray();
+ if (seqs.length > 0)
+ {
+ al = new Alignment(seqs);
+ }
+
+ if (al == null)
+ {
+ Cache.log.error(
+ "No record found for '" + dbName + ":" + query + "'");
+ }
+ }
+
+ stopQuery();
+ return al;
+ }
+}
import jalview.datamodel.AlignmentI;
import jalview.datamodel.DBRefSource;
-import com.stevesoft.pat.Regex;
-
/**
* @author JimP
*
*/
-public class EmblSource extends EmblXmlSource
+public class EmblSource extends /* EmblXmlSource */ EmblFlatfileSource
{
public EmblSource()
/*
* (non-Javadoc)
*
- * @see jalview.ws.DbSourceProxy#getAccessionSeparator()
- */
- @Override
- public String getAccessionSeparator()
- {
- // TODO Auto-generated method stub
- return null;
- }
-
- /*
- * (non-Javadoc)
- *
- * @see jalview.ws.DbSourceProxy#getAccessionValidator()
- */
- @Override
- public Regex getAccessionValidator()
- {
- return new Regex("^[A-Z]+[0-9]+");
- }
-
- /*
- * (non-Javadoc)
- *
* @see jalview.ws.DbSourceProxy#getDbSource()
*/
@Override
/*
* (non-Javadoc)
*
- * @see jalview.ws.DbSourceProxy#getDbVersion()
- */
- @Override
- public String getDbVersion()
- {
- // TODO Auto-generated method stub
- return "0";
- }
-
- /*
- * (non-Javadoc)
- *
* @see jalview.ws.DbSourceProxy#getSequenceRecords(java.lang.String[])
*/
@Override
return getEmblSequenceRecords(DBRefSource.EMBL, queries);
}
- /*
- * (non-Javadoc)
- *
- * @see jalview.ws.DbSourceProxy#isValidReference(java.lang.String)
- */
- @Override
- public boolean isValidReference(String accession)
- {
- // most embl refs look like ..
-
- return (accession == null || accession.length() < 2) ? false
- : getAccessionValidator().search(accession);
-
- }
-
/**
* return LHD_CHICK coding gene
*/
{
return "EMBL"; // getDbSource();
}
-
- @Override
- public int getTier()
- {
- return 0;
- }
}
*/
package jalview.ws.dbsources;
+import java.io.File;
+import java.io.FileInputStream;
+import java.io.InputStream;
+import java.text.ParseException;
+import java.util.ArrayList;
+import java.util.Arrays;
+import java.util.Hashtable;
+import java.util.List;
+import java.util.Map;
+import java.util.Map.Entry;
+
+import javax.xml.bind.JAXBContext;
+import javax.xml.bind.JAXBElement;
+import javax.xml.bind.JAXBException;
+import javax.xml.stream.FactoryConfigurationError;
+import javax.xml.stream.XMLInputFactory;
+import javax.xml.stream.XMLStreamException;
+import javax.xml.stream.XMLStreamReader;
+
+import com.stevesoft.pat.Regex;
+
import jalview.analysis.SequenceIdMatcher;
import jalview.bin.Cache;
import jalview.datamodel.Alignment;
import jalview.util.DnaUtils;
import jalview.util.MapList;
import jalview.util.MappingUtils;
-import jalview.util.MessageManager;
import jalview.ws.ebi.EBIFetchClient;
import jalview.xml.binding.embl.EntryType;
import jalview.xml.binding.embl.EntryType.Feature;
import jalview.xml.binding.embl.EntryType.Feature.Qualifier;
+import jalview.xml.binding.embl.ROOT;
import jalview.xml.binding.embl.XrefType;
-import java.io.File;
-import java.io.FileInputStream;
-import java.io.InputStream;
-import java.text.ParseException;
-import java.util.ArrayList;
-import java.util.Arrays;
-import java.util.Hashtable;
-import java.util.List;
-import java.util.Map;
-import java.util.Map.Entry;
-
-import javax.xml.bind.JAXBContext;
-import javax.xml.bind.JAXBException;
-import javax.xml.stream.FactoryConfigurationError;
-import javax.xml.stream.XMLInputFactory;
-import javax.xml.stream.XMLStreamException;
-import javax.xml.stream.XMLStreamReader;
-
+/**
+ * Provides XML binding and parsing of EMBL or EMBLCDS records retrieved from
+ * (e.g.) {@code https://www.ebi.ac.uk/ena/data/view/x53828&display=xml}.
+ *
+ * @deprecated endpoint withdrawn August 2020 (JAL-3692), use EmblFlatfileSource
+ */
public abstract class EmblXmlSource extends EbiFileRetrievedProxy
{
+ private static final Regex ACCESSION_REGEX = new Regex("^[A-Z]+[0-9]+");
+
/*
* JAL-1856 Embl returns this text for query not found
*/
} catch (Exception e)
{
stopQuery();
- throw new Exception(MessageManager.formatMessage(
- "exception.ebiembl_retrieval_failed_on", new String[]
- { emprefx.toLowerCase(), query.trim() }), e);
+ throw new Exception(
+ String.format("EBI EMBL XML retrieval failed for %s:%s",
+ emprefx.toLowerCase(), query.trim()),
+ e);
}
return getEmblSequenceRecords(emprefx, query, reply);
}
XMLStreamReader streamReader = XMLInputFactory.newInstance()
.createXMLStreamReader(is);
javax.xml.bind.Unmarshaller um = jc.createUnmarshaller();
- jalview.xml.binding.embl.ROOT root = (jalview.xml.binding.embl.ROOT) um
- .unmarshal(streamReader);
+ JAXBElement<ROOT> rootElement = um.unmarshal(streamReader,
+ ROOT.class);
+ ROOT root = rootElement.getValue();
/*
* document root contains either "entry" or "entrySet"
&& dnaToProteinMapping.getTo() != null)
{
DBRefEntry dnaToEmblProteinRef = new DBRefEntry(
- DBRefSource.EMBLCDSProduct, sequenceVersion,
- proteinId);
+ DBRefSource.EMBLCDSProduct, sequenceVersion, proteinId);
dnaToEmblProteinRef.setMap(dnaToProteinMapping);
dnaToProteinMapping.setMappedFromId(proteinId);
dna.addDBRef(dnaToEmblProteinRef);
{
return new int[] {};
}
-
+
try
{
List<int[]> ranges = DnaUtils.parseLocation(location);
return sf;
}
+ @Override
+ public String getAccessionSeparator()
+ {
+ return null;
+ }
+
+ @Override
+ public Regex getAccessionValidator()
+ {
+ return ACCESSION_REGEX;
+ }
+
+ @Override
+ public String getDbVersion()
+ {
+ return "0";
+ }
+
+ @Override
+ public int getTier()
+ {
+ return 0;
+ }
+
+ @Override
+ public boolean isValidReference(String accession)
+ {
+ if (accession == null || accession.length() < 2)
+ {
+ return false;
+ }
+ return getAccessionValidator().search(accession);
+ }
+
/**
* Truncates (if necessary) the exon intervals to match 3 times the length of
* the protein; also accepts 3 bases longer (for stop codon not included in
}
int expectedCdsLength = proteinLength * 3;
int exonLength = MappingUtils.getLength(Arrays.asList(exon));
-
+
/*
* if exon length matches protein, or is shorter, or longer by the
* length of a stop codon (3 bases), then leave it unchanged
{
return exon;
}
-
+
int origxon[];
int sxpos = -1;
int endxon = 0;
// .println("Truncating final exon interval on region by "
// + (cdspos - cdslength));
}
-
+
/*
* shrink the final exon - reduce end position if forward
* strand, increase it if reverse
break;
}
}
-
+
if (sxpos != -1)
{
// and trim the exon interval set if necessary
import java.io.BufferedReader;
import java.io.File;
import java.io.FileOutputStream;
+import java.io.IOException;
import java.io.InputStream;
import java.io.InputStreamReader;
import java.net.HttpURLConnection;
* the query formatted as db:query1;query2;query3
* @param format
* the format wanted
- * @param extension
+ * @param ext
* for the temporary file to hold response (without separator)
* @return the file holding the response
* @throws OutOfMemoryError
{
// long time = System.currentTimeMillis();
String url = buildUrl(ids, database, format);
-
+ InputStream is = null;
+ BufferedReader br = null;
try
{
URL rcall = new URL(url);
System.err.println("Warning: response code " + responseCode
+ " for " + url);
}
- InputStream is = new BufferedInputStream(conn.getInputStream());
+ is = new BufferedInputStream(conn.getInputStream());
if (outFile != null)
{
FileOutputStream fio = new FileOutputStream(outFile);
}
else
{
- BufferedReader br = new BufferedReader(new InputStreamReader(is));
+ br = new BufferedReader(new InputStreamReader(is));
String rtn;
List<String> arl = new ArrayList<String>();
while ((rtn = br.readLine()) != null)
{
// System.err.println("EBIFetch took " + (System.currentTimeMillis() -
// time) + " ms");
+ if (is != null)
+ {
+ try
+ {
+ is.close();
+ } catch (IOException e)
+ {
+ }
+ }
+ if (br != null)
+ {
+ try
+ {
+ br.close();
+ } catch (IOException e)
+ {
+ }
+ }
}
return null;
}
if (database.equalsIgnoreCase(DBRefSource.EMBL)
|| database.equalsIgnoreCase(DBRefSource.EMBLCDS))
{
- url = "https://www.ebi.ac.uk/ena/data/view/" + ids.toLowerCase()
- + (format != null ? "&" + format : "");
+// url = "https://www.ebi.ac.uk/ena/data/view/" + ids.toLowerCase()
+// + (format != null ? "&" + format : "");
+ url = "https://www.ebi.ac.uk/ena/browser/api/embl/" + ids.toLowerCase();
}
else
{
import static org.testng.AssertJUnit.assertFalse;
import static org.testng.AssertJUnit.assertSame;
import static org.testng.AssertJUnit.assertTrue;
+import static org.testng.AssertJUnit.fail;
import jalview.api.AlignViewportI;
import jalview.commands.EditCommand;
assertEquals(1, ranges.size());
assertEquals(9, ranges.get(0)[1]);
}
+
+ @Test(groups = "Functional")
+ public void testListToArray()
+ {
+ List<int[]> ranges = new ArrayList<>();
+
+ int[] result = MappingUtils.listToArray(ranges);
+ assertEquals(result.length, 0);
+ ranges.add(new int[] {24, 12});
+ result = MappingUtils.listToArray(ranges);
+ assertEquals(result.length, 2);
+ assertEquals(result[0], 24);
+ assertEquals(result[1], 12);
+ ranges.add(new int[] {-7, 30});
+ result = MappingUtils.listToArray(ranges);
+ assertEquals(result.length, 4);
+ assertEquals(result[0], 24);
+ assertEquals(result[1], 12);
+ assertEquals(result[2], -7);
+ assertEquals(result[3], 30);
+ try
+ {
+ MappingUtils.listToArray(null);
+ fail("Expected exception");
+ } catch (NullPointerException e)
+ {
+ // expected
+ }
+ }
}
import static org.testng.AssertJUnit.assertSame;
import static org.testng.AssertJUnit.assertTrue;
+import jalview.datamodel.AlignmentI;
import jalview.datamodel.DBRefEntry;
import jalview.datamodel.DBRefSource;
import jalview.datamodel.SequenceI;
import java.util.Arrays;
import java.util.List;
+import org.testng.annotations.BeforeClass;
import org.testng.annotations.Test;
-public class EmblSourceTest
+public class EmblXmlSourceTest
{
// adapted from http://www.ebi.ac.uk/ena/data/view/X07547&display=xml
+ "ACCCCCAATATTGTGATATAATTAAAAACATAGCAT"
+ "</sequence></entry></ROOT>";
+ private EmblXmlSource testee;
+
+ @BeforeClass(alwaysRun = true)
+ public void setUp()
+ {
+ testee = new EmblXmlSource()
+ {
+
+ @Override
+ public String getDbSource()
+ {
+ return null;
+ }
+
+ @Override
+ public String getDbName()
+ {
+ return null;
+ }
+
+ @Override
+ public String getTestQuery()
+ {
+ return null;
+ }
+
+ @Override
+ public AlignmentI getSequenceRecords(String queries) throws Exception
+ {
+ return null;
+ }
+ };
+ }
+
@Test(groups = "Functional")
public void testGetCdsRanges()
{
- EmblSource testee = new EmblSource();
-
/*
* Make a (CDS) Feature with 5 locations
*/
Feature cds = new Feature();
- cds.setLocation("join(10..20,complement(30..40),50..60,70..80,complement(110..120))");
+ cds.setLocation(
+ "join(10..20,complement(30..40),50..60,70..80,complement(110..120))");
int[] exons = testee.getCdsRanges("EMBL", cds);
assertEquals("[10, 20, 40, 30, 50, 60, 70, 80, 120, 110]",
{
// not the whole sequence but enough for this test...
List<SequenceI> peptides = new ArrayList<>();
- List<EntryType> entries = EmblSourceTest.getEmblEntries();
+ List<EntryType> entries = getEmblEntries();
assertEquals(1, entries.size());
EntryType entry = entries.get(0);
- EmblSource testee = new EmblSource();
String sourceDb = "EMBL";
SequenceI dna = testee.getSequence(sourceDb, entry, peptides);
3, 1);
MapList cds2Map = new MapList(new int[] { 4, 15 }, new int[] { 1, 4 },
3, 1);
- MapList cds3Map = new MapList(new int[] { 4, 6, 10, 15 }, new int[] {
- 1, 3 }, 3, 1);
+ MapList cds3Map = new MapList(new int[] { 4, 6, 10, 15 },
+ new int[]
+ { 1, 3 }, 3, 1);
DBRefEntry[] dbrefs = dna.getDBRefs();
assertEquals(7, dbrefs.length);
* - to EMBLCDS (with 1:3 mapping)
* - direct (no mapping) to other protein accessions
*/
- MapList proteinToCdsMap1 = new MapList(new int[] { 1, 4 }, new int[] {
- 1, 12 }, 1, 3);
- MapList proteinToCdsMap2 = new MapList(new int[] { 1, 3 }, new int[] {
- 1, 9 }, 1, 3);
+ MapList proteinToCdsMap1 = new MapList(new int[] { 1, 4 },
+ new int[]
+ { 1, 12 }, 1, 3);
+ MapList proteinToCdsMap2 = new MapList(new int[] { 1, 3 },
+ new int[]
+ { 1, 9 }, 1, 3);
// dbrefs for first CDS EMBL product CAA30420.1
dbrefs = peptides.get(0).getDBRefs();
@Test(groups = { "Functional" })
public void testGetEmblEntries()
{
- List<EntryType> entries = EmblSourceTest.getEmblEntries();
+ List<EntryType> entries = getEmblEntries();
assertEquals(1, entries.size());
EntryType entry = entries.get(0);
-
+
assertEquals("X07547", entry.getAccession());
assertEquals("C. trachomatis plasmid", entry.getDescription());
assertEquals("STD", entry.getDataClass());
assertEquals(2, entry.getKeyword().size());
assertEquals("plasmid", entry.getKeyword().get(0));
assertEquals("unidentified reading frame", entry.getKeyword().get(1));
-
+
/*
* dbrefs
*/
assertEquals("MD5", dbref.getDb());
assertEquals("ac73317", dbref.getId());
assertNull(dbref.getSecondaryId());
-
+
/*
* three sequence features for CDS
*/
q = ef.getQualifier().get(2);
assertEquals("translation", q.getName());
assertEquals("MLCF", q.getValue());
-
+
/*
* second CDS
*/
q = ef.getQualifier().get(1);
assertEquals("translation", q.getName());
assertEquals("MSSS", q.getValue());
-
+
/*
* third CDS
*/
q = ef.getQualifier().get(1);
assertEquals("translation", q.getName());
assertEquals("MSS", q.getValue());
-
+
/*
* Sequence - raw data before removal of newlines
*/
String seq = entry.getSequence();
- assertEquals(
- "GGTATGTCCTCTAGTACAAAC\n"
- + "ACCCCCAATATTGTGATATAATTAAAAACATAGCAT",
- seq);
-
+ assertEquals("GGTATGTCCTCTAGTACAAAC\n"
+ + "ACCCCCAATATTGTGATATAATTAAAAACATAGCAT", seq);
+
/*
* getSequence() converts empty DBRefEntry.version to "0"
*/
assertNull(entry.getFeature().get(0).getXref().get(1).getSecondaryId());
}
- static List<EntryType> getEmblEntries()
+ List<EntryType> getEmblEntries()
{
- return new EmblSource()
+ return testee
.getEmblEntries(new ByteArrayInputStream(TESTDATA.getBytes()));
}
}
git://source.jalview.org / jalview.git / commitdiff