-<html>
-<!--
- * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
- * Copyright (C) $$Year-Rel$$ The Jalview Authors
- *
- * This file is part of Jalview.
- *
- * Jalview is free software: you can redistribute it and/or
- * modify it under the terms of the GNU General Public License
- * as published by the Free Software Foundation, either version 3
- * of the License, or (at your option) any later version.
- *
- * Jalview is distributed in the hope that it will be useful, but
- * WITHOUT ANY WARRANTY; without even the implied warranty
- * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
- * PURPOSE. See the GNU General Public License for more details.
- *
- * You should have received a copy of the GNU General Public License
- * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
- * The Jalview Authors are detailed in the 'AUTHORS' file.
- -->
-<head>
-<title>Alignment Window Menus</title>
-</head>
-
-<body>
- <p>
- <strong>Alignment Window Calculate Menu</strong>
- </p>
- <ul>
- <li><strong>Sort </strong>
- <ul>
- <li><strong>By ID</strong><em><br> This will sort
- the sequences according to sequence name. If the sort is
- repeated, the order of the sorted sequences will be
- inverted. </em></li>
- <li><strong>By Length</strong><em><br> This will
- sort the sequences according to their length (excluding gap
- characters). If the sort is repeated, the order of the
- sorted sequences will be inverted. </em></li>
- <li><strong>By Group</strong><strong><br> </strong><em>This
- will sort the sequences according to sequence name. If the
- sort is repeated, the order of the sorted sequences will be
- inverted. </em><strong></strong></li>
- <li><strong>By Pairwise Identity<br>
- </strong><em>This will sort the selected sequences by their
- percentage identity to the consensus sequence. The most
- similar sequence is put at the top. </em></li>
- <li><em>The <a href="../calculations/sorting.html">Sort
- menu</a> will have some additional options if the alignment
- has any associated score annotation, or you have just done a
- multiple alignment calculation or opened a tree viewer
- window.
- </em><br></li>
- </ul></li>
- <li><strong>Calculate Tree or PCA ...</strong> <br> <em>Opens the
- <a href="../calculations/calculations.html">calculations dialog</a> for
- for calculating <a href="../calculations/tree.html">trees</a> or
- <a href="../calculations/pca.html">principle component analysis
- plots</a> on the alignment or the currently selected
- region.
- </em><br>
- </li>
- <li><strong>Pairwise Alignments</strong><br> <em>Applies
- Smith and Waterman algorithm to selected sequences. See <a
- href="../calculations/pairwise.html">pairwise
- alignments</a>.
- </em><br></li>
- <li><strong>Extract Scores ... (optional)</strong><br> <em>This
- option is only visible if Jalview detects one or more
- white-space separated values in the description line of the
- alignment sequences.<br> When selected, these numbers are
- parsed into sequence associated annotation which can then be
- used to sort the alignment via the Sort by→Score menu.
- </em> <br></li>
- <li><strong>Translate as cDNA</strong> (not applet)<br> <em>This
- option is visible for nucleotide alignments. Selecting this
- option shows the DNA's calculated protein product in a new <a
- href="../features/splitView.html">split frame</a> window. Note
- that the translation is not frame- or intron-aware; it simply
- translates all codons in each sequence, using the standard <a
- href="../misc/geneticCode.html">genetic code</a> (any incomplete
- final codon is discarded). You can perform this action on the
- whole alignment, or selected rows, columns, or regions.
- </em> <br></li>
- <li><strong>Reverse, Reverse Complement</strong> (not applet)<br>
- <em>These options are visible for nucleotide alignments.
- Selecting them adds the reverse (or reverse complement) of the
- sequences (or selected region) as new sequences in the
- alignment. To try this out, add this sequence and perform
- 'Reverse Complement' followed by 'Translate as cDNA': <br>
- <small> Seq
- GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC
- TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG</small>
- </em> <br></li>
- <li><strong>Get Cross-References</strong> (not applet)<br>
- <em>This option is visible where sequences have
- cross-references to other standard databases; for example, an
- EMBL entry may have cross-references to one or more UNIPROT
- entries. Select the database to view all cross-referenced
- sequences in a new <a href="../features/splitView.html">split
- frame</a> window.
- </em> <br></li>
- <li><strong>Autocalculate Consensus</strong><br> <em>For
- large alignments it can be useful to deselect
- "Autocalculate Consensus" when editing. This prevents
- the sometimes lengthy calculations performed after each sequence
- edit.</em> <br></li>
- <li><strong>Sort Alignment With New Tree</strong><br> <em>If
- this option is selected, the alignment will be automatically
- sorted whenever a new tree is calculated or loaded.</em> <br></li>
- <li><strong>Show Flanking Regions</strong><br> <em>Opens
- a new alignment window showing any additional sequence data
- either side of the current alignment. Useful in conjunction with
- 'Fetch Database References' when the 'Trim Retrieved Sequences'
- option is disabled to retrieve full length sequences for a set
- of aligned peptides. </em></li>
- </ul>
-</body>
-</html>