+++ /dev/null
-/*
- VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases.
- Copyright (C) 2008 Kevin Darty, Alain Denise and Yann Ponty.
- electronic mail : Yann.Ponty@lri.fr
- paper mail : LRI, bat 490 Université Paris-Sud 91405 Orsay Cedex France
-
- This file is part of VARNA version 3.1.
- VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License
- as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
-
- VARNA version 3.1 is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY;
- without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
- See the GNU General Public License for more details.
-
- You should have received a copy of the GNU General Public License along with VARNA version 3.1.
- If not, see http://www.gnu.org/licenses.
- */
-package fr.orsay.lri.varna.applications;
-
-import java.awt.BorderLayout;
-import java.awt.Color;
-import java.awt.Dimension;
-import java.awt.Font;
-import java.awt.GridLayout;
-import java.awt.event.ActionEvent;
-import java.awt.event.ActionListener;
-import java.awt.event.ItemEvent;
-import java.awt.event.ItemListener;
-import java.awt.event.MouseEvent;
-import java.math.BigInteger;
-import java.util.ArrayList;
-import java.util.Collections;
-
-import javax.swing.BorderFactory;
-import javax.swing.DefaultComboBoxModel;
-import javax.swing.JButton;
-import javax.swing.JComboBox;
-import javax.swing.JFrame;
-import javax.swing.JLabel;
-import javax.swing.JOptionPane;
-import javax.swing.JPanel;
-import javax.swing.JSplitPane;
-import javax.swing.JTextArea;
-import javax.swing.JTextField;
-import javax.swing.JTextPane;
-import javax.swing.border.BevelBorder;
-
-import fr.orsay.lri.varna.VARNAPanel;
-import fr.orsay.lri.varna.controlers.ControleurInterpolator;
-import fr.orsay.lri.varna.exceptions.ExceptionDrawingAlgorithm;
-import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax;
-import fr.orsay.lri.varna.exceptions.ExceptionModeleStyleBaseSyntaxError;
-import fr.orsay.lri.varna.exceptions.ExceptionNAViewAlgorithm;
-import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
-import fr.orsay.lri.varna.exceptions.ExceptionParameterError;
-import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses;
-import fr.orsay.lri.varna.exceptions.MappingException;
-import fr.orsay.lri.varna.models.VARNAConfig;
-import fr.orsay.lri.varna.models.VARNAConfig.BP_STYLE;
-import fr.orsay.lri.varna.models.rna.Mapping;
-import fr.orsay.lri.varna.models.rna.ModeleBP;
-import fr.orsay.lri.varna.models.rna.ModeleBase;
-import fr.orsay.lri.varna.models.rna.ModelBaseStyle;
-import fr.orsay.lri.varna.models.rna.RNA;
-import fr.orsay.lri.varna.interfaces.InterfaceVARNABasesListener;
-import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener;;
-
-public class NussinovDesignDemo extends JFrame implements InterfaceVARNAListener,InterfaceVARNABasesListener, ItemListener {
-
- /**
- *
- */
- private static final long serialVersionUID = -790155708306987257L;
-
- private static final String SEQUENCE_A = "AGGCACGUCU";
- private static final String SEQUENCE_B = "GAGUAGCCUC";
- private static final String SEQUENCE_C = "GCAUAGCUGC";
- private static final String SEQUENCE_INRIA = "CGAUUGCAUCGCAAGU";
-
- private static final String TARGET_STRUCTURE_1 = "(((((((..)))))))";
- private static final String TARGET_STRUCTURE_2 = "(((())))(((())))";
- private static final String TARGET_STRUCTURE_3 = "(.((.((..).)).))";
- private static final String TARGET_STRUCTURE_4 = "((((((())))(((())(()))))))";
- private static final String TARGET_STRUCTURE_5 = "(((())))(((())))(((())))(((())))(((())))(((())))";
-
- private static final String SEQUENCE_BIG = "AAAACAAAAACACCAUGGUGUUUUCACCCAAUUGGGUGAAAACAGAGAUCUCGAGAUCUCUGUUUUUGUUUU";
-
- private static final String DEFAULT_STRUCTURE = "..........";
- // private static final String DEFAULT_STRUCTURE1 = "((((....))))";
- // private static final String DEFAULT_STRUCTURE2 =
- // "((((..(((....)))..))))";
-
- private VARNAPanel _vpMaster;
- private VARNAPanel _vpTarget;
-
- private InfoPanel _infos = new InfoPanel();
- private JPanel _tools = new JPanel();
- private JPanel _input = new JPanel();
-
- private JPanel _seqPanel = new JPanel();
- private JPanel _structPanel = new JPanel();
- private JLabel _actions = new JLabel();
- private JComboBox _struct = new JComboBox();
- private JLabel _seq1 = new JLabel();
- private JLabel _structLabel = new JLabel("Structure Cible");
- private JLabel _seqLabel = new JLabel("Sequence d'ARN");
- private JButton _switchButton = new JButton("Reset");
-
-
- private Color _backgroundColor = Color.white;
-
- private Color _okColor = Color.decode("#E33729");
- private Color _koColor = new Color(250,200,200);
-
-
- public static ModelBaseStyle createStyle(String txt)
- {
- ModelBaseStyle result = new ModelBaseStyle();
- try {
- result.assignParameters(txt);
- } catch (ExceptionModeleStyleBaseSyntaxError e) {
- // TODO Auto-generated catch block
- e.printStackTrace();
- } catch (ExceptionParameterError e) {
- // TODO Auto-generated catch block
- e.printStackTrace();
- }
- return result;
- }
-
- public void applyTo(VARNAPanel vp, ModelBaseStyle mb, int[] indices)
- {
- for(int i=0;i<indices.length;i++)
- {
- ModeleBase m = vp.getRNA().getBaseAt(indices[i]);
- m.setStyleBase(mb);
- if (m.getElementStructure()!=-1)
- {
- vp.getRNA().getBaseAt(m.getElementStructure()).setStyleBase(mb);
- }
- }
- vp.repaint();
- }
-
-
- public NussinovDesignDemo() {
- super();
- try {
- _vpMaster = new VARNAPanel(getSeq(), "");
- _vpTarget = new VARNAPanel();
- } catch (ExceptionNonEqualLength e) {
- _vpMaster.errorDialog(e);
- }
- _vpMaster.setPreferredSize(new Dimension(600, 600));
- _vpTarget.setPreferredSize(new Dimension(600, 600));
- RNAPanelDemoInit();
- }
-
- static Font labelsFont = Font.decode("Dialog-BOLD-25");
-
- private void RNAPanelDemoInit() {
- int marginTools = 250;
- Font textFieldsFont = Font.decode("MonoSpaced-BOLD-16");
-
-
-
- _seq1.setFont(textFieldsFont.deriveFont(25f));
-
-
- setBackground(_backgroundColor);
-
-
- _structLabel.setFont(labelsFont.deriveFont(Font.PLAIN));
-
-
- String[] secstr = {TARGET_STRUCTURE_1,TARGET_STRUCTURE_2,TARGET_STRUCTURE_3,TARGET_STRUCTURE_4,TARGET_STRUCTURE_5};
- DefaultComboBoxModel cm = new DefaultComboBoxModel(secstr);
- _struct.setModel(cm);
- _struct.addActionListener(new ActionListener() {
- public void actionPerformed(ActionEvent e) {
- System.out.println(e.getActionCommand());
- setTarget(((JComboBox)e.getSource()).getSelectedItem().toString());
- }
- });
- _struct.setFont(textFieldsFont);
- _struct.setEnabled(true);
- _struct.setEditable(true);
-
-
- _switchButton.addActionListener(new ActionListener() {
- public void actionPerformed(ActionEvent e) {
- setTarget(_struct.getSelectedItem().toString());
- }
- });
-
- _seqPanel.setLayout(new BorderLayout());
- _seqPanel.add(_seqLabel, BorderLayout.WEST);
- _seqPanel.add(_seq1, BorderLayout.CENTER);
-
- _seqPanel.setBorder(BorderFactory.createEmptyBorder(5, 5, 5, 5));
-
- _structLabel.setPreferredSize(new Dimension(marginTools, 15));
- _structLabel.setHorizontalTextPosition(JLabel.LEFT);
- _structPanel.setLayout(new BorderLayout());
- _structPanel.add(_structLabel, BorderLayout.WEST);
- _structPanel.add(_struct, BorderLayout.CENTER);
-
- _input.setLayout(new GridLayout(0, 1));
- _input.add(_structPanel);
-
- JPanel goPanel = new JPanel();
- goPanel.setLayout(new BorderLayout());
-
- _infos.setFont(labelsFont);
-
-
- formatLabel(_seqLabel);
- formatLabel(_seq1);
-
-
- _tools.setLayout(new BorderLayout());
- //_tools.add(_infos, BorderLayout.NORTH);
- _tools.add(_input, BorderLayout.CENTER);
- _tools.add(_actions, BorderLayout.SOUTH);
- _tools.add(goPanel, BorderLayout.EAST);
-
- _tools.setBorder(BorderFactory.createEmptyBorder(5, 5, 5, 5));
-
- //goPanel.add(_goButton, BorderLayout.CENTER);
- goPanel.add(_switchButton, BorderLayout.CENTER);
-
- getContentPane().setLayout(new BorderLayout());
- JSplitPane VARNAs = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT);
- VARNAs.setBorder(BorderFactory.createBevelBorder(BevelBorder.RAISED));
- //VARNAs.setLayout(new GridLayout(1,2));
- JPanel mast2 = new JPanel();
- mast2.setLayout(new BorderLayout());
- mast2.add(_seqPanel, BorderLayout.NORTH);
- mast2.add(_infos, BorderLayout.SOUTH);
-
- JPanel mast = new JPanel();
- mast.setLayout(new BorderLayout());
- mast.add(_vpMaster, BorderLayout.CENTER);
- mast.add(mast2,BorderLayout.SOUTH);
-
- VARNAs.add(mast);
- VARNAs.add(_vpTarget);
- VARNAs.doLayout();
- VARNAs.setDividerSize(5);
-
- getContentPane().add(VARNAs, BorderLayout.CENTER);
- getContentPane().add(_tools, BorderLayout.NORTH);
-
- setVisible(true);
-
-
- _vpMaster.setBackground(_backgroundColor);
- _vpMaster.addVARNAListener(this);
- _vpMaster.setTitle("Meilleur repliement - Séquence courante");
- _vpMaster.setBPStyle(BP_STYLE.SIMPLE);
- _vpMaster.getVARNAUI().UIRadiate();
- _vpMaster.setTitleFontSize(26f);
- _vpMaster.setTitleFontStyle(Font.PLAIN);
-
- _vpTarget.setBackground(Color.decode("#308099"));
- _vpTarget.setModifiable(false);
- _vpTarget.setTitle("Repliement cible");
- _vpTarget.setBPStyle(BP_STYLE.SIMPLE);
- _vpTarget.setBackboneColor(Color.white);
- _vpTarget.setDefaultBPColor(Color.white);
- _vpTarget.setBaseNumbersColor(Color.white);
- _vpTarget.setBaseOutlineColor(Color.white);
- _vpTarget.setTitleColor(Color.white);
- _vpTarget.setTitleFontSize(26f);
-
-
- _okColor = Color.decode("#F39126");
- _koColor = new Color(250,200,200);
-
- _seqPanel.setBackground(Color.decode("#E33729"));
- _infos.setBackground(Color.decode("#E33729"));
-
-
-
- _vpMaster.addVARNABasesListener(this);
- setTitle("Fête de la science 2015 - Inria AMIB - Design d'ARN");
-
- setTarget(secstr[0]);
-
- }
-
- private synchronized void showSolution()
- {
- ArrayList<String> sols = getStructs();
- _infos.setInfo(sols, count(getSeq()));
- if ((sols.size()==1)&&(sols.get(0).equals(_struct.getSelectedItem().toString())))
- {
- /*JOptionPane.showMessageDialog(null,
- "Vous avez trouvé une séquence pour cette structure !!!\n Saurez vous faire le design de molécules plus complexes ?",
- "Félicitations !",
- JOptionPane.INFORMATION_MESSAGE);*/
-
- }
- else
- {
- this._vpMaster.setTitle("Meilleur repliement - Séquence courante");
- }
- }
-
-
- public void setTarget(String target)
- {
- try {
- _vpTarget.drawRNA(String.format("%"+target.length()+"s", ""),target);
- _vpTarget.setBaseNumbersColor(Color.white);
- _vpTarget.setBaseOutlineColor(Color.white);
- //_vpTarget.toggleDrawOutlineBases();
- createDummySeq();
- showSolution();
- onStructureRedrawn();
- } catch (ExceptionNonEqualLength e) {
- // TODO Auto-generated catch block
- e.printStackTrace();
- }
- }
-
- private void createDummySeq()
- {
- RNA r = _vpTarget.getRNA();
- String seq = new String();
- for (int i=0;i<r.getSize();i++)
- {
- seq += 'A';
- }
- try {
- RNA rn = new RNA();
- rn.setRNA(seq,r.getStructDBN());
- for(ModeleBP mbp: r.getAllBPs())
- {
- rn.getBaseAt(mbp.getIndex5()).setContent("A");
- rn.getBaseAt(mbp.getIndex3()).setContent("U");
- }
- _vpMaster.drawRNA(rn);
- _vpMaster.repaint();
- _seq1.setText(_vpMaster.getRNA().getSeq());
- } catch (ExceptionUnmatchedClosingParentheses e) {
- // TODO Auto-generated catch block
- e.printStackTrace();
- } catch (ExceptionFileFormatOrSyntax e) {
- // TODO Auto-generated catch block
- e.printStackTrace();
- }
- }
-
-
- public String getSeq()
- {
- return (""+_seq1.getText()).toUpperCase();
- }
-
-
- private boolean canBasePairAll(char a, char b)
- {
- return true;
- }
-
- private boolean canBasePairBasic(char a, char b)
- {
- if ((a=='G')&&(b=='C'))
- return true;
- if ((a=='C')&&(b=='G'))
- return true;
- if ((a=='U')&&(b=='A'))
- return true;
- if ((a=='A')&&(b=='U'))
- return true;
- return false;
- }
-
- private double basePairScoreBasic(char a, char b)
- {
- if ((a=='G')&&(b=='C'))
- return 1.0;
- if ((a=='C')&&(b=='G'))
- return 1.0;
- if ((a=='U')&&(b=='A'))
- return 1.0;
- if ((a=='A')&&(b=='U'))
- return 1.0;
- return Double.NEGATIVE_INFINITY;
- }
-
-
- private boolean canBasePairNussinov(char a, char b)
- {
- if ((a=='G')&&(b=='C'))
- return true;
- if ((a=='C')&&(b=='G'))
- return true;
- if ((a=='U')&&(b=='A'))
- return true;
- if ((a=='A')&&(b=='U'))
- return true;
- if ((a=='U')&&(b=='G'))
- return true;
- if ((a=='G')&&(b=='U'))
- return true;
- return false;
- }
-
- private double basePairScoreNussinov(char a, char b)
- {
- if ((a=='G')&&(b=='C'))
- return 3.0;
- if ((a=='C')&&(b=='G'))
- return 3.0;
- if ((a=='U')&&(b=='A'))
- return 2.0;
- if ((a=='A')&&(b=='U'))
- return 2.0;
- if ((a=='U')&&(b=='G'))
- return 1.0;
- if ((a=='G')&&(b=='U'))
- return 1.0;
- return Double.NEGATIVE_INFINITY;
- }
-
- private boolean canBasePairINRIA(char a, char b)
- {
- if ((a=='U')&&(b=='A'))
- return true;
- if ((a=='A')&&(b=='U'))
- return true;
- if ((a=='G')&&(b=='C'))
- return true;
- if ((a=='C')&&(b=='G'))
- return true;
-
- if ((a=='A')&&(b=='G'))
- return true;
- if ((a=='G')&&(b=='A'))
- return true;
- if ((a=='U')&&(b=='C'))
- return true;
- if ((a=='C')&&(b=='U'))
- return true;
- if ((a=='A')&&(b=='A'))
- return true;
- if ((a=='U')&&(b=='U'))
- return true;
-
- if ((a=='U')&&(b=='G'))
- return true;
- if ((a=='G')&&(b=='U'))
- return true;
- if ((a=='A')&&(b=='C'))
- return true;
- if ((a=='C')&&(b=='A'))
- return true;
- return false;
- }
-
- private double basePairScoreINRIA(char a, char b)
- {
- if ((a=='U')&&(b=='A'))
- return 3;
- if ((a=='A')&&(b=='U'))
- return 3;
- if ((a=='G')&&(b=='C'))
- return 3;
- if ((a=='C')&&(b=='G'))
- return 3;
-
- if ((a=='A')&&(b=='G'))
- return 2;
- if ((a=='G')&&(b=='A'))
- return 2;
- if ((a=='U')&&(b=='C'))
- return 2;
- if ((a=='C')&&(b=='U'))
- return 2;
- if ((a=='A')&&(b=='A'))
- return 2;
- if ((a=='U')&&(b=='U'))
- return 2;
-
- if ((a=='U')&&(b=='G'))
- return 1;
- if ((a=='G')&&(b=='U'))
- return 1;
- if ((a=='A')&&(b=='C'))
- return 1;
- if ((a=='C')&&(b=='A'))
- return 1;
- return Double.NEGATIVE_INFINITY;
- }
-
- private boolean canBasePair(char a, char b)
- {
- return canBasePairBasic(a,b);
- //return canBasePairNussinov(a,b);
- //return canBasePairINRIA(a,b);
- }
-
- private double basePairScore(char a, char b)
- {
- return basePairScoreBasic(a,b);
- //return basePairScoreNussinov(a,b);
- //return basePairScoreINRIA(a,b);
- }
-
- public double[][] fillMatrix(String seq)
- {
- int n = seq.length();
- double[][] tab = new double[n][n];
- for(int m=1;m<=n;m++)
- {
- for(int i=0;i<n-m+1;i++)
- {
- int j = i+m-1;
- tab[i][j] = 0;
- if (i<j)
- {
- tab[i][j] = Math.max(tab[i][j], tab[i+1][j]);
- for (int k=i+1;k<=j;k++)
- {
- if (canBasePair(seq.charAt(i),seq.charAt(k)))
- {
- double fact1 = 0;
- if (k>i+1)
- {
- fact1 = tab[i+1][k-1];
- }
- double fact2 = 0;
- if (k<j)
- {
- fact2 = tab[k+1][j];
- }
- tab[i][j] = Math.max(tab[i][j],basePairScore(seq.charAt(i),seq.charAt(k))+fact1+fact2);
- }
- }
- }
- }
- }
- return tab;
- }
-
- public static ArrayList<Double> combine(double bonus, ArrayList<Double> part1, ArrayList<Double> part2)
- {
- ArrayList<Double> base = new ArrayList<Double>();
- for(double d1: part1)
- {
- for(double d2: part2)
- {
- base.add(bonus+d1+d2);
- }
- }
- return base;
- }
-
- public static ArrayList<Double> selectBests(ArrayList<Double> base)
- {
- ArrayList<Double> result = new ArrayList<Double>();
- double best = Double.NEGATIVE_INFINITY;
- for(double val: base)
- {
- best = Math.max(val, best);
- }
- for(double val: base)
- {
- if (val == best)
- result.add(val);
- }
- return result;
- }
-
-
- private ArrayList<String> backtrack(double[][] tab, String seq)
- {
- return backtrack(tab,seq, 0, seq.length()-1);
- }
-
- private ArrayList<String> backtrack(double[][] tab, String seq, int i, int j)
- {
- ArrayList<String> result = new ArrayList<String>();
- if (i<j)
- {
- ArrayList<Integer> indices = new ArrayList<Integer>();
- indices.add(-1);
- for (int k=i+1;k<=j;k++)
- {
- indices.add(k);
- }
- for (int k : indices)
- {
- if (k==-1)
- {
- if (tab[i][j] == tab[i+1][j])
- {
- for (String s:backtrack(tab, seq, i+1,j))
- {
- result.add("."+s);
- }
- }
- }
- else
- {
- if (canBasePair(seq.charAt(i),seq.charAt(k)))
- {
- double fact1 = 0;
- if (k>i+1)
- {
- fact1 = tab[i+1][k-1];
- }
- double fact2 = 0;
- if (k<j)
- {
- fact2 = tab[k+1][j];
- }
- if (tab[i][j]==basePairScore(seq.charAt(i),seq.charAt(k))+fact1+fact2)
- {
- for (String s1:backtrack(tab, seq, i+1,k-1))
- {
- for (String s2:backtrack(tab, seq, k+1,j))
- {
- result.add("("+s1+")"+s2);
- }
- }
- }
- }
- }
- }
- }
- else if (i==j)
- {
- result.add(".");
- }
- else
- {
- result.add("");
- }
- return result;
- }
-
- public BigInteger count(String seq)
- {
- int n = seq.length();
-
- BigInteger[][] tab = new BigInteger[n][n];
- for(int m=1;m<=n;m++)
- {
- for(int i=0;i<n-m+1;i++)
- {
- int j = i+m-1;
- tab[i][j] = BigInteger.ZERO;
- if (i<j)
- {
- tab[i][j] = tab[i][j].add(tab[i+1][j]);
- for (int k=i+1;k<=j;k++)
- {
- if (canBasePair(seq.charAt(i),seq.charAt(k)))
- {
- BigInteger fact1 = BigInteger.ONE;
- if (k>i+1)
- {
- fact1 = tab[i+1][k-1];
- }
- BigInteger fact2 = BigInteger.ONE;
- if (k<j)
- {
- fact2 = tab[k+1][j];
- }
- tab[i][j] = tab[i][j].add(fact1.multiply(fact2));
- }
- }
- }
- else
- {
- tab[i][j] = BigInteger.ONE;
- }
- }
- }
- return tab[0][n-1];
- }
-
- private String _cache = "";
- ArrayList<String> _cacheStructs = new ArrayList<String>();
-
- public ArrayList<String> getStructs() {
- String seq = getSeq();
- seq = seq.toUpperCase();
- if (!_cache.equals(seq))
- {
- double[][] mfe = fillMatrix(seq);
- _cacheStructs = backtrack(mfe,seq);
- _cache = seq;
- }
- return _cacheStructs;
- }
-
- public VARNAPanel get_varnaPanel() {
- return _vpMaster;
- }
-
- public void set_varnaPanel(VARNAPanel surface) {
- _vpMaster = surface;
- }
-
-
- public JLabel get_info() {
- return _actions;
- }
-
- public void set_info(JLabel _info) {
- this._actions = _info;
- }
-
- public static void main(String[] args) {
- NussinovDesignDemo d = new NussinovDesignDemo();
- d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
- d.pack();
- d.setVisible(true);
- }
-
- public void onStructureRedrawn() {
- _vpMaster.repaint();
- }
-
- public void onWarningEmitted(String s) {
- // TODO Auto-generated method stub
-
- }
-
- public void onLoad(String path) {
- // TODO Auto-generated method stub
-
- }
-
- public void onLoaded() {
- // TODO Auto-generated method stub
-
- }
-
- public void onUINewStructure(VARNAConfig v, RNA r) {
- // TODO Auto-generated method stub
-
- }
-
- static final String[] _bases = {"A","C","G","U"};
- static final String[] _basesComp = {"U","G","C","A"};
-
- public void onBaseClicked(ModeleBase mb, MouseEvent e) {
- int index = -1;
- for(int i =0;i<_bases.length;i++)
- {
- if (mb.getContent().equalsIgnoreCase(_bases[i]))
- {
- index = i;
- }
- }
- index = (index+1)%_bases.length;
- mb.setContent(_bases[index].toUpperCase());
- ArrayList<ModeleBase> partners =_vpTarget.getRNA().getAllPartners(mb.getIndex());
- if (partners.size()!=0)
- {
- ModeleBase mbPartner = _vpMaster.getRNA().getBaseAt(partners.get(0).getIndex());
- mbPartner.setContent(_basesComp[index].toUpperCase());
- }
- _vpMaster.repaint();
- _seq1.setText(_vpMaster.getRNA().getSeq());
- new Temporizer(_vpMaster.getRNA().getSeq()).start();
- }
-
- private class Temporizer extends Thread{
- String _seq;
- public Temporizer(String seq)
- {
- _seq = seq;
- }
- public void run() {
- try {
- this.sleep(1000);
- if (_vpMaster.getRNA().getSeq().equalsIgnoreCase(_seq))
- {
- showSolution();
- }
- } catch (InterruptedException e) {
- // TODO Auto-generated catch block
- e.printStackTrace();
- }
- }
- }
- public void onZoomLevelChanged() {
- // TODO Auto-generated method stub
-
- }
-
- public void onTranslationChanged() {
- // TODO Auto-generated method stub
-
- }
-
- public void itemStateChanged(ItemEvent arg0) {
- // TODO Auto-generated method stub
- System.out.println();
- }
-
-
- public static void formatLabel(JLabel j)
- {
- j.setHorizontalTextPosition(JLabel.LEFT);
- j.setPreferredSize(new Dimension(NussinovDemo.marginTools, 25));
- j.setFont(labelsFont);
- j.setForeground(Color.white);
- }
-
- public static void formatLabel(JTextArea j)
- {
- j.setPreferredSize(new Dimension(NussinovDemo.marginTools, 25));
- j.setFont(labelsFont);
- j.setForeground(Color.white);
- }
-
- public class InfoPanel extends JPanel
- {
- ArrayList<String> _sols = new ArrayList<String>();
- BigInteger _nbFolds = BigInteger.ZERO;
- JLabel _text = new JLabel("");
- JLabel _subopts = new JLabel("");
- JPanel _suboptBrowser = new JPanel();
- JPanel _suboptCount = new JPanel();
- int _selectedIndex = 0;
- JButton next = new JButton(">");
- JButton previous = new JButton("<");
-
- InfoPanel()
- {
- this.setBorder(BorderFactory.createEmptyBorder(5, 5, 5, 5));
- setLayout(new BorderLayout());
- add(_suboptBrowser,BorderLayout.SOUTH);
- add(_suboptCount,BorderLayout.NORTH);
-
- next.addActionListener(new ActionListener(){
- public void actionPerformed(ActionEvent arg0) {
- if (_sols.size()>0)
- {
- setSelectedIndex((_selectedIndex+1)%_sols.size());
- }
- }
- });
-
- previous.addActionListener(new ActionListener(){
- public void actionPerformed(ActionEvent arg0) {
- if (_sols.size()>0)
- {
- setSelectedIndex((_selectedIndex+_sols.size()-1)%_sols.size());
- }
- }
- });
- next.setEnabled(false);
- previous.setEnabled(false);
-
- JLabel nbLab = new JLabel("#Repliements");
- NussinovDesignDemo.formatLabel(nbLab);
-
-
- JLabel cooptlab = new JLabel("#Co-optimaux");
- NussinovDesignDemo.formatLabel(cooptlab);
-
- NussinovDesignDemo.formatLabel(_text);
- NussinovDesignDemo.formatLabel(_subopts);
-
-
- _suboptCount.setLayout(new BorderLayout());
- _suboptCount.add(nbLab,BorderLayout.WEST);
- _suboptCount.add(_text,BorderLayout.CENTER);
- _suboptCount.setBackground(Color.decode("#E33729"));
-
-
- JPanel commands = new JPanel();
- commands.add(previous);
- commands.add(next);
- commands.setBackground(Color.decode("#E33729"));
-
- JPanel jp = new JPanel();
- jp.setLayout(new BorderLayout());
- jp.add(_subopts,BorderLayout.WEST);
- jp.add(commands,BorderLayout.CENTER);
- jp.setBackground(Color.decode("#E33729"));
-
- _suboptBrowser.setLayout(new BorderLayout());
- _suboptBrowser.add(cooptlab,BorderLayout.WEST);
- _suboptBrowser.add(jp,BorderLayout.CENTER);
- _suboptBrowser.setBackground(Color.decode("#E33729"));
-
- }
-
-
- /*public void setSelectedIndex(int i)
- {
- _selectedIndex = i;
- RNA rfolded = new RNA();
- try {
- rfolded.setRNA(getSeq(), _sols.get(i));
- rfolded.drawRNARadiate(_vpMaster.getConfig());
- _vpMaster.showRNAInterpolated(rfolded);
- } catch (ExceptionUnmatchedClosingParentheses e) {
- // TODO Auto-generated catch block
- e.printStackTrace();
- } catch (ExceptionFileFormatOrSyntax e) {
- // TODO Auto-generated catch block
- e.printStackTrace();
- }
- //_struct.setText(_sols.get(i));
- formatDescription();
- }*/
-
- public void setSelectedIndex(int i)
- {
- _selectedIndex = i;
- RNA rfolded = new RNA();
- try {
- rfolded.setRNA(getSeq(), _sols.get(i));
- RNA target = _vpTarget.getRNA();
- for(ModeleBase mb: rfolded.get_listeBases())
- {
- ModeleBase mbref = target.getBaseAt(mb.getIndex());
- if (mb.getElementStructure()==mbref.getElementStructure())
- {
- mb.getStyleBase().setBaseInnerColor(_okColor);
- mb.getStyleBase().setBaseNameColor(Color.white);
- }
- }
- for(ModeleBase mb: target.get_listeBases())
- {
- ModeleBase mbref = rfolded.getBaseAt(mb.getIndex());
- if (mb.getElementStructure()==mbref.getElementStructure())
- {
- mb.getStyleBase().setBaseInnerColor(_okColor);
- }
- else
- {
- mb.getStyleBase().setBaseInnerColor(Color.white);
- }
- }
- rfolded.drawRNARadiate(_vpMaster.getConfig());
- if ((_sols.size()==1)&& (target.getStructDBN().equals(_sols.get(0))))
- rfolded.setName("Félicitations !");
- else
- rfolded.setName("Repliement stable - "+(i+1)+"/"+_sols.size());
- _vpMaster.showRNAInterpolated(rfolded);
- _vpTarget.repaint();
- } catch (ExceptionUnmatchedClosingParentheses e) {
- // TODO Auto-generated catch block
- e.printStackTrace();
- } catch (ExceptionFileFormatOrSyntax e) {
- // TODO Auto-generated catch block
- e.printStackTrace();
- }
- //_struct.setSelectedItem(_sols.get(i));
- formatDescription();
- }
-
-// public void setFont(Font f)
-// {
-// super.setFont(f);
-// if(_text!=null)
-// {
-// _text.setFont(f);
-// _text.setOpaque(false);
-// }
-// if(_subopts!=null)
-// {
-// _subopts.setFont(f);
-// _subopts.setOpaque(false);
-// }
-// }
- public void setInfo(ArrayList<String> sols, BigInteger nbFolds)
- {
- _sols = sols;
- _nbFolds = nbFolds;
- formatDescription();
- setSelectedIndex(0);
- }
-
- private void formatDescription()
- {
- _text.setText(""+_nbFolds);
- _subopts.setText(""+_sols.size());
- next.setEnabled(_sols.size()>1);
- previous.setEnabled(_sols.size()>1);
-
- }
-
- }
-
-}
git://source.jalview.org / jalview.git / blobdiff