VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases.
Copyright (C) 2008 Kevin Darty, Alain Denise and Yann Ponty.
electronic mail : Yann.Ponty@lri.fr
- paper mail : LRI, bat 490 Université Paris-Sud 91405 Orsay Cedex France
+ paper mail : LRI, bat 490 Universit� Paris-Sud 91405 Orsay Cedex France
This file is part of VARNA version 3.1.
VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License
public class VARNAEditor extends JFrame implements DropTargetListener, InterfaceVARNAListener, MouseListener {
- /**
- *
- */
-// private static final_long serialVersionUID = -790155708306987257L;
-
- private static final String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA";
-
- private static final String DEFAULT_STRUCTURE1 = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...)))))..";
- private static final String DEFAULT_STRUCTURE2 = "..(((((...(((((...(((((........(((((...(((((.....)))))...)))))..................))))).....)))))...)))))..";
- // private static final String DEFAULT_STRUCTURE1 = "((((....))))";
- // private static final String DEFAULT_STRUCTURE2 =
- // "((((..(((....)))..))))";
-
- private VARNAPanel _vp;
-
- private JPanel _tools = new JPanel();
- private JPanel _input = new JPanel();
-
- private JPanel _seqPanel = new JPanel();
- private JPanel _strPanel = new JPanel();
- private JLabel _info = new JLabel();
-
- private JTextField _str = new JTextField(DEFAULT_STRUCTURE1);
- Object _hoverHighlightStr = null;
- ArrayList<Object> _selectionHighlightStr = new ArrayList<Object>();
-
- private JTextField _seq = new JTextField(DEFAULT_SEQUENCE);
- Object _hoverHighlightSeq = null;
- ArrayList<Object> _selectionHighlightSeq = new ArrayList<Object>();
-
-
- private JLabel _strLabel = new JLabel(" Str:");
- private JLabel _seqLabel = new JLabel(" Seq:");
- private JButton _deleteButton = new JButton("Delete");
- private JButton _duplicateButton = new JButton("Duplicate");
-
- private JPanel _listPanel = new JPanel();
- private ReorderableJList _sideList = null;
-
-
-
- private static String errorOpt = "error";
- @SuppressWarnings("unused")
- private boolean _error;
-
- private Color _backgroundColor = Color.white;
-
- private static int _nextID = 1;
- @SuppressWarnings("unused")
- private int _algoCode;
-
- private BackupHolder _rnaList;
-
-
- public VARNAEditor() {
- super("VARNA Editor");
- RNAPanelDemoInit();
- }
-
- private void RNAPanelDemoInit()
- {
- DefaultListModel dlm = new DefaultListModel();
-
-
- int marginTools = 40;
-
- DefaultListSelectionModel m = new DefaultListSelectionModel();
- m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
- m.setLeadAnchorNotificationEnabled(false);
-
-
- _sideList = new ReorderableJList();
- _sideList.setModel(dlm);
- _sideList.addMouseListener(this);
- _sideList.setSelectionModel(m);
- _sideList.setPreferredSize(new Dimension(100, 0));
- _sideList.addListSelectionListener( new ListSelectionListener(){
- public void valueChanged(ListSelectionEvent arg0) {
- //System.out.println(arg0);
- if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
- {
- FullBackup sel = (FullBackup) _sideList.getSelectedValue();
- Mapping map = Mapping.DefaultOutermostMapping(_vp.getRNA().getSize(), sel.rna.getSize());
- _vp.showRNAInterpolated(sel.rna,sel.config,map);
- _seq.setText(sel.rna.getSeq());
- _str.setText(sel.rna.getStructDBN(true));
- }
- }
- });
-
- _rnaList = new BackupHolder(dlm,_sideList);
- RNA _RNA1 = new RNA("User defined 1");
- RNA _RNA2 = new RNA("User defined 2");
- try {
- _vp = new VARNAPanel("0",".");
- _RNA1.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE1);
- _RNA1.drawRNARadiate(_vp.getConfig());
- _RNA2.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE2);
- _RNA2.drawRNARadiate(_vp.getConfig());
- } catch (ExceptionNonEqualLength e) {
- _vp.errorDialog(e);
- } catch (ExceptionUnmatchedClosingParentheses e2) {
- e2.printStackTrace();
- } catch (ExceptionFileFormatOrSyntax e3) {
- e3.printStackTrace();
- }
- _vp.setPreferredSize(new Dimension(400, 400));
- //
-
- // BH 2018 this will NOT be a clone in SwingJS
- _rnaList.add(_vp.getConfig().clone(),_RNA2,generateDefaultName());
- _rnaList.add(_vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
-
- JScrollPane listScroller = new JScrollPane(_sideList);
- listScroller.setPreferredSize(new Dimension(150, 0));
-
- setBackground(_backgroundColor);
- _vp.setBackground(_backgroundColor);
-
-
- Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
-
- _seqLabel.setHorizontalTextPosition(JLabel.LEFT);
- _seqLabel.setPreferredSize(new Dimension(marginTools, 15));
- _seq.setFont(textFieldsFont);
- _seq.setText(DEFAULT_SEQUENCE);
- _seq.setEditable(false);
-
-
- _seqPanel.setLayout(new BorderLayout());
- _seqPanel.add(_seqLabel, BorderLayout.WEST);
- _seqPanel.add(_seq, BorderLayout.CENTER);
-
- _strLabel.setPreferredSize(new Dimension(marginTools, 15));
- _strLabel.setHorizontalTextPosition(JLabel.LEFT);
- _str.setFont(textFieldsFont);
- _str.setEditable(false);
- _strPanel.setLayout(new BorderLayout());
- _strPanel.add(_strLabel, BorderLayout.WEST);
- _strPanel.add(_str, BorderLayout.CENTER);
-
- _input.setLayout(new GridLayout(2, 0));
- _input.add(_seqPanel);
- _input.add(_strPanel);
-
-
- _tools.setLayout(new BorderLayout());
- _tools.add(_input, BorderLayout.CENTER);
- _tools.add(_info, BorderLayout.SOUTH);
-
- _deleteButton.addActionListener(new ActionListener() {
- public void actionPerformed(ActionEvent e) {
- _rnaList.removeSelected();
- }
- });
-// _duplicateButton.addActionListener(new ActionListener() {
-// public void actionPerformed(ActionEvent e) {
-// _rnaList.add((VARNAConfig)_vp.getConfig().clone(),_vp.getRNA().clone(),_vp.getRNA().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new Date()),true);
-// }});
-
- JPanel ops = new JPanel();
- ops.setLayout(new GridLayout(1,2));
- ops.add(_deleteButton);
- ops.add(_duplicateButton);
-
- JLabel j = new JLabel("Structures",JLabel.CENTER);
- _listPanel.setLayout(new BorderLayout());
-
- _listPanel.add(ops,BorderLayout.SOUTH);
- _listPanel.add(j,BorderLayout.NORTH);
- _listPanel.add(listScroller,BorderLayout.CENTER);
-
-
- JSplitPane split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,_vp);
- getContentPane().setLayout(new BorderLayout());
- getContentPane().add(split, BorderLayout.CENTER);
- getContentPane().add(_tools, BorderLayout.NORTH);
-
- setVisible(true);
- DropTarget dt = new DropTarget(_vp, this);
-
- _vp.addRNAListener(new InterfaceVARNARNAListener(){
- public void onSequenceModified(int index, String oldseq, String newseq) {
- _seq.setText(_vp.getRNA().getSeq());
- }
-
- public void onStructureModified(Set<ModeleBP> current,
- Set<ModeleBP> addedBasePairs, Set<ModeleBP> removedBasePairs) {
- _str.setText(_vp.getRNA().getStructDBN(true));
- }
-
- public void onRNALayoutChanged(Hashtable<Integer, Double> previousPositions) {
- }
-
- });
-
- _vp.addSelectionListener(new InterfaceVARNASelectionListener(){
-
- public void onHoverChanged(ModeleBase oldbase, ModeleBase newBase) {
- if (_hoverHighlightSeq!=null)
- {
- _seq.getHighlighter().removeHighlight(_hoverHighlightSeq);
- _hoverHighlightSeq = null;
- }
- if (_hoverHighlightStr!=null)
- {
- _str.getHighlighter().removeHighlight(_hoverHighlightStr);
- _hoverHighlightStr = null;
- }
- if (newBase!=null)
- {
- try {
- _hoverHighlightSeq = _seq.getHighlighter().addHighlight(newBase.getIndex(), newBase.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.green) );
- _hoverHighlightStr = _str.getHighlighter().addHighlight(newBase.getIndex(), newBase.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.green) );
- } catch (BadLocationException e) {
- e.printStackTrace();
- }
- }
- }
-
- public void onSelectionChanged(BaseList selection,
- BaseList addedBases, BaseList removedBases) {
- for(Object tag: _selectionHighlightSeq)
- {
- _seq.getHighlighter().removeHighlight(tag);
- }
- _selectionHighlightSeq.clear();
- for(Object tag: _selectionHighlightStr)
- {
- _str.getHighlighter().removeHighlight(tag);
- }
- _selectionHighlightStr.clear();
- for (ModeleBase m: selection.getBases())
- {
- try {
- _selectionHighlightSeq.add(_seq.getHighlighter().addHighlight(m.getIndex(), m.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.orange) ));
- _selectionHighlightStr.add(_str.getHighlighter().addHighlight(m.getIndex(), m.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.orange) ));
- } catch (BadLocationException e) {
- e.printStackTrace();
- }
- }
- }
-
- });
-
- _vp.addVARNAListener(this);
- }
-
- public static String generateDefaultName()
- {
- return "User file #"+_nextID++;
- }
-
- public RNA getRNA() {
- return (RNA)_sideList.getSelectedValue();
- }
-
-
-
- public String[][] getParameterInfo() {
- String[][] info = {
- // Parameter Name Kind of Value Description,
- { "sequenceDBN", "String", "A raw RNA sequence" },
- { "structureDBN", "String",
- "An RNA structure in dot bracket notation (DBN)" },
- { errorOpt, "boolean", "To show errors" }, };
- return info;
- }
-
- public void init() {
- _vp.setBackground(_backgroundColor);
- _error = true;
- }
-
- @SuppressWarnings("unused")
- private Color getSafeColor(String col, Color def) {
- Color result;
- try {
- result = Color.decode(col);
- } catch (Exception e) {
- try {
- result = Color.getColor(col, def);
- } catch (Exception e2) {
- return def;
- }
- }
- return result;
- }
-
- public VARNAPanel get_varnaPanel() {
- return _vp;
- }
-
- public void set_varnaPanel(VARNAPanel surface) {
- _vp = surface;
- }
-
-
- public JTextField get_seq() {
- return _seq;
- }
-
- public void set_seq(JTextField _seq) {
- this._seq = _seq;
- }
-
- public JLabel get_info() {
- return _info;
- }
-
- public void set_info(JLabel _info) {
- this._info = _info;
- }
-
- public static void main(String[] args) {
- VARNAEditor d = new VARNAEditor();
- d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
- d.pack();
- d.setVisible(true);
- }
-
-
- public void dragEnter(DropTargetDragEvent arg0) {
- // TODO Auto-generated method stub
-
- }
-
- public void dragExit(DropTargetEvent arg0) {
- // TODO Auto-generated method stub
-
- }
-
- public void dragOver(DropTargetDragEvent arg0) {
- // TODO Auto-generated method stub
-
- }
-
- public void drop(DropTargetDropEvent dtde) {
- try {
- Transferable tr = dtde.getTransferable();
- DataFlavor[] flavors = tr.getTransferDataFlavors();
- for (int i = 0; i < flavors.length; i++) {
- if (flavors[i].isFlavorJavaFileListType()) {
- dtde.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
- Object ob = tr.getTransferData(flavors[i]);
- if (ob instanceof List)
- {
- List list = (List) ob;
- for (int j = 0; j < list.size(); j++) {
- Object o = list.get(j);
-
- if (dtde.getSource() instanceof DropTarget)
- {
- DropTarget dt = (DropTarget) dtde.getSource();
- Component c = dt.getComponent();
- if (c instanceof VARNAPanel)
- {
- String path = o.toString();
- VARNAPanel vp = (VARNAPanel) c;
- try{
- FullBackup bck = VARNAPanel.importSession((File) o); // BH SwingJS
- _rnaList.add(bck.config, bck.rna,bck.name,true);
- }
- catch (ExceptionLoadingFailed e3)
- {
- Collection<RNA> rnas = RNAFactory.loadSecStr((File) o); // BH SwingJS
- if (rnas.isEmpty())
- {
- throw new ExceptionFileFormatOrSyntax("No RNA could be parsed from that source.");
- }
-
- int id = 1;
- for(RNA r: rnas)
- {
- r.drawRNA(vp.getConfig());
- String name = r.getName();
- if (name.equals(""))
- {
- name = path.substring(path.lastIndexOf(File.separatorChar)+1);
- }
- if (rnas.size()>1)
- {
- name += " - Molecule# "+id++;
- }
- _rnaList.add(vp.getConfig().clone(),r,name,true);
- }
- }
- }
- }
- }
- }
- // If we made it this far, everything worked.
- dtde.dropComplete(true);
- return;
- }
- }
- // Hmm, the user must not have dropped a file list
- dtde.rejectDrop();
- } catch (Exception e) {
- e.printStackTrace();
- dtde.rejectDrop();
- }
-
- }
-
- public void dropActionChanged(DropTargetDragEvent arg0) {
- }
-
- private class BackupHolder{
- private DefaultListModel _rnaList;
- private ArrayList<RNA> _rnas = new ArrayList<RNA>();
- JList _l;
-
- public BackupHolder(DefaultListModel rnaList, JList l)
- {
- _rnaList = rnaList;
- _l = l;
- }
-
- public void add(VARNAConfig c, RNA r)
- {
- add(c, r, r.getName(),false);
- }
-
- public void add(VARNAConfig c, RNA r,boolean select)
- {
- add(c, r, r.getName(),select);
- }
-
- public void add(VARNAConfig c, RNA r, String name)
- {
- add(c, r, name,false);
- }
- public void add(VARNAConfig c, RNA r, String name, boolean select)
- {
- if (select){
- _l.removeSelectionInterval(0, _rnaList.size());
- }
- if (name.equals(""))
- {
- name = generateDefaultName();
- }
- FullBackup bck = new FullBackup(c,r,name);
- _rnas.add(0, r);
- _rnaList.add(0,bck);
- if (select){
- _l.setSelectedIndex(0);
- }
- }
-
- public void remove(int i)
- {
- _rnas.remove(i);
- _rnaList.remove(i);
-
- }
- public DefaultListModel getModel()
- {
- return _rnaList;
- }
- public boolean contains(RNA r)
- {
- return _rnas.contains(r);
- }
- /*public int getSize()
- {
- return _rnaList.getSize();
- }*/
- public FullBackup getElementAt(int i)
- {
- return (FullBackup) _rnaList.getElementAt(i);
- }
-
- public void removeSelected()
- {
- int i = _l.getSelectedIndex();
- if (i!=-1)
- {
- if (_rnaList.getSize()==1)
- {
- RNA r = new RNA();
- try {
- r.setRNA(" ", ".");
- } catch (ExceptionUnmatchedClosingParentheses e1) {
- } catch (ExceptionFileFormatOrSyntax e1) {
- }
- _vp.showRNA(r);
- _vp.repaint();
- }
- else
- {
- int newi = i+1;
- if (newi==_rnaList.getSize())
- {
- newi = _rnaList.getSize()-2;
- }
- FullBackup bck = (FullBackup) _rnaList.getElementAt(newi);
- _l.setSelectedValue(bck,true);
- }
- _rnaList.remove(i);
- }
-
- }
- }
-
- public void onStructureRedrawn() {
- // TODO Auto-generated method stub
-
- }
-
- public void onUINewStructure(VARNAConfig v, RNA r) {
- _rnaList.add(v, r,"",true);
- }
-
- public void onWarningEmitted(String s) {
- // TODO Auto-generated method stub
-
- }
-
- public void mouseClicked(MouseEvent e) {
- if(e.getClickCount() == 2){
- int index = _sideList.locationToIndex(e.getPoint());
- ListModel dlm = _sideList.getModel();
- FullBackup item = (FullBackup) dlm.getElementAt(index);;
- _sideList.ensureIndexIsVisible(index);
- Object newName = JOptionPane.showInputDialog(
- this,
- "Specify a new name for this RNA",
- "Rename RNA",
- JOptionPane.QUESTION_MESSAGE,
- (Icon)null,
- null,
- item.toString());
- if (newName!=null)
- {
- item.name = newName.toString();
- this._sideList.repaint();
- }
- }
- }
-
- public void mouseEntered(MouseEvent arg0) {
- // TODO Auto-generated method stub
-
- }
-
- public void mouseExited(MouseEvent arg0) {
- // TODO Auto-generated method stub
-
- }
-
- public void mousePressed(MouseEvent arg0) {
- // TODO Auto-generated method stub
-
- }
-
- public void mouseReleased(MouseEvent arg0) {
- // TODO Auto-generated method stub
-
- }
-
- public void onZoomLevelChanged() {
- // TODO Auto-generated method stub
-
- }
-
- public void onTranslationChanged() {
- // TODO Auto-generated method stub
-
- }
+ /**
+ *
+ */
+// private static final_long serialVersionUID = -790155708306987257L;
+
+ private static final String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA";
+
+ private static final String DEFAULT_STRUCTURE1 = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...)))))..";
+ private static final String DEFAULT_STRUCTURE2 = "..(((((...(((((...(((((........(((((...(((((.....)))))...)))))..................))))).....)))))...)))))..";
+ // private static final String DEFAULT_STRUCTURE1 = "((((....))))";
+ // private static final String DEFAULT_STRUCTURE2 =
+ // "((((..(((....)))..))))";
+
+ private VARNAPanel _vp;
+
+ private JPanel _tools = new JPanel();
+ private JPanel _input = new JPanel();
+
+ private JPanel _seqPanel = new JPanel();
+ private JPanel _strPanel = new JPanel();
+ private JLabel _info = new JLabel();
+
+ private JTextField _str = new JTextField(DEFAULT_STRUCTURE1);
+ Object _hoverHighlightStr = null;
+ ArrayList<Object> _selectionHighlightStr = new ArrayList<Object>();
+
+ private JTextField _seq = new JTextField(DEFAULT_SEQUENCE);
+ Object _hoverHighlightSeq = null;
+ ArrayList<Object> _selectionHighlightSeq = new ArrayList<Object>();
+
+
+ private JLabel _strLabel = new JLabel(" Str:");
+ private JLabel _seqLabel = new JLabel(" Seq:");
+ private JButton _deleteButton = new JButton("Delete");
+ private JButton _duplicateButton = new JButton("Duplicate");
+
+ private JPanel _listPanel = new JPanel();
+ private ReorderableJList _sideList = null;
+
+
+
+ private static String errorOpt = "error";
+ @SuppressWarnings("unused")
+ private boolean _error;
+
+ private Color _backgroundColor = Color.white;
+
+ private static int _nextID = 1;
+ @SuppressWarnings("unused")
+ private int _algoCode;
+
+ private BackupHolder _rnaList;
+
+
+ public VARNAEditor() {
+ super("VARNA Editor");
+ RNAPanelDemoInit();
+ }
+
+ private void RNAPanelDemoInit()
+ {
+ DefaultListModel dlm = new DefaultListModel();
+
+
+ int marginTools = 40;
+
+ DefaultListSelectionModel m = new DefaultListSelectionModel();
+ m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
+ m.setLeadAnchorNotificationEnabled(false);
+
+
+ _sideList = new ReorderableJList();
+ _sideList.setModel(dlm);
+ _sideList.addMouseListener(this);
+ _sideList.setSelectionModel(m);
+ _sideList.setPreferredSize(new Dimension(100, 0));
+ _sideList.addListSelectionListener( new ListSelectionListener(){
+ public void valueChanged(ListSelectionEvent arg0) {
+ //System.out.println(arg0);
+ if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
+ {
+ FullBackup sel = (FullBackup) _sideList.getSelectedValue();
+ Mapping map = Mapping.DefaultOutermostMapping(_vp.getRNA().getSize(), sel.rna.getSize());
+ _vp.showRNAInterpolated(sel.rna,sel.config,map);
+ _seq.setText(sel.rna.getSeq());
+ _str.setText(sel.rna.getStructDBN(true));
+ }
+ }
+ });
+
+ _rnaList = new BackupHolder(dlm,_sideList);
+ RNA _RNA1 = new RNA("User defined 1");
+ RNA _RNA2 = new RNA("User defined 2");
+ try {
+ _vp = new VARNAPanel("0",".");
+ _RNA1.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE1);
+ _RNA1.drawRNARadiate(_vp.getConfig());
+ _RNA2.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE2);
+ _RNA2.drawRNARadiate(_vp.getConfig());
+ } catch (ExceptionNonEqualLength e) {
+ _vp.errorDialog(e);
+ } catch (ExceptionUnmatchedClosingParentheses e2) {
+ e2.printStackTrace();
+ } catch (ExceptionFileFormatOrSyntax e3) {
+ e3.printStackTrace();
+ }
+ _vp.setPreferredSize(new Dimension(400, 400));
+ //
+
+ // BH 2018 this will NOT be a clone in SwingJS
+ _rnaList.add(_vp.getConfig().clone(),_RNA2,generateDefaultName());
+ _rnaList.add(_vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
+
+ JScrollPane listScroller = new JScrollPane(_sideList);
+ listScroller.setPreferredSize(new Dimension(150, 0));
+
+ setBackground(_backgroundColor);
+ _vp.setBackground(_backgroundColor);
+
+
+ Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
+
+ _seqLabel.setHorizontalTextPosition(JLabel.LEFT);
+ _seqLabel.setPreferredSize(new Dimension(marginTools, 15));
+ _seq.setFont(textFieldsFont);
+ _seq.setText(DEFAULT_SEQUENCE);
+ _seq.setEditable(false);
+
+
+ _seqPanel.setLayout(new BorderLayout());
+ _seqPanel.add(_seqLabel, BorderLayout.WEST);
+ _seqPanel.add(_seq, BorderLayout.CENTER);
+
+ _strLabel.setPreferredSize(new Dimension(marginTools, 15));
+ _strLabel.setHorizontalTextPosition(JLabel.LEFT);
+ _str.setFont(textFieldsFont);
+ _str.setEditable(false);
+ _strPanel.setLayout(new BorderLayout());
+ _strPanel.add(_strLabel, BorderLayout.WEST);
+ _strPanel.add(_str, BorderLayout.CENTER);
+
+ _input.setLayout(new GridLayout(2, 0));
+ _input.add(_seqPanel);
+ _input.add(_strPanel);
+
+
+ _tools.setLayout(new BorderLayout());
+ _tools.add(_input, BorderLayout.CENTER);
+ _tools.add(_info, BorderLayout.SOUTH);
+
+ _deleteButton.addActionListener(new ActionListener() {
+ public void actionPerformed(ActionEvent e) {
+ _rnaList.removeSelected();
+ }
+ });
+// _duplicateButton.addActionListener(new ActionListener() {
+// public void actionPerformed(ActionEvent e) {
+// _rnaList.add((VARNAConfig)_vp.getConfig().clone(),_vp.getRNA().clone(),_vp.getRNA().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new Date()),true);
+// }});
+
+ JPanel ops = new JPanel();
+ ops.setLayout(new GridLayout(1,2));
+ ops.add(_deleteButton);
+ ops.add(_duplicateButton);
+
+ JLabel j = new JLabel("Structures",JLabel.CENTER);
+ _listPanel.setLayout(new BorderLayout());
+
+ _listPanel.add(ops,BorderLayout.SOUTH);
+ _listPanel.add(j,BorderLayout.NORTH);
+ _listPanel.add(listScroller,BorderLayout.CENTER);
+
+
+ JSplitPane split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,_vp);
+ getContentPane().setLayout(new BorderLayout());
+ getContentPane().add(split, BorderLayout.CENTER);
+ getContentPane().add(_tools, BorderLayout.NORTH);
+
+ setVisible(true);
+ DropTarget dt = new DropTarget(_vp, this);
+
+ _vp.addRNAListener(new InterfaceVARNARNAListener(){
+ public void onSequenceModified(int index, String oldseq, String newseq) {
+ _seq.setText(_vp.getRNA().getSeq());
+ }
+
+ public void onStructureModified(Set<ModeleBP> current,
+ Set<ModeleBP> addedBasePairs, Set<ModeleBP> removedBasePairs) {
+ _str.setText(_vp.getRNA().getStructDBN(true));
+ }
+
+ public void onRNALayoutChanged(Hashtable<Integer, Double> previousPositions) {
+ }
+
+ });
+
+ _vp.addSelectionListener(new InterfaceVARNASelectionListener(){
+
+ public void onHoverChanged(ModeleBase oldbase, ModeleBase newBase) {
+ if (_hoverHighlightSeq!=null)
+ {
+ _seq.getHighlighter().removeHighlight(_hoverHighlightSeq);
+ _hoverHighlightSeq = null;
+ }
+ if (_hoverHighlightStr!=null)
+ {
+ _str.getHighlighter().removeHighlight(_hoverHighlightStr);
+ _hoverHighlightStr = null;
+ }
+ if (newBase!=null)
+ {
+ try {
+ _hoverHighlightSeq = _seq.getHighlighter().addHighlight(newBase.getIndex(), newBase.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.green) );
+ _hoverHighlightStr = _str.getHighlighter().addHighlight(newBase.getIndex(), newBase.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.green) );
+ } catch (BadLocationException e) {
+ e.printStackTrace();
+ }
+ }
+ }
+
+ public void onSelectionChanged(BaseList selection,
+ BaseList addedBases, BaseList removedBases) {
+ for(Object tag: _selectionHighlightSeq)
+ {
+ _seq.getHighlighter().removeHighlight(tag);
+ }
+ _selectionHighlightSeq.clear();
+ for(Object tag: _selectionHighlightStr)
+ {
+ _str.getHighlighter().removeHighlight(tag);
+ }
+ _selectionHighlightStr.clear();
+ for (ModeleBase m: selection.getBases())
+ {
+ try {
+ _selectionHighlightSeq.add(_seq.getHighlighter().addHighlight(m.getIndex(), m.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.orange) ));
+ _selectionHighlightStr.add(_str.getHighlighter().addHighlight(m.getIndex(), m.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.orange) ));
+ } catch (BadLocationException e) {
+ e.printStackTrace();
+ }
+ }
+ }
+
+ });
+
+ _vp.addVARNAListener(this);
+ }
+
+ public static String generateDefaultName()
+ {
+ return "User file #"+_nextID++;
+ }
+
+ public RNA getRNA() {
+ return (RNA)_sideList.getSelectedValue();
+ }
+
+
+
+ public String[][] getParameterInfo() {
+ String[][] info = {
+ // Parameter Name Kind of Value Description,
+ { "sequenceDBN", "String", "A raw RNA sequence" },
+ { "structureDBN", "String",
+ "An RNA structure in dot bracket notation (DBN)" },
+ { errorOpt, "boolean", "To show errors" }, };
+ return info;
+ }
+
+ public void init() {
+ _vp.setBackground(_backgroundColor);
+ _error = true;
+ }
+
+ @SuppressWarnings("unused")
+ private Color getSafeColor(String col, Color def) {
+ Color result;
+ try {
+ result = Color.decode(col);
+ } catch (Exception e) {
+ try {
+ result = Color.getColor(col, def);
+ } catch (Exception e2) {
+ return def;
+ }
+ }
+ return result;
+ }
+
+ public VARNAPanel get_varnaPanel() {
+ return _vp;
+ }
+
+ public void set_varnaPanel(VARNAPanel surface) {
+ _vp = surface;
+ }
+
+
+ public JTextField get_seq() {
+ return _seq;
+ }
+
+ public void set_seq(JTextField _seq) {
+ this._seq = _seq;
+ }
+
+ public JLabel get_info() {
+ return _info;
+ }
+
+ public void set_info(JLabel _info) {
+ this._info = _info;
+ }
+
+ public static void main(String[] args) {
+ VARNAEditor d = new VARNAEditor();
+ d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
+ d.pack();
+ d.setVisible(true);
+ }
+
+
+ public void dragEnter(DropTargetDragEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void dragExit(DropTargetEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void dragOver(DropTargetDragEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void drop(DropTargetDropEvent dtde) {
+ try {
+ Transferable tr = dtde.getTransferable();
+ DataFlavor[] flavors = tr.getTransferDataFlavors();
+ for (int i = 0; i < flavors.length; i++) {
+ if (flavors[i].isFlavorJavaFileListType()) {
+ dtde.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
+ Object ob = tr.getTransferData(flavors[i]);
+ if (ob instanceof List)
+ {
+ List list = (List) ob;
+ for (int j = 0; j < list.size(); j++) {
+ Object o = list.get(j);
+
+ if (dtde.getSource() instanceof DropTarget)
+ {
+ DropTarget dt = (DropTarget) dtde.getSource();
+ Component c = dt.getComponent();
+ if (c instanceof VARNAPanel)
+ {
+ String path = o.toString();
+ VARNAPanel vp = (VARNAPanel) c;
+ try{
+ FullBackup bck = VARNAPanel.importSession((File) o); // BH SwingJS
+ _rnaList.add(bck.config, bck.rna,bck.name,true);
+ }
+ catch (ExceptionLoadingFailed e3)
+ {
+ Collection<RNA> rnas = RNAFactory.loadSecStr((File) o); // BH SwingJS
+ if (rnas.isEmpty())
+ {
+ throw new ExceptionFileFormatOrSyntax("No RNA could be parsed from that source.");
+ }
+
+ int id = 1;
+ for(RNA r: rnas)
+ {
+ r.drawRNA(vp.getConfig());
+ String name = r.getName();
+ if (name.equals(""))
+ {
+ name = path.substring(path.lastIndexOf(File.separatorChar)+1);
+ }
+ if (rnas.size()>1)
+ {
+ name += " - Molecule# "+id++;
+ }
+ _rnaList.add(vp.getConfig().clone(),r,name,true);
+ }
+ }
+ }
+ }
+ }
+ }
+ // If we made it this far, everything worked.
+ dtde.dropComplete(true);
+ return;
+ }
+ }
+ // Hmm, the user must not have dropped a file list
+ dtde.rejectDrop();
+ } catch (Exception e) {
+ e.printStackTrace();
+ dtde.rejectDrop();
+ }
+
+ }
+
+ public void dropActionChanged(DropTargetDragEvent arg0) {
+ }
+
+ private class BackupHolder{
+ private DefaultListModel _rnaList;
+ private ArrayList<RNA> _rnas = new ArrayList<RNA>();
+ JList _l;
+
+ public BackupHolder(DefaultListModel rnaList, JList l)
+ {
+ _rnaList = rnaList;
+ _l = l;
+ }
+
+ public void add(VARNAConfig c, RNA r)
+ {
+ add(c, r, r.getName(),false);
+ }
+
+ public void add(VARNAConfig c, RNA r,boolean select)
+ {
+ add(c, r, r.getName(),select);
+ }
+
+ public void add(VARNAConfig c, RNA r, String name)
+ {
+ add(c, r, name,false);
+ }
+ public void add(VARNAConfig c, RNA r, String name, boolean select)
+ {
+ if (select){
+ _l.removeSelectionInterval(0, _rnaList.size());
+ }
+ if (name.equals(""))
+ {
+ name = generateDefaultName();
+ }
+ FullBackup bck = new FullBackup(c,r,name);
+ _rnas.add(0, r);
+ _rnaList.add(0,bck);
+ if (select){
+ _l.setSelectedIndex(0);
+ }
+ }
+
+ public void remove(int i)
+ {
+ _rnas.remove(i);
+ _rnaList.remove(i);
+
+ }
+ public DefaultListModel getModel()
+ {
+ return _rnaList;
+ }
+ public boolean contains(RNA r)
+ {
+ return _rnas.contains(r);
+ }
+ /*public int getSize()
+ {
+ return _rnaList.getSize();
+ }*/
+ public FullBackup getElementAt(int i)
+ {
+ return (FullBackup) _rnaList.getElementAt(i);
+ }
+
+ public void removeSelected()
+ {
+ int i = _l.getSelectedIndex();
+ if (i!=-1)
+ {
+ if (_rnaList.getSize()==1)
+ {
+ RNA r = new RNA();
+ try {
+ r.setRNA(" ", ".");
+ } catch (ExceptionUnmatchedClosingParentheses e1) {
+ } catch (ExceptionFileFormatOrSyntax e1) {
+ }
+ _vp.showRNA(r);
+ _vp.repaint();
+ }
+ else
+ {
+ int newi = i+1;
+ if (newi==_rnaList.getSize())
+ {
+ newi = _rnaList.getSize()-2;
+ }
+ FullBackup bck = (FullBackup) _rnaList.getElementAt(newi);
+ _l.setSelectedValue(bck,true);
+ }
+ _rnaList.remove(i);
+ }
+
+ }
+ }
+
+ public void onStructureRedrawn() {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void onUINewStructure(VARNAConfig v, RNA r) {
+ _rnaList.add(v, r,"",true);
+ }
+
+ public void onWarningEmitted(String s) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void mouseClicked(MouseEvent e) {
+ if(e.getClickCount() == 2){
+ int index = _sideList.locationToIndex(e.getPoint());
+ ListModel dlm = _sideList.getModel();
+ FullBackup item = (FullBackup) dlm.getElementAt(index);;
+ _sideList.ensureIndexIsVisible(index);
+ Object newName = JOptionPane.showInputDialog(
+ this,
+ "Specify a new name for this RNA",
+ "Rename RNA",
+ JOptionPane.QUESTION_MESSAGE,
+ (Icon)null,
+ null,
+ item.toString());
+ if (newName!=null)
+ {
+ item.name = newName.toString();
+ this._sideList.repaint();
+ }
+ }
+ }
+
+ public void mouseEntered(MouseEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void mouseExited(MouseEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void mousePressed(MouseEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void mouseReleased(MouseEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void onZoomLevelChanged() {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void onTranslationChanged() {
+ // TODO Auto-generated method stub
+
+ }
}