import static org.testng.Assert.assertNull;
import static org.testng.Assert.assertTrue;
+import java.awt.EventQueue;
+import java.awt.FontMetrics;
+import java.awt.event.MouseEvent;
+import java.lang.reflect.InvocationTargetException;
+
+import javax.swing.JLabel;
+
+import org.testng.annotations.AfterMethod;
+import org.testng.annotations.BeforeClass;
+import org.testng.annotations.Test;
import jalview.api.AlignViewportI;
import jalview.bin.Cache;
import jalview.bin.Jalview;
import jalview.datamodel.Alignment;
import jalview.datamodel.AlignmentAnnotation;
import jalview.datamodel.AlignmentI;
+import jalview.datamodel.SearchResults;
+import jalview.datamodel.SearchResultsI;
import jalview.datamodel.Sequence;
import jalview.datamodel.SequenceI;
import jalview.gui.SeqPanel.MousePos;
import jalview.util.MessageManager;
import jalview.viewmodel.ViewportRanges;
-import java.awt.EventQueue;
-import java.awt.event.MouseEvent;
-import java.lang.reflect.InvocationTargetException;
-
-import javax.swing.JLabel;
-
-import org.testng.annotations.AfterMethod;
-import org.testng.annotations.BeforeClass;
-import org.testng.annotations.Test;
import junit.extensions.PA;
evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
+ SeqCanvas sc = testee.seqCanvas;
+ assertEquals(pos.seqIndex, alignmentHeight - 1,
+ String.format("%s n=%d y=%d %d, %d, %d, %d",
+ annotationRows[n].label, n, y, sc.getWidth(),
+ sc.getHeight(), sc.wrappedRepeatHeightPx,
+ sc.wrappedSpaceAboveAlignment));
assertEquals(pos.annotationIndex, n);
}
{
Cache.applicationProperties.setProperty("SHOW_ANNOTATIONS", "false");
Cache.applicationProperties.setProperty("WRAP_ALIGNMENT", "true");
+ Cache.applicationProperties.setProperty("FONT_SIZE", "10");
AlignFrame alignFrame = new FileLoader().LoadFileWaitTillLoaded(
"examples/uniref50.fa", DataSourceType.FILE);
AlignViewportI av = alignFrame.getViewport();
e.printStackTrace();
}
}
+ @Test(groups = "Functional")
+ public void testFindMousePosition_wrapped_scales_longSequence()
+ {
+ Cache.applicationProperties.setProperty("SHOW_ANNOTATIONS", "false");
+ Cache.applicationProperties.setProperty("WRAP_ALIGNMENT", "true");
+ Cache.applicationProperties.setProperty("FONT_SIZE", "14");
+ Cache.applicationProperties.setProperty("FONT_NAME", "SansSerif");
+ Cache.applicationProperties.setProperty("FONT_STYLE", "0");
+ // sequence of 50 bases, doubled 10 times, = 51200 bases
+ String dna = "ATGGCCATTGGGCCCAAATTTCCCAAAGGGTTTCCCTGAGGTCAGTCAGA";
+ for (int i = 0 ; i < 10 ; i++)
+ {
+ dna += dna;
+ }
+ assertEquals(dna.length(), 51200);
+ AlignFrame alignFrame = new FileLoader()
+ .LoadFileWaitTillLoaded(dna, DataSourceType.PASTE);
+ SeqPanel testee = alignFrame.alignPanel.getSeqPanel();
+ AlignViewport av = alignFrame.getViewport();
+ av.setScaleAboveWrapped(true);
+ av.setScaleLeftWrapped(true);
+ av.setScaleRightWrapped(true);
+ alignFrame.alignPanel.updateLayout();
+
+ try
+ {
+ Thread.sleep(200);
+ } catch (InterruptedException e)
+ {
+ }
+
+ final int charHeight = av.getCharHeight();
+ final int charWidth = av.getCharWidth();
+ assertEquals(charHeight, 17);
+ assertEquals(charWidth, 12);
+
+ FontMetrics fm = testee.getFontMetrics(av.getFont());
+ int labelWidth = fm.stringWidth("00000") + charWidth;
+ assertEquals(labelWidth, 57); // 5 x 9 + charWidth
+ assertEquals(testee.seqCanvas.getLabelWidthWest(), labelWidth);
+
+ int x = 0;
+ int y = 0;
+
+ /*
+ * mouse at top left of wrapped panel; there is a gap of 2 * charHeight
+ * above the alignment
+ */
+ MouseEvent evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y,
+ 0, 0, 0, false, 0);
+ MousePos pos = testee.findMousePosition(evt);
+ assertEquals(pos.column, -1); // over scale left, not an alignment column
+ assertEquals(pos.seqIndex, -1); // above sequences
+ assertEquals(pos.annotationIndex, -1);
+
+ /*
+ * cursor over scale above first sequence
+ */
+ y += charHeight;
+ x = labelWidth;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, -1);
+ assertEquals(pos.column, 0);
+ assertEquals(pos.annotationIndex, -1);
+
+ /*
+ * cursor over scale left of first sequence
+ */
+ y += charHeight;
+ x = 0;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, 0);
+ assertEquals(pos.column, -1);
+ assertEquals(pos.annotationIndex, -1);
+
+ /*
+ * cursor over start of first sequence
+ */
+ x = labelWidth;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, 0);
+ assertEquals(pos.column, 0);
+ assertEquals(pos.annotationIndex, -1);
+
+ /*
+ * move one character right, to bottom pixel of same row
+ */
+ x += charWidth;
+ y += charHeight - 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, 0);
+ assertEquals(pos.column, 1);
+
+ /*
+ * move down one pixel - now in the no man's land between rows
+ */
+ y += 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, -1);
+ assertEquals(pos.column, 1);
+
+ /*
+ * move down two char heights less one pixel - still in the no man's land
+ * (scale above + spacer line)
+ */
+ y += (2 * charHeight - 1);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, -1);
+ assertEquals(pos.column, 1);
+
+ /*
+ * move down one more pixel - now on the next row of the sequence
+ */
+ y += 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, 0);
+ assertEquals(pos.column, 1 + av.getWrappedWidth());
+
+ /*
+ * scroll to near the end of the sequence
+ */
+ SearchResultsI sr = new SearchResults();
+ int scrollTo = dna.length() - 1000;
+ sr.addResult(av.getAlignment().getSequenceAt(0), scrollTo, scrollTo);
+ alignFrame.alignPanel.scrollToPosition(sr);
+
+ /*
+ * place the mouse on the first column of the 6th sequence, and
+ * verify that (computed) findMousePosition matches (actual) ViewportRanges
+ */
+ x = labelWidth;
+ y = 17 * charHeight; // 17 = 6 times two header rows and 5 sequence rows
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, 0);
+ int expected = av.getRanges().getStartRes() + 5 * av.getWrappedWidth();
+ assertEquals(pos.column, expected);
+ }
}