import static org.testng.Assert.assertNull;
import static org.testng.Assert.assertTrue;
+import java.awt.EventQueue;
+import java.awt.FontMetrics;
+import java.awt.event.MouseEvent;
+import java.lang.reflect.InvocationTargetException;
+
+import javax.swing.JLabel;
+
+import org.testng.annotations.AfterMethod;
+import org.testng.annotations.BeforeClass;
+import org.testng.annotations.Test;
import jalview.api.AlignViewportI;
import jalview.bin.Cache;
import jalview.bin.Jalview;
import jalview.commands.EditCommand.Action;
import jalview.commands.EditCommand.Edit;
import jalview.datamodel.Alignment;
+import jalview.datamodel.AlignmentAnnotation;
import jalview.datamodel.AlignmentI;
+import jalview.datamodel.SearchResults;
+import jalview.datamodel.SearchResultsI;
import jalview.datamodel.Sequence;
import jalview.datamodel.SequenceI;
import jalview.gui.SeqPanel.MousePos;
import jalview.io.DataSourceType;
import jalview.io.FileLoader;
import jalview.util.MessageManager;
+import jalview.viewmodel.ViewportRanges;
-import java.awt.Event;
-import java.awt.event.MouseEvent;
-
-import javax.swing.JLabel;
-
-import org.testng.annotations.AfterMethod;
-import org.testng.annotations.BeforeClass;
-import org.testng.annotations.Test;
import junit.extensions.PA;
/*
* mouse at top left of unwrapped panel
*/
- MouseEvent evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y,
+ MouseEvent evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y,
0, 0, 0, false, 0);
MousePos pos = testee.findMousePosition(evt);
assertEquals(pos.column, 0);
av.setScaleAboveWrapped(false);
av.setScaleLeftWrapped(false);
av.setScaleRightWrapped(false);
- alignFrame.alignPanel.paintAlignment(false, false);
- waitForSwing(); // for Swing thread
+
+ alignFrame.alignPanel.updateLayout();
final int charHeight = av.getCharHeight();
final int charWidth = av.getCharWidth();
* mouse at top left of wrapped panel; there is a gap of charHeight
* above the alignment
*/
- MouseEvent evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y,
+ MouseEvent evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y,
0, 0, 0, false, 0);
MousePos pos = testee.findMousePosition(evt);
assertEquals(pos.column, 0);
* cursor at bottom of gap above
*/
y = charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, -1);
* cursor over top of first sequence
*/
y = charHeight;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 0);
* cursor at bottom of first sequence
*/
y = 2 * charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 0);
* cursor at top of second sequence
*/
y = 2 * charHeight;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 1);
* cursor at bottom of second sequence
*/
y = 3 * charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 1);
* cursor at bottom of last sequence
*/
y = charHeight * (1 + alignmentHeight) - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, alignmentHeight - 1);
* method reports index of nearest sequence above
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, alignmentHeight - 1);
* cursor still in the gap above annotations, now at the bottom of it
*/
y += SeqCanvas.SEQS_ANNOTATION_GAP - 1; // 3-1 = 2
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, alignmentHeight - 1);
assertEquals(pos.annotationIndex, -1);
- /*
- * cursor at the top of the first annotation
- */
- y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 0); // over first annotation
-
- /*
- * cursor at the bottom of the first annotation
- */
- y += av.getAlignment().getAlignmentAnnotation()[0].height - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 0);
-
- /*
- * cursor at the top of the second annotation
- */
- y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 1);
-
- /*
- * cursor at the bottom of the second annotation
- */
- y += av.getAlignment().getAlignmentAnnotation()[1].height - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 1);
-
- /*
- * cursor at the top of the third annotation
- */
- y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 2);
+ AlignmentAnnotation[] annotationRows = av.getAlignment()
+ .getAlignmentAnnotation();
+ for (int n = 0; n < annotationRows.length; n++)
+ {
+ /*
+ * cursor at the top of the n'th annotation
+ */
+ y += 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, alignmentHeight - 1);
+ assertEquals(pos.annotationIndex, n); // over n'th annotation
- /*
- * cursor at the bottom of the third annotation
- */
- y += av.getAlignment().getAlignmentAnnotation()[2].height - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 2);
+ /*
+ * cursor at the bottom of the n'th annotation
+ */
+ y += annotationRows[n].height - 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, alignmentHeight - 1);
+ assertEquals(pos.annotationIndex, n);
+ }
/*
* cursor in gap between wrapped widths
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, -1);
* cursor at bottom of gap between wrapped widths
*/
y += charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, -1);
* cursor at top of first sequence, second wrapped width
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 0);
av.setScaleAboveWrapped(true);
av.setScaleLeftWrapped(false);
av.setScaleRightWrapped(false);
- alignFrame.alignPanel.paintAlignment(false, false);
- waitForSwing();
+ alignFrame.alignPanel.updateLayout();
final int charHeight = av.getCharHeight();
final int charWidth = av.getCharWidth();
* mouse at top left of wrapped panel; there is a gap of charHeight
* above the alignment
*/
- MouseEvent evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y,
+ MouseEvent evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y,
0, 0, 0, false, 0);
MousePos pos = testee.findMousePosition(evt);
assertEquals(pos.column, 0);
* two charHeights including scale panel
*/
y = 2 * charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, -1);
* cursor over top of first sequence
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 0);
* cursor at bottom of first sequence
*/
y += charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 0);
* cursor at top of second sequence
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 1);
* cursor at bottom of second sequence
*/
y += charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 1);
* (scale + gap + sequences)
*/
y = charHeight * (2 + alignmentHeight) - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, alignmentHeight - 1);
* cursor below sequences, in 3-pixel gap above annotations
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, alignmentHeight - 1);
* method reports index of nearest sequence above
*/
y += SeqCanvas.SEQS_ANNOTATION_GAP - 1; // 3-1 = 2
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, alignmentHeight - 1);
assertEquals(pos.annotationIndex, -1);
- /*
- * cursor at the top of the first annotation
- */
- y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 0); // over first annotation
-
- /*
- * cursor at the bottom of the first annotation
- */
- y += av.getAlignment().getAlignmentAnnotation()[0].height - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 0);
-
- /*
- * cursor at the top of the second annotation
- */
- y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 1);
-
- /*
- * cursor at the bottom of the second annotation
- */
- y += av.getAlignment().getAlignmentAnnotation()[1].height - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 1);
-
- /*
- * cursor at the top of the third annotation
- */
- y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 2);
-
- /*
- * cursor at the bottom of the third annotation
- */
- y += av.getAlignment().getAlignmentAnnotation()[2].height - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 2);
+ AlignmentAnnotation[] annotationRows = av.getAlignment().getAlignmentAnnotation();
+ for (int n = 0; n < annotationRows.length; n++)
+ {
+ /*
+ * cursor at the top of the n'th annotation
+ */
+ y += 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, alignmentHeight - 1);
+ assertEquals(pos.annotationIndex, n); // over n'th annotation
+
+ /*
+ * cursor at the bottom of the n'th annotation
+ */
+ y += annotationRows[n].height - 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ SeqCanvas sc = testee.seqCanvas;
+ assertEquals(pos.seqIndex, alignmentHeight - 1,
+ String.format("%s n=%d y=%d %d, %d, %d, %d",
+ annotationRows[n].label, n, y, sc.getWidth(),
+ sc.getHeight(), sc.wrappedRepeatHeightPx,
+ sc.wrappedSpaceAboveAlignment));
+ assertEquals(pos.annotationIndex, n);
+ }
/*
* cursor in gap between wrapped widths
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, -1);
* cursor at bottom of gap between wrapped widths
*/
y += charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, -1);
* cursor at top of scale, second wrapped width
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, -1);
* cursor at bottom of scale, second wrapped width
*/
y += charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, -1);
* cursor at top of first sequence, second wrapped width
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 0);
{
Cache.applicationProperties.setProperty("SHOW_ANNOTATIONS", "false");
Cache.applicationProperties.setProperty("WRAP_ALIGNMENT", "true");
+ Cache.applicationProperties.setProperty("FONT_SIZE", "10");
AlignFrame alignFrame = new FileLoader().LoadFileWaitTillLoaded(
"examples/uniref50.fa", DataSourceType.FILE);
AlignViewportI av = alignFrame.getViewport();
av.setScaleAboveWrapped(false);
av.setScaleLeftWrapped(false);
av.setScaleRightWrapped(false);
- alignFrame.alignPanel.paintAlignment(false, false);
- waitForSwing();
+ alignFrame.alignPanel.updateLayout();
final int charHeight = av.getCharHeight();
final int charWidth = av.getCharWidth();
* mouse at top left of wrapped panel; there is a gap of charHeight
* above the alignment
*/
- MouseEvent evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y,
+ MouseEvent evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y,
0, 0, 0, false, 0);
MousePos pos = testee.findMousePosition(evt);
assertEquals(pos.column, 0);
* cursor over top of first sequence
*/
y = charHeight;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 0);
* cursor at bottom of last sequence
*/
y = charHeight * (1 + alignmentHeight) - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, alignmentHeight - 1);
* cursor below sequences, at top of charHeight gap between widths
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, -1);
* cursor below sequences, at top of charHeight gap between widths
*/
y += charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, -1);
* cursor at the top of the first sequence, second width
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 0);
int x = 0;
final int charWidth = alignFrame.getViewport().getCharWidth();
assertTrue(charWidth > 0); // sanity check
- assertEquals(alignFrame.getViewport().getRanges().getStartRes(), 0);
+ ViewportRanges ranges = alignFrame.getViewport().getRanges();
+ assertEquals(ranges.getStartRes(), 0);
/*
* mouse at top left of unwrapped panel
*/
- MouseEvent evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, 0,
+ MouseEvent evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0,
0, 0, 0, false, 0);
assertEquals(testee.findColumn(evt), 0);
* not quite one charWidth across
*/
x = charWidth-1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0,
0, 0, 0, false, 0);
assertEquals(testee.findColumn(evt), 0);
* one charWidth across
*/
x = charWidth;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, 0, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0, 0,
false, 0);
assertEquals(testee.findColumn(evt), 1);
* two charWidths across
*/
x = 2 * charWidth;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, 0, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0, 0,
false, 0);
assertEquals(testee.findColumn(evt), 2);
* limited to last column of seqcanvas
*/
x = 20000;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, 0, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0, 0,
false, 0);
SeqCanvas seqCanvas = alignFrame.alignPanel.getSeqPanel().seqCanvas;
int w = seqCanvas.getWidth();
- // limited to number of whole columns, base 0
- int expected = w / charWidth - 1;
+ // limited to number of whole columns, base 0,
+ // and to end of visible range
+ int expected = w / charWidth;
+ expected = Math.min(expected, ranges.getEndRes());
assertEquals(testee.findColumn(evt), expected);
/*
alignFrame.getViewport().hideColumns(4, 9);
x = 5 * charWidth + 2;
// x is in 6th visible column, absolute column 12, or 11 base 0
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, 0, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0, 0,
false, 0);
assertEquals(testee.findColumn(evt), 11);
}
av.setScaleAboveWrapped(false);
av.setScaleLeftWrapped(false);
av.setScaleRightWrapped(false);
- alignFrame.alignPanel.paintAlignment(false, false);
- // need to wait for repaint to finish!
- waitForSwing();
+ alignFrame.alignPanel.updateLayout();
SeqPanel testee = alignFrame.alignPanel.getSeqPanel();
int x = 0;
final int charWidth = av.getCharWidth();
/*
* mouse at top left of wrapped panel, no West (left) scale
*/
- MouseEvent evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, 0,
+ MouseEvent evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0,
0, 0, 0, false, 0);
assertEquals(testee.findColumn(evt), 0);
* not quite one charWidth across
*/
x = charWidth-1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0,
0, 0, 0, false, 0);
assertEquals(testee.findColumn(evt), 0);
* one charWidth across
*/
x = charWidth;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, 0, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0, 0,
false, 0);
assertEquals(testee.findColumn(evt), 1);
* x over scale left (before drawn columns) results in -1
*/
av.setScaleLeftWrapped(true);
- alignFrame.alignPanel.paintAlignment(false, false);
- waitForSwing();
+ alignFrame.alignPanel.updateLayout();
SeqCanvas seqCanvas = testee.seqCanvas;
int labelWidth = (int) PA.getValue(seqCanvas, "labelWidthWest");
assertTrue(labelWidth > 0);
x = labelWidth - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, 0, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0, 0,
false, 0);
assertEquals(testee.findColumn(evt), -1);
x = labelWidth;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, 0, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0, 0,
false, 0);
assertEquals(testee.findColumn(evt), 0);
int residuesWide = av.getRanges().getViewportWidth();
assertTrue(residuesWide > 0);
x = labelWidth + charWidth * residuesWide - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, 0, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0, 0,
false, 0);
assertEquals(testee.findColumn(evt), residuesWide - 1);
* x over scale right (beyond drawn columns) results in -1
*/
av.setScaleRightWrapped(true);
- alignFrame.alignPanel.paintAlignment(false, false);
- waitForSwing();
+ alignFrame.alignPanel.updateLayout();
labelWidth = (int) PA.getValue(seqCanvas, "labelWidthEast");
assertTrue(labelWidth > 0);
int residuesWide2 = av.getRanges().getViewportWidth();
assertTrue(residuesWide2 > 0);
assertTrue(residuesWide2 < residuesWide); // available width reduced
x += 1; // just over left edge of scale right
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, 0, 0, 0, 0,
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0, 0,
false, 0);
assertEquals(testee.findColumn(evt), -1);
}
/**
- * waits a few ms for Swing to do something
+ * waits for Swing event dispatch queue to empty
*/
synchronized void waitForSwing()
{
try
{
- super.wait(10);
- } catch (InterruptedException e)
+ EventQueue.invokeAndWait(new Runnable()
+ {
+ @Override
+ public void run()
+ {
+ }
+ });
+ } catch (InterruptedException | InvocationTargetException e)
{
e.printStackTrace();
}
}
+ @Test(groups = "Functional")
+ public void testFindMousePosition_wrapped_scales_longSequence()
+ {
+ Cache.applicationProperties.setProperty("SHOW_ANNOTATIONS", "false");
+ Cache.applicationProperties.setProperty("WRAP_ALIGNMENT", "true");
+ Cache.applicationProperties.setProperty("FONT_SIZE", "14");
+ Cache.applicationProperties.setProperty("FONT_NAME", "SansSerif");
+ Cache.applicationProperties.setProperty("FONT_STYLE", "0");
+ // sequence of 50 bases, doubled 10 times, = 51200 bases
+ String dna = "ATGGCCATTGGGCCCAAATTTCCCAAAGGGTTTCCCTGAGGTCAGTCAGA";
+ for (int i = 0 ; i < 10 ; i++)
+ {
+ dna += dna;
+ }
+ assertEquals(dna.length(), 51200);
+ AlignFrame alignFrame = new FileLoader()
+ .LoadFileWaitTillLoaded(dna, DataSourceType.PASTE);
+ SeqPanel testee = alignFrame.alignPanel.getSeqPanel();
+ AlignViewport av = alignFrame.getViewport();
+ av.setScaleAboveWrapped(true);
+ av.setScaleLeftWrapped(true);
+ av.setScaleRightWrapped(true);
+ alignFrame.alignPanel.updateLayout();
+
+ try
+ {
+ Thread.sleep(200);
+ } catch (InterruptedException e)
+ {
+ }
+
+ final int charHeight = av.getCharHeight();
+ final int charWidth = av.getCharWidth();
+ assertEquals(charHeight, 17);
+ assertEquals(charWidth, 12);
+
+ FontMetrics fm = testee.getFontMetrics(av.getFont());
+ int labelWidth = fm.stringWidth("00000") + charWidth;
+ assertEquals(labelWidth, 57); // 5 x 9 + charWidth
+ assertEquals(testee.seqCanvas.getLabelWidthWest(), labelWidth);
+
+ int x = 0;
+ int y = 0;
+
+ /*
+ * mouse at top left of wrapped panel; there is a gap of 2 * charHeight
+ * above the alignment
+ */
+ MouseEvent evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y,
+ 0, 0, 0, false, 0);
+ MousePos pos = testee.findMousePosition(evt);
+ assertEquals(pos.column, -1); // over scale left, not an alignment column
+ assertEquals(pos.seqIndex, -1); // above sequences
+ assertEquals(pos.annotationIndex, -1);
+
+ /*
+ * cursor over scale above first sequence
+ */
+ y += charHeight;
+ x = labelWidth;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, -1);
+ assertEquals(pos.column, 0);
+ assertEquals(pos.annotationIndex, -1);
+
+ /*
+ * cursor over scale left of first sequence
+ */
+ y += charHeight;
+ x = 0;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, 0);
+ assertEquals(pos.column, -1);
+ assertEquals(pos.annotationIndex, -1);
+
+ /*
+ * cursor over start of first sequence
+ */
+ x = labelWidth;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, 0);
+ assertEquals(pos.column, 0);
+ assertEquals(pos.annotationIndex, -1);
+
+ /*
+ * move one character right, to bottom pixel of same row
+ */
+ x += charWidth;
+ y += charHeight - 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, 0);
+ assertEquals(pos.column, 1);
+
+ /*
+ * move down one pixel - now in the no man's land between rows
+ */
+ y += 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, -1);
+ assertEquals(pos.column, 1);
+
+ /*
+ * move down two char heights less one pixel - still in the no man's land
+ * (scale above + spacer line)
+ */
+ y += (2 * charHeight - 1);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, -1);
+ assertEquals(pos.column, 1);
+
+ /*
+ * move down one more pixel - now on the next row of the sequence
+ */
+ y += 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, 0);
+ assertEquals(pos.column, 1 + av.getWrappedWidth());
+
+ /*
+ * scroll to near the end of the sequence
+ */
+ SearchResultsI sr = new SearchResults();
+ int scrollTo = dna.length() - 1000;
+ sr.addResult(av.getAlignment().getSequenceAt(0), scrollTo, scrollTo);
+ alignFrame.alignPanel.scrollToPosition(sr);
+
+ /*
+ * place the mouse on the first column of the 6th sequence, and
+ * verify that (computed) findMousePosition matches (actual) ViewportRanges
+ */
+ x = labelWidth;
+ y = 17 * charHeight; // 17 = 6 times two header rows and 5 sequence rows
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+ false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, 0);
+ int expected = av.getRanges().getStartRes() + 5 * av.getWrappedWidth();
+ assertEquals(pos.column, expected);
+ }
}
git://source.jalview.org / jalview.git / blobdiff