--- /dev/null
+package jalview.io.gff;
+
+import static org.testng.AssertJUnit.assertEquals;
+import static org.testng.AssertJUnit.assertNull;
+import static org.testng.AssertJUnit.assertSame;
+import static org.testng.AssertJUnit.assertTrue;
+import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
+
+import jalview.datamodel.AlignedCodonFrame;
+import jalview.datamodel.Alignment;
+import jalview.datamodel.AlignmentI;
+import jalview.datamodel.Mapping;
+import jalview.datamodel.MappingType;
+import jalview.datamodel.Sequence;
+import jalview.datamodel.SequenceDummy;
+import jalview.datamodel.SequenceI;
+import jalview.gui.AlignFrame;
+import jalview.io.FileLoader;
+import jalview.io.FormatAdapter;
+
+import java.io.IOException;
+import java.util.ArrayList;
+import java.util.Iterator;
+import java.util.List;
+import java.util.Map;
+
+import org.testng.annotations.Test;
+
+public class ExonerateHelperTest
+{
+ @Test(groups = "Functional")
+ public void testGetMappingType()
+ {
+ // protein-to-dna:
+ assertSame(MappingType.PeptideToNucleotide,
+ ExonerateHelper
+ .getMappingType("exonerate:protein2genome:local"));
+ assertSame(MappingType.PeptideToNucleotide,
+ ExonerateHelper.getMappingType("exonerate:protein2dna:local"));
+
+ // dna-to-dna:
+ assertSame(MappingType.NucleotideToNucleotide,
+ ExonerateHelper.getMappingType("coding2coding"));
+ assertSame(MappingType.NucleotideToNucleotide,
+ ExonerateHelper.getMappingType("coding2genome"));
+ assertSame(MappingType.NucleotideToNucleotide,
+ ExonerateHelper.getMappingType("cdna2genome"));
+ assertSame(MappingType.NucleotideToNucleotide,
+ ExonerateHelper.getMappingType("genome2genome"));
+ assertNull(ExonerateHelper.getMappingType("affine:local"));
+ }
+
+ /**
+ * Test processing one exonerate GFF line for the case where the mapping is
+ * protein2dna, similarity feature is on the query (the protein), match to the
+ * forward strand, target sequence is in neither the alignment nor the 'new
+ * sequences'
+ *
+ * @throws IOException
+ */
+ @Test(groups = "Functional")
+ public void testProcessGffSimilarity_protein2dna_forward_querygff()
+ throws IOException
+ {
+ ExonerateHelper testee = new ExonerateHelper();
+ List<SequenceI> newseqs = new ArrayList<SequenceI>();
+ String[] gff = "Seq\texonerate:protein2dna:local\tsimilarity\t3\t10\t.\t+\t.\talignment_id 0 ; Target dna1 ; Align 3 400 8"
+ .split("\\t");
+ SequenceI seq = new Sequence("Seq", "PQRASTGKEEDVMIWCHQN");
+ seq.createDatasetSequence();
+ AlignmentI align = new Alignment(new SequenceI[] {});
+ Map<String, List<String>> set = Gff2Helper.parseNameValuePairs(gff[8]);
+
+ /*
+ * this should create a mapping from Seq2/3-10 to virtual sequence
+ * dna1 (added to newseqs) positions 400-423
+ */
+ testee.processGffSimilarity(set, seq, gff, align, newseqs, false);
+ assertEquals(1, newseqs.size());
+ assertTrue(newseqs.get(0) instanceof SequenceDummy);
+ assertEquals("dna1", newseqs.get(0).getName());
+ assertEquals(1, align.getCodonFrames().size());
+ AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
+ assertEquals(1, mapping.getAaSeqs().length);
+ assertSame(seq.getDatasetSequence(), mapping.getAaSeqs()[0]);
+ assertEquals(1, mapping.getdnaSeqs().length);
+ assertSame(newseqs.get(0), mapping.getdnaSeqs()[0]);
+ assertEquals(1, mapping.getdnaToProt().length);
+ assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
+ assertArrayEquals(new int[] { 400, 423 }, mapping.getdnaToProt()[0]
+ .getFromRanges().get(0));
+ assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
+ assertArrayEquals(new int[] { 3, 10 }, mapping.getdnaToProt()[0]
+ .getToRanges().get(0));
+ }
+
+ /**
+ * Test processing one exonerate GFF line for the case where the mapping is
+ * protein2dna, similarity feature is on the query (the protein), match to the
+ * reverse strand
+ *
+ * @throws IOException
+ */
+ @Test(groups = "Functional")
+ public void testProcessGffSimilarity_protein2dna_reverse_querygff()
+ throws IOException
+ {
+ ExonerateHelper testee = new ExonerateHelper();
+ List<SequenceI> newseqs = new ArrayList<SequenceI>();
+ String[] gff = "Seq\texonerate:protein2dna:local\tsimilarity\t3\t10\t0\t-\t.\talignment_id 0 ; Target dna1 ; Align 3 400 8"
+ .split("\\t");
+ SequenceI seq = new Sequence("Seq", "PQRASTGKEEDVMIWCHQN");
+ seq.createDatasetSequence();
+ AlignmentI align = new Alignment(new SequenceI[] {});
+ Map<String, List<String>> set = Gff2Helper.parseNameValuePairs(gff[8]);
+
+ /*
+ * this should create a mapping from Seq2/3-10 to virtual sequence
+ * dna1 (added to newseqs) positions 400-377 (reverse)
+ */
+ testee.processGffSimilarity(set, seq, gff, align, newseqs, false);
+ assertEquals(1, newseqs.size());
+ assertTrue(newseqs.get(0) instanceof SequenceDummy);
+ assertEquals("dna1", newseqs.get(0).getName());
+ assertEquals(1, align.getCodonFrames().size());
+ AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
+ assertEquals(1, mapping.getAaSeqs().length);
+ assertSame(seq.getDatasetSequence(), mapping.getAaSeqs()[0]);
+ assertEquals(1, mapping.getdnaSeqs().length);
+ assertSame(newseqs.get(0), mapping.getdnaSeqs()[0]);
+ assertEquals(1, mapping.getdnaToProt().length);
+ assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
+ assertArrayEquals(new int[] { 400, 377 }, mapping.getdnaToProt()[0]
+ .getFromRanges().get(0));
+ assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
+ assertArrayEquals(new int[] { 3, 10 }, mapping.getdnaToProt()[0]
+ .getToRanges().get(0));
+ }
+
+ /**
+ * Test processing one exonerate GFF line for the case where the mapping is
+ * protein2dna, similarity feature is on the target (the dna), match to the
+ * forward strand
+ *
+ * @throws IOException
+ */
+ @Test(groups = "Functional")
+ public void testProcessGffSimilarity_protein2dna_forward_targetgff()
+ throws IOException
+ {
+ ExonerateHelper testee = new ExonerateHelper();
+ List<SequenceI> newseqs = new ArrayList<SequenceI>();
+ String[] gff = "dna1\texonerate:protein2dna:local\tsimilarity\t400\t423\t0\t+\t.\talignment_id 0 ; Query Prot1 ; Align 400 3 24"
+ .split("\\t");
+ SequenceI seq = new Sequence("dna1/391-430",
+ "CGATCCGATCCGATCCGATCCGATCCGATCCGATCCGATC");
+ seq.createDatasetSequence();
+ AlignmentI align = new Alignment(new SequenceI[] { seq });
+ // GFF feature on the target describes mapping from base 400 for
+ // count 24 to position 3
+ Map<String, List<String>> set = Gff2Helper.parseNameValuePairs(gff[8]);
+
+ /*
+ * this should create a mapping from virtual sequence dna1 (added to
+ * newseqs) positions 400-423 to Prot1/3-10
+ */
+ testee.processGffSimilarity(set, seq, gff, align, newseqs, false);
+ assertEquals(1, newseqs.size());
+ assertTrue(newseqs.get(0) instanceof SequenceDummy);
+ assertEquals("Prot1", newseqs.get(0).getName());
+ assertEquals(1, align.getCodonFrames().size());
+ AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
+ assertEquals(1, mapping.getAaSeqs().length);
+ assertSame(newseqs.get(0), mapping.getAaSeqs()[0]);
+ assertSame(seq.getDatasetSequence(), mapping.getdnaSeqs()[0]);
+ assertEquals(1, mapping.getdnaSeqs().length);
+ assertEquals(1, mapping.getdnaToProt().length);
+ assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
+ assertArrayEquals(new int[] { 400, 423 }, mapping.getdnaToProt()[0]
+ .getFromRanges().get(0));
+ assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
+ assertArrayEquals(new int[] { 3, 10 }, mapping.getdnaToProt()[0]
+ .getToRanges().get(0));
+ }
+
+ /**
+ * Test processing one exonerate GFF line for the case where the mapping is
+ * protein2dna, similarity feature is on the target (the dna), match to the
+ * reverse strand
+ *
+ * @throws IOException
+ */
+ @Test(groups = "Functional")
+ public void testProcessGffSimilarity_protein2dna_reverse_targetgff()
+ throws IOException
+ {
+ ExonerateHelper testee = new ExonerateHelper();
+ List<SequenceI> newseqs = new ArrayList<SequenceI>();
+ String[] gff = "dna1\texonerate:protein2dna:local\tsimilarity\t377\t400\t0\t-\t.\talignment_id 0 ; Query Prot1 ; Align 400 3 24"
+ .split("\\t");
+ SequenceI seq = new Sequence("dna1/371-410",
+ "CGATCCGATCCGATCCGATCCGATCCGATCCGATCCGATC");
+ seq.createDatasetSequence();
+ AlignmentI align = new Alignment(new SequenceI[] { seq });
+ // GFF feature on the target describes mapping from base 400 for
+ // count 24 to position 3
+ Map<String, List<String>> set = Gff2Helper.parseNameValuePairs(gff[8]);
+
+ /*
+ * this should create a mapping from virtual sequence dna1 (added to
+ * newseqs) positions 400-377 (reverse) to Prot1/3-10
+ */
+ testee.processGffSimilarity(set, seq, gff, align, newseqs, false);
+ assertEquals(1, newseqs.size());
+ assertTrue(newseqs.get(0) instanceof SequenceDummy);
+ assertEquals("Prot1", newseqs.get(0).getName());
+ assertEquals(1, align.getCodonFrames().size());
+ AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
+ assertEquals(1, mapping.getAaSeqs().length);
+ assertSame(newseqs.get(0), mapping.getAaSeqs()[0]);
+ assertSame(seq.getDatasetSequence(), mapping.getdnaSeqs()[0]);
+ assertEquals(1, mapping.getdnaSeqs().length);
+ assertEquals(1, mapping.getdnaToProt().length);
+ assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
+ assertArrayEquals(new int[] { 400, 377 }, mapping.getdnaToProt()[0]
+ .getFromRanges().get(0));
+ assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
+ assertArrayEquals(new int[] { 3, 10 }, mapping.getdnaToProt()[0]
+ .getToRanges().get(0));
+ }
+
+ /**
+ * Tests loading exonerate GFF2 output, including 'similarity' alignment
+ * feature, on to sequences
+ */
+ @Test(groups = { "Functional" })
+ public void testAddExonerateGffToAlignment()
+ {
+ FileLoader loader = new FileLoader(false);
+ AlignFrame af = loader.LoadFileWaitTillLoaded(
+ "examples/testdata/exonerateseqs.fa",
+ FormatAdapter.FILE);
+
+ af.loadJalviewDataFile("examples/testdata/exonerateoutput.gff",
+ FormatAdapter.FILE, null, null);
+
+ /*
+ * verify one mapping to a dummy sequence, one to a real one
+ */
+ List<AlignedCodonFrame> mappings = af
+ .getViewport().getAlignment().getDataset().getCodonFrames();
+ assertEquals(2, mappings.size());
+ Iterator<AlignedCodonFrame> iter = mappings.iterator();
+
+ // first mapping is to dummy sequence
+ AlignedCodonFrame mapping = iter.next();
+ Mapping[] mapList = mapping.getProtMappings();
+ assertEquals(1, mapList.length);
+ assertTrue(mapList[0].getTo() instanceof SequenceDummy);
+ assertEquals("DDB_G0269124", mapList[0].getTo().getName());
+
+ // 143 in protein should map to codon [11270, 11269, 11268] in dna
+ int[] mappedRegion = mapList[0].getMap().locateInFrom(143, 143);
+ assertArrayEquals(new int[] { 11270, 11268 }, mappedRegion);
+
+ // second mapping is to a sequence in the alignment
+ mapping = iter.next();
+ mapList = mapping.getProtMappings();
+ assertEquals(1, mapList.length);
+ SequenceI proteinSeq = af.getViewport().getAlignment()
+ .findName("DDB_G0280897");
+ assertSame(proteinSeq.getDatasetSequence(), mapList[0].getTo());
+ assertEquals(1, mapping.getdnaToProt().length);
+
+ // 143 in protein should map to codon [11270, 11269, 11268] in dna
+ mappedRegion = mapList[0].getMap().locateInFrom(143, 143);
+ assertArrayEquals(new int[] { 11270, 11268 }, mappedRegion);
+
+ // 182 in protein should map to codon [11153, 11152, 11151] in dna
+ mappedRegion = mapList[0].getMap().locateInFrom(182, 182);
+ assertArrayEquals(new int[] { 11153, 11151 }, mappedRegion);
+
+ // and the reverse mapping:
+ mappedRegion = mapList[0].getMap().locateInTo(11151, 11153);
+ assertArrayEquals(new int[] { 182, 182 }, mappedRegion);
+
+ // 11150 in dna should _not_ map to protein
+ mappedRegion = mapList[0].getMap().locateInTo(11150, 11150);
+ assertNull(mappedRegion);
+
+ // similarly 183 in protein should _not_ map to dna
+ mappedRegion = mapList[0].getMap().locateInFrom(183, 183);
+ assertNull(mappedRegion);
+ }
+}
git://source.jalview.org / jalview.git / blobdiff