+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.io.gff;
import static org.testng.AssertJUnit.assertEquals;
"GAATTCGTTCATGTAGGTTGATTTTTATT");
seq.createDatasetSequence();
AlignmentI align = new Alignment(new SequenceI[] {});
-
+
// mapping from gi|68711 12923-13060 to gi|N37351 1-138
String[] gff = "gi|68711\tblat-pasa\tcDNA_match\t12923\t13060\t98.55\t+\t.\tID=align_68;Target=gi|N37351 1 138 +"
.split("\\t");
// (this is important for 'align cdna to genome' to work correctly)
assertEquals(1, align.getCodonFrames().size());
AlignedCodonFrame mapping = align.getCodonFrames().get(0);
-
+
/*
* 'dnaseqs' (map from) is here [gi|68711]
* 'aaseqs' (map to) is here [gi|N37351]
assertEquals(1, mapping.getdnaToProt().length);
assertEquals(2, mapping.getdnaToProt()[0].getFromRanges().size());
// the two spliced dna ranges are combined in one MapList
- assertArrayEquals(new int[] { 12923, 13060 },
- mapping.getdnaToProt()[0]
+ assertArrayEquals(new int[] { 12923, 13060 }, mapping.getdnaToProt()[0]
.getFromRanges().get(0));
assertArrayEquals(new int[] { 13411, 13550 }, mapping.getdnaToProt()[0]
.getFromRanges().get(1));