JAL-2189 apply license

[jalview.git] / test / jalview / io / gff / GffTests.java

diff --git a/test/jalview/io/gff/GffTests.java b/test/jalview/io/gff/GffTests.java
index 77da8fa..221f612 100644 (file)
--- a/test/jalview/io/gff/GffTests.java
+++ b/test/jalview/io/gff/GffTests.java
@@ -1,3 +1,23 @@
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ * 
+ * This file is part of Jalview.
+ * 
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License 
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *  
+ * Jalview is distributed in the hope that it will be useful, but 
+ * WITHOUT ANY WARRANTY; without even the implied warranty 
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR 
+ * PURPOSE.  See the GNU General Public License for more details.
+ * 
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview.  If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
 package jalview.io.gff;
 
 import static org.testng.AssertJUnit.assertEquals;
@@ -69,8 +89,6 @@ public class GffTests
     mappedRegion = mapList[0].getMap().locateInFrom(15, 15);
     assertArrayEquals(new int[] { 12, 10 }, mappedRegion);
 
-    // so far so good; TODO: programmatically add mapped sequences
-    // and verify the mappings are 'realised'
     SequenceI dna1 = new Sequence("dna1", "AAACCCGGGTTTAAACCCGGGTTT");
     AlignmentI al = new Alignment(new SequenceI[] { dna1 });
     al.setDataset(null);