--- /dev/null
+/*
+ VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases.
+ Copyright (C) 2008 Kevin Darty, Alain Denise and Yann Ponty.
+ electronic mail : Yann.Ponty@lri.fr
+ paper mail : LRI, bat 490 Université Paris-Sud 91405 Orsay Cedex France
+
+ This file is part of VARNA version 3.1.
+ VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License
+ as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+
+ VARNA version 3.1 is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY;
+ without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+ See the GNU General Public License for more details.
+
+ You should have received a copy of the GNU General Public License along with VARNA version 3.1.
+ If not, see http://www.gnu.org/licenses.
+ */
+package fr.orsay.lri.varna.applications;
+
+import java.awt.BorderLayout;
+import java.awt.Color;
+import java.awt.Dimension;
+import java.awt.Font;
+import java.awt.GridLayout;
+import java.awt.event.ActionEvent;
+import java.awt.event.ActionListener;
+import java.awt.event.ItemEvent;
+import java.awt.event.ItemListener;
+import java.awt.event.MouseEvent;
+import java.math.BigInteger;
+import java.util.ArrayList;
+import java.util.Collections;
+
+import javax.swing.BorderFactory;
+import javax.swing.DefaultComboBoxModel;
+import javax.swing.JButton;
+import javax.swing.JComboBox;
+import javax.swing.JFrame;
+import javax.swing.JLabel;
+import javax.swing.JOptionPane;
+import javax.swing.JPanel;
+import javax.swing.JSplitPane;
+import javax.swing.JTextArea;
+import javax.swing.JTextField;
+import javax.swing.JTextPane;
+import javax.swing.border.BevelBorder;
+
+import fr.orsay.lri.varna.VARNAPanel;
+import fr.orsay.lri.varna.controlers.ControleurInterpolator;
+import fr.orsay.lri.varna.exceptions.ExceptionDrawingAlgorithm;
+import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax;
+import fr.orsay.lri.varna.exceptions.ExceptionModeleStyleBaseSyntaxError;
+import fr.orsay.lri.varna.exceptions.ExceptionNAViewAlgorithm;
+import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
+import fr.orsay.lri.varna.exceptions.ExceptionParameterError;
+import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses;
+import fr.orsay.lri.varna.exceptions.MappingException;
+import fr.orsay.lri.varna.models.VARNAConfig;
+import fr.orsay.lri.varna.models.VARNAConfig.BP_STYLE;
+import fr.orsay.lri.varna.models.rna.Mapping;
+import fr.orsay.lri.varna.models.rna.ModeleBP;
+import fr.orsay.lri.varna.models.rna.ModeleBase;
+import fr.orsay.lri.varna.models.rna.ModelBaseStyle;
+import fr.orsay.lri.varna.models.rna.RNA;
+import fr.orsay.lri.varna.interfaces.InterfaceVARNABasesListener;
+import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener;;
+
+public class NussinovDesignDemo extends JFrame implements InterfaceVARNAListener,InterfaceVARNABasesListener, ItemListener {
+
+ /**
+ *
+ */
+ private static final long serialVersionUID = -790155708306987257L;
+
+ private static final String SEQUENCE_A = "AGGCACGUCU";
+ private static final String SEQUENCE_B = "GAGUAGCCUC";
+ private static final String SEQUENCE_C = "GCAUAGCUGC";
+ private static final String SEQUENCE_INRIA = "CGAUUGCAUCGCAAGU";
+
+ private static final String TARGET_STRUCTURE_1 = "(((((((..)))))))";
+ private static final String TARGET_STRUCTURE_2 = "(((())))(((())))";
+ private static final String TARGET_STRUCTURE_3 = "(.((.((..).)).))";
+ private static final String TARGET_STRUCTURE_4 = "((((((())))(((())(()))))))";
+ private static final String TARGET_STRUCTURE_5 = "(((())))(((())))(((())))(((())))(((())))(((())))";
+
+ private static final String SEQUENCE_BIG = "AAAACAAAAACACCAUGGUGUUUUCACCCAAUUGGGUGAAAACAGAGAUCUCGAGAUCUCUGUUUUUGUUUU";
+
+ private static final String DEFAULT_STRUCTURE = "..........";
+ // private static final String DEFAULT_STRUCTURE1 = "((((....))))";
+ // private static final String DEFAULT_STRUCTURE2 =
+ // "((((..(((....)))..))))";
+
+ private VARNAPanel _vpMaster;
+ private VARNAPanel _vpTarget;
+
+ private InfoPanel _infos = new InfoPanel();
+ private JPanel _tools = new JPanel();
+ private JPanel _input = new JPanel();
+
+ private JPanel _seqPanel = new JPanel();
+ private JPanel _structPanel = new JPanel();
+ private JLabel _actions = new JLabel();
+ private JComboBox _struct = new JComboBox();
+ private JLabel _seq1 = new JLabel();
+ private JLabel _structLabel = new JLabel("Structure Cible");
+ private JLabel _seqLabel = new JLabel("Sequence d'ARN");
+ private JButton _switchButton = new JButton("Reset");
+
+
+ private Color _backgroundColor = Color.white;
+
+ private Color _okColor = Color.decode("#E33729");
+ private Color _koColor = new Color(250,200,200);
+
+
+ public static ModelBaseStyle createStyle(String txt)
+ {
+ ModelBaseStyle result = new ModelBaseStyle();
+ try {
+ result.assignParameters(txt);
+ } catch (ExceptionModeleStyleBaseSyntaxError e) {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ } catch (ExceptionParameterError e) {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ }
+ return result;
+ }
+
+ public void applyTo(VARNAPanel vp, ModelBaseStyle mb, int[] indices)
+ {
+ for(int i=0;i<indices.length;i++)
+ {
+ ModeleBase m = vp.getRNA().getBaseAt(indices[i]);
+ m.setStyleBase(mb);
+ if (m.getElementStructure()!=-1)
+ {
+ vp.getRNA().getBaseAt(m.getElementStructure()).setStyleBase(mb);
+ }
+ }
+ vp.repaint();
+ }
+
+
+ public NussinovDesignDemo() {
+ super();
+ try {
+ _vpMaster = new VARNAPanel(getSeq(), "");
+ _vpTarget = new VARNAPanel();
+ } catch (ExceptionNonEqualLength e) {
+ _vpMaster.errorDialog(e);
+ }
+ _vpMaster.setPreferredSize(new Dimension(600, 600));
+ _vpTarget.setPreferredSize(new Dimension(600, 600));
+ RNAPanelDemoInit();
+ }
+
+ static Font labelsFont = Font.decode("Dialog-BOLD-25");
+
+ private void RNAPanelDemoInit() {
+ int marginTools = 250;
+ Font textFieldsFont = Font.decode("MonoSpaced-BOLD-16");
+
+
+
+ _seq1.setFont(textFieldsFont.deriveFont(25f));
+
+
+ setBackground(_backgroundColor);
+
+
+ _structLabel.setFont(labelsFont.deriveFont(Font.PLAIN));
+
+
+ String[] secstr = {TARGET_STRUCTURE_1,TARGET_STRUCTURE_2,TARGET_STRUCTURE_3,TARGET_STRUCTURE_4,TARGET_STRUCTURE_5};
+ DefaultComboBoxModel cm = new DefaultComboBoxModel(secstr);
+ _struct.setModel(cm);
+ _struct.addActionListener(new ActionListener() {
+ public void actionPerformed(ActionEvent e) {
+ System.out.println(e.getActionCommand());
+ setTarget(((JComboBox)e.getSource()).getSelectedItem().toString());
+ }
+ });
+ _struct.setFont(textFieldsFont);
+ _struct.setEnabled(true);
+ _struct.setEditable(true);
+
+
+ _switchButton.addActionListener(new ActionListener() {
+ public void actionPerformed(ActionEvent e) {
+ setTarget(_struct.getSelectedItem().toString());
+ }
+ });
+
+ _seqPanel.setLayout(new BorderLayout());
+ _seqPanel.add(_seqLabel, BorderLayout.WEST);
+ _seqPanel.add(_seq1, BorderLayout.CENTER);
+
+ _seqPanel.setBorder(BorderFactory.createEmptyBorder(5, 5, 5, 5));
+
+ _structLabel.setPreferredSize(new Dimension(marginTools, 15));
+ _structLabel.setHorizontalTextPosition(JLabel.LEFT);
+ _structPanel.setLayout(new BorderLayout());
+ _structPanel.add(_structLabel, BorderLayout.WEST);
+ _structPanel.add(_struct, BorderLayout.CENTER);
+
+ _input.setLayout(new GridLayout(0, 1));
+ _input.add(_structPanel);
+
+ JPanel goPanel = new JPanel();
+ goPanel.setLayout(new BorderLayout());
+
+ _infos.setFont(labelsFont);
+
+
+ formatLabel(_seqLabel);
+ formatLabel(_seq1);
+
+
+ _tools.setLayout(new BorderLayout());
+ //_tools.add(_infos, BorderLayout.NORTH);
+ _tools.add(_input, BorderLayout.CENTER);
+ _tools.add(_actions, BorderLayout.SOUTH);
+ _tools.add(goPanel, BorderLayout.EAST);
+
+ _tools.setBorder(BorderFactory.createEmptyBorder(5, 5, 5, 5));
+
+ //goPanel.add(_goButton, BorderLayout.CENTER);
+ goPanel.add(_switchButton, BorderLayout.CENTER);
+
+ getContentPane().setLayout(new BorderLayout());
+ JSplitPane VARNAs = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT);
+ VARNAs.setBorder(BorderFactory.createBevelBorder(BevelBorder.RAISED));
+ //VARNAs.setLayout(new GridLayout(1,2));
+ JPanel mast2 = new JPanel();
+ mast2.setLayout(new BorderLayout());
+ mast2.add(_seqPanel, BorderLayout.NORTH);
+ mast2.add(_infos, BorderLayout.SOUTH);
+
+ JPanel mast = new JPanel();
+ mast.setLayout(new BorderLayout());
+ mast.add(_vpMaster, BorderLayout.CENTER);
+ mast.add(mast2,BorderLayout.SOUTH);
+
+ VARNAs.add(mast);
+ VARNAs.add(_vpTarget);
+ VARNAs.doLayout();
+ VARNAs.setDividerSize(5);
+
+ getContentPane().add(VARNAs, BorderLayout.CENTER);
+ getContentPane().add(_tools, BorderLayout.NORTH);
+
+ setVisible(true);
+
+
+ _vpMaster.setBackground(_backgroundColor);
+ _vpMaster.addVARNAListener(this);
+ _vpMaster.setTitle("Meilleur repliement - Séquence courante");
+ _vpMaster.setBPStyle(BP_STYLE.SIMPLE);
+ _vpMaster.getVARNAUI().UIRadiate();
+ _vpMaster.setTitleFontSize(26f);
+ _vpMaster.setTitleFontStyle(Font.PLAIN);
+
+ _vpTarget.setBackground(Color.decode("#308099"));
+ _vpTarget.setModifiable(false);
+ _vpTarget.setTitle("Repliement cible");
+ _vpTarget.setBPStyle(BP_STYLE.SIMPLE);
+ _vpTarget.setBackboneColor(Color.white);
+ _vpTarget.setDefaultBPColor(Color.white);
+ _vpTarget.setBaseNumbersColor(Color.white);
+ _vpTarget.setBaseOutlineColor(Color.white);
+ _vpTarget.setTitleColor(Color.white);
+ _vpTarget.setTitleFontSize(26f);
+
+
+ _okColor = Color.decode("#F39126");
+ _koColor = new Color(250,200,200);
+
+ _seqPanel.setBackground(Color.decode("#E33729"));
+ _infos.setBackground(Color.decode("#E33729"));
+
+
+
+ _vpMaster.addVARNABasesListener(this);
+ setTitle("Fête de la science 2015 - Inria AMIB - Design d'ARN");
+
+ setTarget(secstr[0]);
+
+ }
+
+ private synchronized void showSolution()
+ {
+ ArrayList<String> sols = getStructs();
+ _infos.setInfo(sols, count(getSeq()));
+ if ((sols.size()==1)&&(sols.get(0).equals(_struct.getSelectedItem().toString())))
+ {
+ /*JOptionPane.showMessageDialog(null,
+ "Vous avez trouvé une séquence pour cette structure !!!\n Saurez vous faire le design de molécules plus complexes ?",
+ "Félicitations !",
+ JOptionPane.INFORMATION_MESSAGE);*/
+
+ }
+ else
+ {
+ this._vpMaster.setTitle("Meilleur repliement - Séquence courante");
+ }
+ }
+
+
+ public void setTarget(String target)
+ {
+ try {
+ _vpTarget.drawRNA(String.format("%"+target.length()+"s", ""),target);
+ _vpTarget.setBaseNumbersColor(Color.white);
+ _vpTarget.setBaseOutlineColor(Color.white);
+ //_vpTarget.toggleDrawOutlineBases();
+ createDummySeq();
+ showSolution();
+ onStructureRedrawn();
+ } catch (ExceptionNonEqualLength e) {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ }
+ }
+
+ private void createDummySeq()
+ {
+ RNA r = _vpTarget.getRNA();
+ String seq = new String();
+ for (int i=0;i<r.getSize();i++)
+ {
+ seq += 'A';
+ }
+ try {
+ RNA rn = new RNA();
+ rn.setRNA(seq,r.getStructDBN());
+ for(ModeleBP mbp: r.getAllBPs())
+ {
+ rn.getBaseAt(mbp.getIndex5()).setContent("A");
+ rn.getBaseAt(mbp.getIndex3()).setContent("U");
+ }
+ _vpMaster.drawRNA(rn);
+ _vpMaster.repaint();
+ _seq1.setText(_vpMaster.getRNA().getSeq());
+ } catch (ExceptionUnmatchedClosingParentheses e) {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ } catch (ExceptionFileFormatOrSyntax e) {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ }
+ }
+
+
+ public String getSeq()
+ {
+ return (""+_seq1.getText()).toUpperCase();
+ }
+
+
+ private boolean canBasePairAll(char a, char b)
+ {
+ return true;
+ }
+
+ private boolean canBasePairBasic(char a, char b)
+ {
+ if ((a=='G')&&(b=='C'))
+ return true;
+ if ((a=='C')&&(b=='G'))
+ return true;
+ if ((a=='U')&&(b=='A'))
+ return true;
+ if ((a=='A')&&(b=='U'))
+ return true;
+ return false;
+ }
+
+ private double basePairScoreBasic(char a, char b)
+ {
+ if ((a=='G')&&(b=='C'))
+ return 1.0;
+ if ((a=='C')&&(b=='G'))
+ return 1.0;
+ if ((a=='U')&&(b=='A'))
+ return 1.0;
+ if ((a=='A')&&(b=='U'))
+ return 1.0;
+ return Double.NEGATIVE_INFINITY;
+ }
+
+
+ private boolean canBasePairNussinov(char a, char b)
+ {
+ if ((a=='G')&&(b=='C'))
+ return true;
+ if ((a=='C')&&(b=='G'))
+ return true;
+ if ((a=='U')&&(b=='A'))
+ return true;
+ if ((a=='A')&&(b=='U'))
+ return true;
+ if ((a=='U')&&(b=='G'))
+ return true;
+ if ((a=='G')&&(b=='U'))
+ return true;
+ return false;
+ }
+
+ private double basePairScoreNussinov(char a, char b)
+ {
+ if ((a=='G')&&(b=='C'))
+ return 3.0;
+ if ((a=='C')&&(b=='G'))
+ return 3.0;
+ if ((a=='U')&&(b=='A'))
+ return 2.0;
+ if ((a=='A')&&(b=='U'))
+ return 2.0;
+ if ((a=='U')&&(b=='G'))
+ return 1.0;
+ if ((a=='G')&&(b=='U'))
+ return 1.0;
+ return Double.NEGATIVE_INFINITY;
+ }
+
+ private boolean canBasePairINRIA(char a, char b)
+ {
+ if ((a=='U')&&(b=='A'))
+ return true;
+ if ((a=='A')&&(b=='U'))
+ return true;
+ if ((a=='G')&&(b=='C'))
+ return true;
+ if ((a=='C')&&(b=='G'))
+ return true;
+
+ if ((a=='A')&&(b=='G'))
+ return true;
+ if ((a=='G')&&(b=='A'))
+ return true;
+ if ((a=='U')&&(b=='C'))
+ return true;
+ if ((a=='C')&&(b=='U'))
+ return true;
+ if ((a=='A')&&(b=='A'))
+ return true;
+ if ((a=='U')&&(b=='U'))
+ return true;
+
+ if ((a=='U')&&(b=='G'))
+ return true;
+ if ((a=='G')&&(b=='U'))
+ return true;
+ if ((a=='A')&&(b=='C'))
+ return true;
+ if ((a=='C')&&(b=='A'))
+ return true;
+ return false;
+ }
+
+ private double basePairScoreINRIA(char a, char b)
+ {
+ if ((a=='U')&&(b=='A'))
+ return 3;
+ if ((a=='A')&&(b=='U'))
+ return 3;
+ if ((a=='G')&&(b=='C'))
+ return 3;
+ if ((a=='C')&&(b=='G'))
+ return 3;
+
+ if ((a=='A')&&(b=='G'))
+ return 2;
+ if ((a=='G')&&(b=='A'))
+ return 2;
+ if ((a=='U')&&(b=='C'))
+ return 2;
+ if ((a=='C')&&(b=='U'))
+ return 2;
+ if ((a=='A')&&(b=='A'))
+ return 2;
+ if ((a=='U')&&(b=='U'))
+ return 2;
+
+ if ((a=='U')&&(b=='G'))
+ return 1;
+ if ((a=='G')&&(b=='U'))
+ return 1;
+ if ((a=='A')&&(b=='C'))
+ return 1;
+ if ((a=='C')&&(b=='A'))
+ return 1;
+ return Double.NEGATIVE_INFINITY;
+ }
+
+ private boolean canBasePair(char a, char b)
+ {
+ return canBasePairBasic(a,b);
+ //return canBasePairNussinov(a,b);
+ //return canBasePairINRIA(a,b);
+ }
+
+ private double basePairScore(char a, char b)
+ {
+ return basePairScoreBasic(a,b);
+ //return basePairScoreNussinov(a,b);
+ //return basePairScoreINRIA(a,b);
+ }
+
+ public double[][] fillMatrix(String seq)
+ {
+ int n = seq.length();
+ double[][] tab = new double[n][n];
+ for(int m=1;m<=n;m++)
+ {
+ for(int i=0;i<n-m+1;i++)
+ {
+ int j = i+m-1;
+ tab[i][j] = 0;
+ if (i<j)
+ {
+ tab[i][j] = Math.max(tab[i][j], tab[i+1][j]);
+ for (int k=i+1;k<=j;k++)
+ {
+ if (canBasePair(seq.charAt(i),seq.charAt(k)))
+ {
+ double fact1 = 0;
+ if (k>i+1)
+ {
+ fact1 = tab[i+1][k-1];
+ }
+ double fact2 = 0;
+ if (k<j)
+ {
+ fact2 = tab[k+1][j];
+ }
+ tab[i][j] = Math.max(tab[i][j],basePairScore(seq.charAt(i),seq.charAt(k))+fact1+fact2);
+ }
+ }
+ }
+ }
+ }
+ return tab;
+ }
+
+ public static ArrayList<Double> combine(double bonus, ArrayList<Double> part1, ArrayList<Double> part2)
+ {
+ ArrayList<Double> base = new ArrayList<Double>();
+ for(double d1: part1)
+ {
+ for(double d2: part2)
+ {
+ base.add(bonus+d1+d2);
+ }
+ }
+ return base;
+ }
+
+ public static ArrayList<Double> selectBests(ArrayList<Double> base)
+ {
+ ArrayList<Double> result = new ArrayList<Double>();
+ double best = Double.NEGATIVE_INFINITY;
+ for(double val: base)
+ {
+ best = Math.max(val, best);
+ }
+ for(double val: base)
+ {
+ if (val == best)
+ result.add(val);
+ }
+ return result;
+ }
+
+
+ private ArrayList<String> backtrack(double[][] tab, String seq)
+ {
+ return backtrack(tab,seq, 0, seq.length()-1);
+ }
+
+ private ArrayList<String> backtrack(double[][] tab, String seq, int i, int j)
+ {
+ ArrayList<String> result = new ArrayList<String>();
+ if (i<j)
+ {
+ ArrayList<Integer> indices = new ArrayList<Integer>();
+ indices.add(-1);
+ for (int k=i+1;k<=j;k++)
+ {
+ indices.add(k);
+ }
+ for (int k : indices)
+ {
+ if (k==-1)
+ {
+ if (tab[i][j] == tab[i+1][j])
+ {
+ for (String s:backtrack(tab, seq, i+1,j))
+ {
+ result.add("."+s);
+ }
+ }
+ }
+ else
+ {
+ if (canBasePair(seq.charAt(i),seq.charAt(k)))
+ {
+ double fact1 = 0;
+ if (k>i+1)
+ {
+ fact1 = tab[i+1][k-1];
+ }
+ double fact2 = 0;
+ if (k<j)
+ {
+ fact2 = tab[k+1][j];
+ }
+ if (tab[i][j]==basePairScore(seq.charAt(i),seq.charAt(k))+fact1+fact2)
+ {
+ for (String s1:backtrack(tab, seq, i+1,k-1))
+ {
+ for (String s2:backtrack(tab, seq, k+1,j))
+ {
+ result.add("("+s1+")"+s2);
+ }
+ }
+ }
+ }
+ }
+ }
+ }
+ else if (i==j)
+ {
+ result.add(".");
+ }
+ else
+ {
+ result.add("");
+ }
+ return result;
+ }
+
+ public BigInteger count(String seq)
+ {
+ int n = seq.length();
+
+ BigInteger[][] tab = new BigInteger[n][n];
+ for(int m=1;m<=n;m++)
+ {
+ for(int i=0;i<n-m+1;i++)
+ {
+ int j = i+m-1;
+ tab[i][j] = BigInteger.ZERO;
+ if (i<j)
+ {
+ tab[i][j] = tab[i][j].add(tab[i+1][j]);
+ for (int k=i+1;k<=j;k++)
+ {
+ if (canBasePair(seq.charAt(i),seq.charAt(k)))
+ {
+ BigInteger fact1 = BigInteger.ONE;
+ if (k>i+1)
+ {
+ fact1 = tab[i+1][k-1];
+ }
+ BigInteger fact2 = BigInteger.ONE;
+ if (k<j)
+ {
+ fact2 = tab[k+1][j];
+ }
+ tab[i][j] = tab[i][j].add(fact1.multiply(fact2));
+ }
+ }
+ }
+ else
+ {
+ tab[i][j] = BigInteger.ONE;
+ }
+ }
+ }
+ return tab[0][n-1];
+ }
+
+ private String _cache = "";
+ ArrayList<String> _cacheStructs = new ArrayList<String>();
+
+ public ArrayList<String> getStructs() {
+ String seq = getSeq();
+ seq = seq.toUpperCase();
+ if (!_cache.equals(seq))
+ {
+ double[][] mfe = fillMatrix(seq);
+ _cacheStructs = backtrack(mfe,seq);
+ _cache = seq;
+ }
+ return _cacheStructs;
+ }
+
+ public VARNAPanel get_varnaPanel() {
+ return _vpMaster;
+ }
+
+ public void set_varnaPanel(VARNAPanel surface) {
+ _vpMaster = surface;
+ }
+
+
+ public JLabel get_info() {
+ return _actions;
+ }
+
+ public void set_info(JLabel _info) {
+ this._actions = _info;
+ }
+
+ public static void main(String[] args) {
+ NussinovDesignDemo d = new NussinovDesignDemo();
+ d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
+ d.pack();
+ d.setVisible(true);
+ }
+
+ public void onStructureRedrawn() {
+ _vpMaster.repaint();
+ }
+
+ public void onWarningEmitted(String s) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void onLoad(String path) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void onLoaded() {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void onUINewStructure(VARNAConfig v, RNA r) {
+ // TODO Auto-generated method stub
+
+ }
+
+ static final String[] _bases = {"A","C","G","U"};
+ static final String[] _basesComp = {"U","G","C","A"};
+
+ public void onBaseClicked(ModeleBase mb, MouseEvent e) {
+ int index = -1;
+ for(int i =0;i<_bases.length;i++)
+ {
+ if (mb.getContent().equalsIgnoreCase(_bases[i]))
+ {
+ index = i;
+ }
+ }
+ index = (index+1)%_bases.length;
+ mb.setContent(_bases[index].toUpperCase());
+ ArrayList<ModeleBase> partners =_vpTarget.getRNA().getAllPartners(mb.getIndex());
+ if (partners.size()!=0)
+ {
+ ModeleBase mbPartner = _vpMaster.getRNA().getBaseAt(partners.get(0).getIndex());
+ mbPartner.setContent(_basesComp[index].toUpperCase());
+ }
+ _vpMaster.repaint();
+ _seq1.setText(_vpMaster.getRNA().getSeq());
+ new Temporizer(_vpMaster.getRNA().getSeq()).start();
+ }
+
+ private class Temporizer extends Thread{
+ String _seq;
+ public Temporizer(String seq)
+ {
+ _seq = seq;
+ }
+ public void run() {
+ try {
+ this.sleep(1000);
+ if (_vpMaster.getRNA().getSeq().equalsIgnoreCase(_seq))
+ {
+ showSolution();
+ }
+ } catch (InterruptedException e) {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ }
+ }
+ }
+ public void onZoomLevelChanged() {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void onTranslationChanged() {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void itemStateChanged(ItemEvent arg0) {
+ // TODO Auto-generated method stub
+ System.out.println();
+ }
+
+
+ public static void formatLabel(JLabel j)
+ {
+ j.setHorizontalTextPosition(JLabel.LEFT);
+ j.setPreferredSize(new Dimension(NussinovDemo.marginTools, 25));
+ j.setFont(labelsFont);
+ j.setForeground(Color.white);
+ }
+
+ public static void formatLabel(JTextArea j)
+ {
+ j.setPreferredSize(new Dimension(NussinovDemo.marginTools, 25));
+ j.setFont(labelsFont);
+ j.setForeground(Color.white);
+ }
+
+ public class InfoPanel extends JPanel
+ {
+ ArrayList<String> _sols = new ArrayList<String>();
+ BigInteger _nbFolds = BigInteger.ZERO;
+ JLabel _text = new JLabel("");
+ JLabel _subopts = new JLabel("");
+ JPanel _suboptBrowser = new JPanel();
+ JPanel _suboptCount = new JPanel();
+ int _selectedIndex = 0;
+ JButton next = new JButton(">");
+ JButton previous = new JButton("<");
+
+ InfoPanel()
+ {
+ this.setBorder(BorderFactory.createEmptyBorder(5, 5, 5, 5));
+ setLayout(new BorderLayout());
+ add(_suboptBrowser,BorderLayout.SOUTH);
+ add(_suboptCount,BorderLayout.NORTH);
+
+ next.addActionListener(new ActionListener(){
+ public void actionPerformed(ActionEvent arg0) {
+ if (_sols.size()>0)
+ {
+ setSelectedIndex((_selectedIndex+1)%_sols.size());
+ }
+ }
+ });
+
+ previous.addActionListener(new ActionListener(){
+ public void actionPerformed(ActionEvent arg0) {
+ if (_sols.size()>0)
+ {
+ setSelectedIndex((_selectedIndex+_sols.size()-1)%_sols.size());
+ }
+ }
+ });
+ next.setEnabled(false);
+ previous.setEnabled(false);
+
+ JLabel nbLab = new JLabel("#Repliements");
+ NussinovDesignDemo.formatLabel(nbLab);
+
+
+ JLabel cooptlab = new JLabel("#Co-optimaux");
+ NussinovDesignDemo.formatLabel(cooptlab);
+
+ NussinovDesignDemo.formatLabel(_text);
+ NussinovDesignDemo.formatLabel(_subopts);
+
+
+ _suboptCount.setLayout(new BorderLayout());
+ _suboptCount.add(nbLab,BorderLayout.WEST);
+ _suboptCount.add(_text,BorderLayout.CENTER);
+ _suboptCount.setBackground(Color.decode("#E33729"));
+
+
+ JPanel commands = new JPanel();
+ commands.add(previous);
+ commands.add(next);
+ commands.setBackground(Color.decode("#E33729"));
+
+ JPanel jp = new JPanel();
+ jp.setLayout(new BorderLayout());
+ jp.add(_subopts,BorderLayout.WEST);
+ jp.add(commands,BorderLayout.CENTER);
+ jp.setBackground(Color.decode("#E33729"));
+
+ _suboptBrowser.setLayout(new BorderLayout());
+ _suboptBrowser.add(cooptlab,BorderLayout.WEST);
+ _suboptBrowser.add(jp,BorderLayout.CENTER);
+ _suboptBrowser.setBackground(Color.decode("#E33729"));
+
+ }
+
+
+ /*public void setSelectedIndex(int i)
+ {
+ _selectedIndex = i;
+ RNA rfolded = new RNA();
+ try {
+ rfolded.setRNA(getSeq(), _sols.get(i));
+ rfolded.drawRNARadiate(_vpMaster.getConfig());
+ _vpMaster.showRNAInterpolated(rfolded);
+ } catch (ExceptionUnmatchedClosingParentheses e) {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ } catch (ExceptionFileFormatOrSyntax e) {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ }
+ //_struct.setText(_sols.get(i));
+ formatDescription();
+ }*/
+
+ public void setSelectedIndex(int i)
+ {
+ _selectedIndex = i;
+ RNA rfolded = new RNA();
+ try {
+ rfolded.setRNA(getSeq(), _sols.get(i));
+ RNA target = _vpTarget.getRNA();
+ for(ModeleBase mb: rfolded.get_listeBases())
+ {
+ ModeleBase mbref = target.getBaseAt(mb.getIndex());
+ if (mb.getElementStructure()==mbref.getElementStructure())
+ {
+ mb.getStyleBase().setBaseInnerColor(_okColor);
+ mb.getStyleBase().setBaseNameColor(Color.white);
+ }
+ }
+ for(ModeleBase mb: target.get_listeBases())
+ {
+ ModeleBase mbref = rfolded.getBaseAt(mb.getIndex());
+ if (mb.getElementStructure()==mbref.getElementStructure())
+ {
+ mb.getStyleBase().setBaseInnerColor(_okColor);
+ }
+ else
+ {
+ mb.getStyleBase().setBaseInnerColor(Color.white);
+ }
+ }
+ rfolded.drawRNARadiate(_vpMaster.getConfig());
+ if ((_sols.size()==1)&& (target.getStructDBN().equals(_sols.get(0))))
+ rfolded.setName("Félicitations !");
+ else
+ rfolded.setName("Repliement stable - "+(i+1)+"/"+_sols.size());
+ _vpMaster.showRNAInterpolated(rfolded);
+ _vpTarget.repaint();
+ } catch (ExceptionUnmatchedClosingParentheses e) {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ } catch (ExceptionFileFormatOrSyntax e) {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ }
+ //_struct.setSelectedItem(_sols.get(i));
+ formatDescription();
+ }
+
+// public void setFont(Font f)
+// {
+// super.setFont(f);
+// if(_text!=null)
+// {
+// _text.setFont(f);
+// _text.setOpaque(false);
+// }
+// if(_subopts!=null)
+// {
+// _subopts.setFont(f);
+// _subopts.setOpaque(false);
+// }
+// }
+ public void setInfo(ArrayList<String> sols, BigInteger nbFolds)
+ {
+ _sols = sols;
+ _nbFolds = nbFolds;
+ formatDescription();
+ setSelectedIndex(0);
+ }
+
+ private void formatDescription()
+ {
+ _text.setText(""+_nbFolds);
+ _subopts.setText(""+_sols.size());
+ next.setEnabled(_sols.size()>1);
+ previous.setEnabled(_sols.size()>1);
+
+ }
+
+ }
+
+}