+++ /dev/null
-/*
- VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases.
- Copyright (C) 2008 Kevin Darty, Alain Denise and Yann Ponty.
- electronic mail : Yann.Ponty@lri.fr
- paper mail : LRI, bat 490 Université Paris-Sud 91405 Orsay Cedex France
-
- This file is part of VARNA version 3.1.
- VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License
- as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
-
- VARNA version 3.1 is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY;
- without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
- See the GNU General Public License for more details.
-
- You should have received a copy of the GNU General Public License along with VARNA version 3.1.
- If not, see http://www.gnu.org/licenses.
- */
-package fr.orsay.lri.varna.applications;
-
-import java.awt.BorderLayout;
-import java.awt.Color;
-import java.awt.Dimension;
-import java.awt.Font;
-import java.awt.GridLayout;
-import java.awt.event.ActionEvent;
-import java.awt.event.ActionListener;
-
-import javax.swing.JButton;
-import javax.swing.JFrame;
-import javax.swing.JLabel;
-import javax.swing.JPanel;
-import javax.swing.JTextField;
-
-import fr.orsay.lri.varna.VARNAPanel;
-import fr.orsay.lri.varna.controlers.ControleurInterpolator;
-import fr.orsay.lri.varna.exceptions.ExceptionDrawingAlgorithm;
-import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax;
-import fr.orsay.lri.varna.exceptions.ExceptionModeleStyleBaseSyntaxError;
-import fr.orsay.lri.varna.exceptions.ExceptionNAViewAlgorithm;
-import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
-import fr.orsay.lri.varna.exceptions.ExceptionParameterError;
-import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses;
-import fr.orsay.lri.varna.exceptions.MappingException;
-import fr.orsay.lri.varna.models.VARNAConfig;
-import fr.orsay.lri.varna.models.rna.Mapping;
-import fr.orsay.lri.varna.models.rna.ModeleBase;
-import fr.orsay.lri.varna.models.rna.ModelBaseStyle;
-import fr.orsay.lri.varna.models.rna.RNA;
-
-import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener;;
-
-public class SuperpositionDemo extends JFrame implements InterfaceVARNAListener {
-
- /**
- *
- */
- private static final long serialVersionUID = -790155708306987257L;
-
- private static final String DEFAULT_SEQUENCE1 = "CGCGCACGCGAUAUUUCGCGUCGCGCAUUUGCGCGUAGCGCG";
- private static final String DEFAULT_SEQUENCE2 = "CGCGCACGCGAUAUUUCGCGUCGCGCAUUUGCGCGUAGCGCG";
-
- private static final String DEFAULT_STRUCTURE1 = "(((((.(((((----....----))))).(((((....)))))..)))))";
- private static final String DEFAULT_STRUCTURE2 = "(((((.(((((((((....))))))))).--------------..)))))";
- // private static final String DEFAULT_STRUCTURE1 = "((((....))))";
- // private static final String DEFAULT_STRUCTURE2 =
- // "((((..(((....)))..))))";
-
- private VARNAPanel _vpMaster;
- private VARNAPanel _vpSlave;
-
- private JPanel _tools = new JPanel();
- private JPanel _input = new JPanel();
-
- private JPanel _seqPanel = new JPanel();
- private JPanel _struct1Panel = new JPanel();
- private JPanel _struct2Panel = new JPanel();
- private JLabel _info = new JLabel();
- private JTextField _struct1 = new JTextField(DEFAULT_STRUCTURE1);
- private JTextField _struct2 = new JTextField(DEFAULT_STRUCTURE2);
- private JTextField _seq1 = new JTextField(DEFAULT_SEQUENCE1);
- private JTextField _seq2 = new JTextField(DEFAULT_SEQUENCE2);
- private JLabel _struct1Label = new JLabel(" Str1:");
- private JLabel _struct2Label = new JLabel(" Str2:");
- private JLabel _seqLabel = new JLabel(" Seq:");
- private JButton _goButton = new JButton("Go");
- private JButton _switchButton = new JButton("Switch");
-
- private String _str1Backup = "";
- private String _str2Backup = "";
- private RNA _RNA1 = new RNA();
- private RNA _RNA2 = new RNA();
-
- private static String errorOpt = "error";
- @SuppressWarnings("unused")
- private boolean _error;
-
- private Color _backgroundColor = Color.white;
-
- @SuppressWarnings("unused")
- private int _algoCode;
-
- private int _currentDisplay = 1;
-
- public static ModelBaseStyle createStyle(String txt)
- {
- ModelBaseStyle result = new ModelBaseStyle();
- try {
- result.assignParameters(txt);
- } catch (ExceptionModeleStyleBaseSyntaxError e) {
- // TODO Auto-generated catch block
- e.printStackTrace();
- } catch (ExceptionParameterError e) {
- // TODO Auto-generated catch block
- e.printStackTrace();
- }
- return result;
- }
-
- public void applyTo(VARNAPanel vp, ModelBaseStyle mb, int[] indices)
- {
- for(int i=0;i<indices.length;i++)
- {
- ModeleBase m = vp.getRNA().getBaseAt(indices[i]);
- m.setStyleBase(mb);
- if (m.getElementStructure()!=-1)
- {
- vp.getRNA().getBaseAt(m.getElementStructure()).setStyleBase(mb);
- }
- }
- vp.repaint();
- }
-
-
- public SuperpositionDemo() {
- super();
- try {
- _vpMaster = new VARNAPanel(getText1(), getStruct1());
- _vpSlave = new VARNAPanel(getText2(), getStruct2());
- } catch (ExceptionNonEqualLength e) {
- _vpMaster.errorDialog(e);
- }
- _vpMaster.setPreferredSize(new Dimension(400, 400));
- RNAPanelDemoInit();
- }
-
- private void RNAPanelDemoInit() {
- int marginTools = 40;
-
- setBackground(_backgroundColor);
- _vpMaster.setBackground(_backgroundColor);
- _vpMaster.addVARNAListener(this);
- //_vpSlave.setModifiable(false);
- _vpSlave.setBackground(Color.decode("#F0F0F0"));
-
- _vpMaster.drawRNA(getRNA((_currentDisplay)%2));
- _vpSlave.drawRNA(getRNA((_currentDisplay+1)%2));
-
- /*ModeleStyleBase red = createStyle("label=#ff4d4d,fill=#ffdddd,outline=#ff4d4d");
- int[] ired = {6,7,8,9,10};
- applyTo(_vpMaster, red, ired);
- applyTo(_vpSlave, red, ired);
- ModeleStyleBase blue = createStyle("label=#0000ff,fill=#ddddff,outline=#0000ff");
- int[] iblue = {0,1,2,3,4};
- applyTo(_vpMaster, blue, iblue);
- applyTo(_vpSlave, blue, iblue);
- ModeleStyleBase purple = createStyle("label=#cc00cc,fill=#ffddff,outline=#cc00cc");
- int[] ipurple = {21,22,23,24,25};
- applyTo(_vpMaster, purple, ipurple);
- ModeleStyleBase green = createStyle("label=#009900,fill=#aaeeaa,outline=#009900");
- int[] igreen = {11,12,13,14};
- applyTo(_vpSlave, green, igreen);*/
-
- Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
-
- _seqLabel.setHorizontalTextPosition(JLabel.LEFT);
- _seqLabel.setPreferredSize(new Dimension(marginTools, 15));
- _seq1.setFont(textFieldsFont);
- _seq1.setText(getRNA1().getSeq());
- _seq2.setFont(textFieldsFont);
- _seq2.setText(getRNA2().getSeq());
-
- _goButton.addActionListener(new ActionListener() {
-
- public void actionPerformed(ActionEvent e) {
- _currentDisplay = (_currentDisplay + 1) % 2;
- _vpMaster.drawRNA(getRNA(_currentDisplay));
- _vpSlave.drawRNA(getRNA((_currentDisplay + 1) % 2));
- onStructureRedrawn();
- }
- });
-
- _switchButton.addActionListener(new ActionListener() {
- public void actionPerformed(ActionEvent e) {
- try {
- _currentDisplay = (_currentDisplay + 1) % 2;
-
- Mapping m = Mapping.readMappingFromAlignment(
- getStruct(_currentDisplay), getStruct((_currentDisplay+1)%2));
- Mapping m2 = Mapping.readMappingFromAlignment(
- getStruct((_currentDisplay+1)%2), getStruct(_currentDisplay));
- _vpMaster.showRNAInterpolated(getRNA(_currentDisplay), m);
- _vpSlave.showRNAInterpolated(getRNA((_currentDisplay+1)%2), m2);
- onStructureRedrawn();
- }
- catch (MappingException e3)
- {
- try {
- _vpMaster.drawRNAInterpolated(getText(_currentDisplay),getStruct(_currentDisplay));
- } catch (ExceptionNonEqualLength e1) {
- // TODO Auto-generated catch block
- e1.printStackTrace();
- }
- }
- _vpMaster.repaint();
- _vpSlave.repaint();
- }
- });
-
- _seqPanel.setLayout(new BorderLayout());
- _seqPanel.add(_seqLabel, BorderLayout.WEST);
- _seqPanel.add(_seq1, BorderLayout.CENTER);
-
- _struct1Label.setPreferredSize(new Dimension(marginTools, 15));
- _struct1Label.setHorizontalTextPosition(JLabel.LEFT);
- _struct1.setFont(textFieldsFont);
- _struct1Panel.setLayout(new BorderLayout());
- _struct1Panel.add(_struct1Label, BorderLayout.WEST);
- _struct1Panel.add(_struct1, BorderLayout.CENTER);
-
- _struct2Label.setPreferredSize(new Dimension(marginTools, 15));
- _struct2Label.setHorizontalTextPosition(JLabel.LEFT);
- _struct2.setFont(textFieldsFont);
- _struct2Panel.setLayout(new BorderLayout());
- _struct2Panel.add(_struct2Label, BorderLayout.WEST);
- _struct2Panel.add(_struct2, BorderLayout.CENTER);
-
- _input.setLayout(new GridLayout(3, 0));
- _input.add(_seqPanel);
- _input.add(_struct1Panel);
- _input.add(_struct2Panel);
-
- JPanel goPanel = new JPanel();
- goPanel.setLayout(new BorderLayout());
-
- _tools.setLayout(new BorderLayout());
- _tools.add(_input, BorderLayout.CENTER);
- _tools.add(_info, BorderLayout.SOUTH);
- _tools.add(goPanel, BorderLayout.EAST);
-
- goPanel.add(_goButton, BorderLayout.CENTER);
- goPanel.add(_switchButton, BorderLayout.SOUTH);
-
- getContentPane().setLayout(new BorderLayout());
- JPanel VARNAs = new JPanel();
- VARNAs.setLayout(new GridLayout(1,2));
- VARNAs.add(_vpMaster);
- VARNAs.add(_vpSlave);
- getContentPane().add(VARNAs, BorderLayout.CENTER);
- getContentPane().add(_tools, BorderLayout.SOUTH);
-
- setVisible(true);
-
- _vpMaster.getVARNAUI().UIRadiate();
- _vpSlave.getVARNAUI().UIRadiate();
-
- onStructureRedrawn();
- }
-
- public RNA getMasterRNA()
- {
- return getRNA(_currentDisplay);
- }
-
- public RNA getSlaveRNA1()
- {
- return getRNA((_currentDisplay+1)%2);
- }
-
- public RNA getSlaveRNA2()
- {
- return getRNA((_currentDisplay+2)%2);
- }
-
-
- public RNA getRNA(int i) {
- if (i==0)
- { return getRNA1(); }
- else
- { return getRNA2(); }
- }
-
-
- public RNA getRNA1() {
- if (!_str1Backup.equals(getStruct1())) {
- try {
- _RNA1.setRNA(getText1(), getStruct1());
- _RNA1.drawRNA(_vpMaster.getDrawMode(),_vpMaster.getConfig());
- } catch (ExceptionUnmatchedClosingParentheses e) {
- e.printStackTrace();
- } catch (ExceptionFileFormatOrSyntax e1) {
- _vpMaster.errorDialog(e1);
- } catch (ExceptionDrawingAlgorithm e) {
- // TODO Auto-generated catch block
- e.printStackTrace();
- }
- _str1Backup = getStruct1();
- }
- return _RNA1;
- }
-
- public RNA getRNA2() {
- if (!_str2Backup.equals(getStruct2())) {
- try {
- _RNA2.setRNA(getText2(), getStruct2());
- _RNA2.drawRNA(_vpMaster.getDrawMode(),_vpMaster.getConfig());
- } catch (ExceptionUnmatchedClosingParentheses e) {
- e.printStackTrace();
- } catch (ExceptionFileFormatOrSyntax e1) {
- _vpMaster.errorDialog(e1);
- } catch (ExceptionDrawingAlgorithm e) {
- // TODO Auto-generated catch block
- e.printStackTrace();
- }
- _str2Backup = getStruct2();
- }
- return _RNA2;
- }
-
- public String getText(int i)
- {
- return "";
- }
-
- public String getStruct(int i)
- {
- if (i==0)
- return _struct1.getText();
- else
- return _struct2.getText();
- }
-
-
- public String getText1()
- {
- return _seq1.getText();
- }
-
- public String getText2()
- {
- return _seq2.getText();
- }
-
- public String getStruct1() {
- return cleanStruct(_struct1.getText());
- }
-
- public String getStruct2() {
- return cleanStruct(_struct2.getText());
- }
-
- private String cleanStruct(String struct) {
- struct = struct.replaceAll("[:-]", "");
- return struct;
- }
-
- public String[][] getParameterInfo() {
- String[][] info = {
- // Parameter Name Kind of Value Description,
- { "sequenceDBN", "String", "A raw RNA sequence" },
- { "structureDBN", "String",
- "An RNA structure in dot bracket notation (DBN)" },
- { errorOpt, "boolean", "To show errors" }, };
- return info;
- }
-
- public void init() {
- _vpMaster.setBackground(_backgroundColor);
- _error = true;
- }
-
- @SuppressWarnings("unused")
- private Color getSafeColor(String col, Color def) {
- Color result;
- try {
- result = Color.decode(col);
- } catch (Exception e) {
- try {
- result = Color.getColor(col, def);
- } catch (Exception e2) {
- return def;
- }
- }
- return result;
- }
-
- public VARNAPanel get_varnaPanel() {
- return _vpMaster;
- }
-
- public void set_varnaPanel(VARNAPanel surface) {
- _vpMaster = surface;
- }
-
- public JTextField get_struct() {
- return _struct1;
- }
-
- public void set_struct(JTextField _struct) {
- this._struct1 = _struct;
- }
-
- public JLabel get_info() {
- return _info;
- }
-
- public void set_info(JLabel _info) {
- this._info = _info;
- }
-
- public static void main(String[] args) {
- SuperpositionDemo d = new SuperpositionDemo();
- d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
- d.pack();
- d.setVisible(true);
- }
-
- public void onStructureRedrawn() {
- try{
- Mapping m = Mapping.readMappingFromAlignment(
- this.getStruct((_currentDisplay+1)%2), getStruct((_currentDisplay)%2));
- ControleurInterpolator.moveNearOtherRNA(getRNA((_currentDisplay)%2), getRNA((_currentDisplay+1)%2), m);
- _vpSlave.repaint();
- _vpMaster.repaint();
- }
- catch (MappingException e3) {System.out.println(e3.toString());}
- }
-
- public void onWarningEmitted(String s) {
- // TODO Auto-generated method stub
-
- }
-
- public void onLoad(String path) {
- // TODO Auto-generated method stub
-
- }
-
- public void onLoaded() {
- // TODO Auto-generated method stub
-
- }
-
- public void onUINewStructure(VARNAConfig v, RNA r) {
- // TODO Auto-generated method stub
-
- }
-
- public void onZoomLevelChanged(){
- // TODO Auto-generated method stub
-
- }
-
- public void onTranslationChanged() {
- // TODO Auto-generated method stub
-
- }
-}
git://source.jalview.org / jalview.git / blobdiff