--- /dev/null
+/*
+ VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases.
+ Copyright (C) 2008 Kevin Darty, Alain Denise and Yann Ponty.
+ electronic mail : Yann.Ponty@lri.fr
+ paper mail : LRI, bat 490 Université Paris-Sud 91405 Orsay Cedex France
+
+ This file is part of VARNA version 3.1.
+ VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License
+ as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+
+ VARNA version 3.1 is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY;
+ without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+ See the GNU General Public License for more details.
+
+ You should have received a copy of the GNU General Public License along with VARNA version 3.1.
+ If not, see http://www.gnu.org/licenses.
+ */
+package fr.orsay.lri.varna.views;
+
+import java.awt.BorderLayout;
+import java.awt.Color;
+import java.awt.Dimension;
+import java.awt.event.ActionEvent;
+import java.awt.event.ActionListener;
+import java.util.ArrayList;
+
+import javax.swing.BorderFactory;
+import javax.swing.JPanel;
+import javax.swing.JTextArea;
+import javax.swing.Timer;
+
+import fr.orsay.lri.varna.VARNAPanel;
+import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
+import fr.orsay.lri.varna.models.VARNAConfig;
+
+/**
+ * BH j2s SwingJS replaces thread with simple javax.swing.Timer
+ *
+ */
+public class VueAboutPanel extends JPanel {
+
+ /**
+ *
+ */
+ private static final long serialVersionUID = 4525998278180950602L;
+
+ private AboutAnimator _anim;
+ private JPanel _textPanel;
+ private JTextArea _textArea;
+
+ public VueAboutPanel() {
+ init();
+ }
+
+ private void init() {
+ try {
+ setBorder(BorderFactory.createEtchedBorder());
+ setLayout(new BorderLayout());
+ setBackground(Color.WHITE);
+
+ String message = "VARNA "
+ + VARNAConfig.MAJOR_VERSION
+ + "."
+ + VARNAConfig.MINOR_VERSION
+ + "\n"
+ + "\n"
+ + "Created by: Kevin Darty, Alain Denise and Yann Ponty\n"
+ + "Contact: ponty@lri.fr\n"
+ + "\n"
+ + "VARNA is freely distributed under the terms of the GNU GPL 3.0 license.\n"
+ + "\n"
+ + "Supported by the BRASERO project (ANR-06-BLAN-0045)\n";
+
+ _textArea = new JTextArea();
+ _textArea.setText(message);
+ _textArea.setEditable(false);
+
+ _textPanel = new JPanel();
+ _textPanel.setBackground(Color.WHITE);
+ _textPanel.setLayout(new BorderLayout());
+ _textPanel.setBorder(BorderFactory.createMatteBorder(0, 15, 0, 15,
+ getBackground()));
+ _textPanel.add(_textArea);
+
+ VARNAPanel vp = new VARNAPanel("GGGGAAAACCCC", "((((....))))");
+ vp.setModifiable(false);
+ vp.setPreferredSize(new Dimension(100, 100));
+ // vp.setBorder(BorderFactory.createLineBorder(Color.gray));
+
+ _anim = new AboutAnimator(vp);
+ _anim
+ .addRNA("GGGGAAGGGGAAAACCCCAACCCC",
+ "((((..((((....))))..))))");
+ _anim.addRNA("GGGGAAGGGGAAGGGGAAAACCCCAACCCCAACCCC",
+ "((((..((((..((((....))))..))))..))))");
+ _anim
+ .addRNA(
+ "GGGGAGGGGAAAACCCCAGGGGAGGGGAAAACCCCAGGGGAAAACCCCAGGGGAAAACCCCACCCCAGGGGAAAACCCCACCCC",
+ "((((.((((....)))).((((.((((....)))).((((....)))).((((....)))).)))).((((....)))).))))");
+ _anim
+ .addRNA(
+ "GGGGGGGGAAAACCCCAGGGGAAAACCCCAGGGGGGGGAAAACCCCAGGGGAAAACCCCAGGGGAAAACCCCAGGGGAAAACCCCGGGGAAAACCCCACCCCAGGGGAAAACCCCAGGGGAAAACCCCCCCC",
+ "((((((((....)))).((((....)))).((((((((....)))).((((....)))).((((....)))).((((....))))((((....)))).)))).((((....)))).((((....))))))))");
+ _anim.addRNA("GGGGAAAACCCC", "((((....))))");
+ _anim.addRNA("GGGGAAGGGGAAAACCCCAGGGGAAAACCCCACCCC",
+ "((((..((((....)))).((((....)))).))))");
+ _anim.addRNA("GGGGAGGGGAAAACCCCAGGGGAAAACCCCAGGGGAAAACCCCACCCC",
+ "((((.((((....)))).((((....)))).((((....)))).))))");
+ _anim
+ .addRNA(
+ "GGGGAGGGGAAAAAAACCCCAGGGGAAAAAAACCCCAGGGGAAAAAAACCCCACCCC",
+ "((((.((((.......)))).((((.......)))).((((.......)))).))))");
+ _anim.start();
+
+ add(vp, BorderLayout.WEST);
+ add(_textPanel, BorderLayout.CENTER);
+ } catch (ExceptionNonEqualLength e) {
+ }
+ }
+
+ public void gracefulStop() {
+ _anim.gracefulStop();
+ }
+
+ private class AboutAnimator implements ActionListener {
+ VARNAPanel _vp;
+ ArrayList<String> _structures = new ArrayList<String>();
+ ArrayList<String> _sequences = new ArrayList<String>();
+ int _period = 2000;
+ boolean _over = false;
+
+ public AboutAnimator(VARNAPanel vp) {
+ super();
+ _vp = vp;
+ }
+
+ /**
+ * mode pointer for timer cycle -- DELAY1, TASK, DELAY2, STOP
+ */
+ int mode = 0;
+
+ /**
+ * modes for run()
+ *
+ */
+ final int DELAY1 = 0, TASK = 1, DELAY2 = 2, STOP = 3;
+ int i = 0;
+
+ @Override
+ public void actionPerformed(ActionEvent e) {
+ run();
+ }
+
+ public void start() {
+ int mode = DELAY1;
+ run();
+ }
+
+ public void addRNA(String seq, String str) {
+ _sequences.add(seq);
+ _structures.add(str);
+ }
+
+ public void gracefulStop() {
+ _over = true;
+ }
+
+ public void run() {
+ int initialDelay;
+ if (_over)
+ mode = STOP;
+ switch (mode) {
+ case DELAY1:
+ mode = TASK;
+ initialDelay = _period;
+ break;
+ case TASK:
+ String seq = _sequences.get(i);
+ String str = _structures.get(i);
+ try {
+ _vp.drawRNAInterpolated(seq, str);
+ mode = DELAY2;
+ initialDelay = 500;
+ } catch (ExceptionNonEqualLength e) {
+ initialDelay = -1;
+ }
+ break;
+ case DELAY2:
+ i = (i + 1) % _sequences.size();
+ mode = DELAY1;
+ initialDelay = 0;
+ break;
+ case STOP:
+ default:
+ initialDelay = -1;
+ break;
+ }
+ if (initialDelay >= 0) {
+ Timer t = new Timer(initialDelay, this);
+ t.setDelay(0);
+ t.setRepeats(false);
+ t.start();
+ } else {
+ System.out.println("VueAbout done");
+ }
+
+ }
+ }
+
+}