--- /dev/null
+package fr.orsay.lri.varna.applications;
+
+/*
+VARNA is a Java library for quick automated drawings RNA secondary structure
+Copyright (C) 2007 Yann Ponty
+
+This program is free software:you can redistribute it and/or modify
+it under the terms of the GNU General Public License as published by
+the Free Software Foundation, either version 3 of the License, or
+(at your option) any later version.
+
+This program is distributed in the hope that it will be useful,
+but WITHOUT ANY WARRANTY; without even the implied warranty of
+MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+GNU General Public License for more details.
+
+You should have received a copy of the GNU General Public License
+along with this program. If not, see <http://www.gnu.org/licenses/>.
+*/
+
+import java.awt.BorderLayout;
+import java.awt.Color;
+import java.awt.Dimension;
+import java.awt.Font;
+import java.awt.GridLayout;
+import java.awt.event.ActionEvent;
+import java.awt.event.ActionListener;
+
+import javax.swing.JApplet;
+import javax.swing.JButton;
+import javax.swing.JLabel;
+import javax.swing.JPanel;
+import javax.swing.JTextField;
+
+import fr.orsay.lri.varna.VARNAPanel;
+import fr.orsay.lri.varna.components.VARNAConsole;
+import fr.orsay.lri.varna.controlers.ControleurDemoTextField;
+import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
+import fr.orsay.lri.varna.models.rna.RNA;
+
+/**
+* An RNA 2d Panel demo applet
+*
+* @author Yann Ponty & Darty Kévin
+*
+*/
+
+public class VARNAConsoleDemo extends JApplet implements ActionListener {
+
+ /**
+ *
+ */
+ private static final long serialVersionUID = -790155708306987257L;
+
+ private static final String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA";
+
+ private static final String DEFAULT_STRUCTURE = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...)))))..";
+
+ private VARNAPanel _vp;
+
+ private JPanel _tools = new JPanel();
+ private JPanel _input = new JPanel();
+
+ private JPanel _seqPanel = new JPanel();
+ private JPanel _structPanel = new JPanel();
+ private JLabel _info = new JLabel();
+ private JButton _go = new JButton("Go");
+ private JTextField _struct = new JTextField();
+ private JTextField _seq = new JTextField();
+ private JLabel _structLabel = new JLabel(" Str:");
+ private JLabel _seqLabel = new JLabel(" Seq:");
+
+ private VARNAConsole _console;
+
+ private static String errorOpt = "error";
+ private boolean _error;
+
+ private Color _backgroundColor = Color.white;
+
+ private int _algoCode;
+
+ public VARNAConsoleDemo() {
+ super();
+ try {
+ _vp = new VARNAPanel(_seq.getText(), _struct.getText());
+ _vp.setErrorsOn(false);
+ } catch (ExceptionNonEqualLength e) {
+ _vp.errorDialog(e);
+ }
+ RNAPanelDemoInit();
+ }
+
+ private void RNAPanelDemoInit() {
+
+
+ int marginTools = 40;
+
+ setBackground(_backgroundColor);
+ _vp.setBackground(_backgroundColor);
+
+ try {
+ _vp.getRNA().setRNA(_seq.getText(), _struct.getText());
+ _vp.setErrorsOn(false);
+ } catch (Exception e1) {
+ _vp.errorDialog(e1);
+ }
+
+ Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
+
+ _console = new VARNAConsole(_vp);
+
+
+ _go.addActionListener(this);
+
+ _seqLabel.setHorizontalTextPosition(JLabel.LEFT);
+ _seqLabel.setPreferredSize(new Dimension(marginTools, 15));
+ _seq.setFont(textFieldsFont);
+ _seq.setText(_vp.getRNA().getSeq());
+
+ _seqPanel.setLayout(new BorderLayout());
+ _seqPanel.add(_seqLabel, BorderLayout.WEST);
+ _seqPanel.add(_seq, BorderLayout.CENTER);
+
+ _structLabel.setPreferredSize(new Dimension(marginTools, 15));
+ _structLabel.setHorizontalTextPosition(JLabel.LEFT);
+ _struct.setFont(textFieldsFont);
+ _struct.setText(_vp.getRNA().getStructDBN());
+ _structPanel.setLayout(new BorderLayout());
+ _structPanel.add(_structLabel, BorderLayout.WEST);
+ _structPanel.add(_struct, BorderLayout.CENTER);
+
+
+ _input.setLayout(new GridLayout(3, 0));
+ _input.add(_seqPanel);
+ _input.add(_structPanel);
+
+ _tools.setLayout(new BorderLayout());
+ _tools.add(_input, BorderLayout.CENTER);
+ _tools.add(_info, BorderLayout.SOUTH);
+ _tools.add(_go, BorderLayout.EAST);
+
+ getContentPane().setLayout(new BorderLayout());
+ getContentPane().add(_vp, BorderLayout.CENTER);
+ getContentPane().add(_tools, BorderLayout.SOUTH);
+
+ _vp.getVARNAUI().UIRadiate();
+ setPreferredSize(new Dimension(400,400));
+
+ setVisible(true);
+
+ _console.setVisible(true);
+
+ }
+
+ public String[][] getParameterInfo() {
+ String[][] info = {
+ // Parameter Name Kind of Value Description,
+ { "sequenceDBN", "String", "A raw RNA sequence" },
+ { "structureDBN", "String",
+ "An RNA structure in dot bracket notation (DBN)" },
+ { errorOpt, "boolean", "To show errors" }, };
+ return info;
+ }
+
+ public void init() {
+ retrieveParametersValues();
+ _vp.setBackground(_backgroundColor);
+ _error = true;
+ }
+
+ private Color getSafeColor(String col, Color def) {
+ Color result;
+ try {
+ result = Color.decode(col);
+ } catch (Exception e) {
+ try {
+ result = Color.getColor(col, def);
+ } catch (Exception e2) {
+ return def;
+ }
+ }
+ return result;
+ }
+
+ private String getParameterValue(String key, String def) {
+ String tmp;
+ tmp = getParameter(key);
+ if (tmp == null) {
+ return def;
+ } else {
+ return tmp;
+ }
+ }
+
+ private void retrieveParametersValues() {
+ _error = Boolean.parseBoolean(getParameterValue(errorOpt, "false"));
+ _vp.setErrorsOn(_error);
+ _backgroundColor = getSafeColor(getParameterValue("background",
+ _backgroundColor.toString()), _backgroundColor);
+ _vp.setBackground(_backgroundColor);
+ _seq.setText(getParameterValue("sequenceDBN", ""));
+ _struct.setText(getParameterValue("structureDBN", ""));
+ String _algo = getParameterValue("algorithm", "radiate");
+ if (_algo.equals("circular"))
+ _algoCode = RNA.DRAW_MODE_CIRCULAR;
+ else if (_algo.equals("naview"))
+ _algoCode = RNA.DRAW_MODE_NAVIEW;
+ else if (_algo.equals("line"))
+ _algoCode = RNA.DRAW_MODE_LINEAR;
+ else
+ _algoCode = RNA.DRAW_MODE_RADIATE;
+ if (_seq.getText().equals("") && _struct.getText().equals("")) {
+ _seq.setText(DEFAULT_SEQUENCE);
+ _struct.setText(DEFAULT_STRUCTURE);
+ }
+ try {
+ _vp.drawRNA(_seq.getText(), _struct.getText(), _algoCode);
+ } catch (ExceptionNonEqualLength e) {
+ e.printStackTrace();
+ }
+
+ }
+
+ public VARNAPanel get_varnaPanel() {
+ return _vp;
+ }
+
+ public void set_varnaPanel(VARNAPanel surface) {
+ _vp = surface;
+ }
+
+ public JTextField get_struct() {
+ return _struct;
+ }
+
+ public void set_struct(JTextField _struct) {
+ this._struct = _struct;
+ }
+
+ public JTextField get_seq() {
+ return _seq;
+ }
+
+ public void set_seq(JTextField _seq) {
+ this._seq = _seq;
+ }
+
+ public JLabel get_info() {
+ return _info;
+ }
+
+ public void set_info(JLabel _info) {
+ this._info = _info;
+ }
+
+ public void actionPerformed(ActionEvent arg0) {
+ RNA r = new RNA();
+ try {
+ _vp.drawRNAInterpolated(_seq.getText(), _struct.getText());
+ } catch (ExceptionNonEqualLength e) {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ }
+ _vp.repaint();
+ }
+}