+++ /dev/null
-/*
- VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases.
- Copyright (C) 2008 Kevin Darty, Alain Denise and Yann Ponty.
- electronic mail : Yann.Ponty@lri.fr
- paper mail : LRI, bat 490 Université Paris-Sud 91405 Orsay Cedex France
-
- This file is part of VARNA version 3.1.
- VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License
- as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
-
- VARNA version 3.1 is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY;
- without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
- See the GNU General Public License for more details.
-
- You should have received a copy of the GNU General Public License along with VARNA version 3.1.
- If not, see http://www.gnu.org/licenses.
- */
-package fr.orsay.lri.varna.applications;
-
-/*
- VARNA is a Java library for quick automated drawings RNA secondary structure
- Copyright (C) 2007 Yann Ponty
-
- This program is free software:you can redistribute it and/or modify
- it under the terms of the GNU General Public License as published by
- the Free Software Foundation, either version 3 of the License, or
- (at your option) any later version.
-
- This program is distributed in the hope that it will be useful,
- but WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
- GNU General Public License for more details.
-
- You should have received a copy of the GNU General Public License
- along with this program. If not, see <http://www.gnu.org/licenses/>.
- */
-
-import java.awt.BorderLayout;
-import java.awt.Color;
-import java.awt.Dimension;
-import java.awt.Font;
-import java.awt.GridLayout;
-
-import javax.swing.JApplet;
-import javax.swing.JLabel;
-import javax.swing.JPanel;
-import javax.swing.JTextField;
-
-import fr.orsay.lri.varna.VARNAPanel;
-import fr.orsay.lri.varna.controlers.ControleurDemoTextField;
-import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
-import fr.orsay.lri.varna.models.rna.RNA;
-
-/**
- * An RNA 2d Panel demo applet
- *
- * @author Yann Ponty & Darty Kévin
- *
- */
-
-public class VARNAOnlineDemo extends JApplet {
-
- /**
- *
- */
- private static final long serialVersionUID = -790155708306987257L;
-
- private static final String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA";
-
- private static final String DEFAULT_STRUCTURE = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...)))))..";
-
- private VARNAPanel _vp;
-
- private JPanel _tools = new JPanel();
- private JPanel _input = new JPanel();
-
- private JPanel _seqPanel = new JPanel();
- private JPanel _structPanel = new JPanel();
- private JLabel _info = new JLabel();
- private JTextField _struct = new JTextField();
- private JTextField _seq = new JTextField();
- private JLabel _structLabel = new JLabel(" Str:");
- private JLabel _seqLabel = new JLabel(" Seq:");
-
- private static String errorOpt = "error";
- private boolean _error;
-
- private Color _backgroundColor = Color.white;
-
- private int _algoCode;
-
- public VARNAOnlineDemo() {
- super();
- try {
- _vp = new VARNAPanel(_seq.getText(), _struct.getText());
- _vp.setErrorsOn(false);
- } catch (ExceptionNonEqualLength e) {
- _vp.errorDialog(e);
- }
- RNAPanelDemoInit();
- }
-
- private void RNAPanelDemoInit() {
- int marginTools = 40;
-
- setBackground(_backgroundColor);
- _vp.setBackground(_backgroundColor);
-
- try {
- _vp.getRNA().setRNA(_seq.getText(), _struct.getText());
- _vp.setErrorsOn(false);
- } catch (Exception e1) {
- _vp.errorDialog(e1);
- }
-
- Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
-
- _seqLabel.setHorizontalTextPosition(JLabel.LEFT);
- _seqLabel.setPreferredSize(new Dimension(marginTools, 15));
- _seq.setFont(textFieldsFont);
- _seq.setText(_vp.getRNA().getSeq());
-
- _seqPanel.setLayout(new BorderLayout());
- _seqPanel.add(_seqLabel, BorderLayout.WEST);
- _seqPanel.add(_seq, BorderLayout.CENTER);
-
- _structLabel.setPreferredSize(new Dimension(marginTools, 15));
- _structLabel.setHorizontalTextPosition(JLabel.LEFT);
- _struct.setFont(textFieldsFont);
- _struct.setText(_vp.getRNA().getStructDBN());
- _structPanel.setLayout(new BorderLayout());
- _structPanel.add(_structLabel, BorderLayout.WEST);
- _structPanel.add(_struct, BorderLayout.CENTER);
-
- ControleurDemoTextField controleurTextField = new ControleurDemoTextField(this);
- _seq.addCaretListener(controleurTextField);
- _struct.addCaretListener(controleurTextField);
-
- _input.setLayout(new GridLayout(3, 0));
- _input.add(_seqPanel);
- _input.add(_structPanel);
-
- _tools.setLayout(new BorderLayout());
- _tools.add(_input, BorderLayout.CENTER);
- _tools.add(_info, BorderLayout.SOUTH);
-
- getContentPane().setLayout(new BorderLayout());
- getContentPane().add(_vp, BorderLayout.CENTER);
- getContentPane().add(_tools, BorderLayout.SOUTH);
-
- setVisible(true);
- _vp.getVARNAUI().UIRadiate();
- }
-
- public String[][] getParameterInfo() {
- String[][] info = {
- // Parameter Name Kind of Value Description,
- { "sequenceDBN", "String", "A raw RNA sequence" },
- { "structureDBN", "String",
- "An RNA structure in dot bracket notation (DBN)" },
- { errorOpt, "boolean", "To show errors" }, };
- return info;
- }
-
- public void init() {
- retrieveParametersValues();
- _vp.setBackground(_backgroundColor);
- _error = true;
- }
-
- private Color getSafeColor(String col, Color def) {
- Color result;
- try {
- result = Color.decode(col);
- } catch (Exception e) {
- try {
- result = Color.getColor(col, def);
- } catch (Exception e2) {
- return def;
- }
- }
- return result;
- }
-
- private String getParameterValue(String key, String def) {
- String tmp;
- tmp = getParameter(key);
- if (tmp == null) {
- return def;
- } else {
- return tmp;
- }
- }
-
- private void retrieveParametersValues() {
- _error = Boolean.parseBoolean(getParameterValue(errorOpt, "false"));
- _vp.setErrorsOn(_error);
- _backgroundColor = getSafeColor(getParameterValue("background",
- _backgroundColor.toString()), _backgroundColor);
- _vp.setBackground(_backgroundColor);
- _seq.setText(getParameterValue("sequenceDBN", ""));
- _struct.setText(getParameterValue("structureDBN", ""));
- String _algo = getParameterValue("algorithm", "radiate");
- if (_algo.equals("circular"))
- _algoCode = RNA.DRAW_MODE_CIRCULAR;
- else if (_algo.equals("naview"))
- _algoCode = RNA.DRAW_MODE_NAVIEW;
- else if (_algo.equals("line"))
- _algoCode = RNA.DRAW_MODE_LINEAR;
- else
- _algoCode = RNA.DRAW_MODE_RADIATE;
- if (_seq.getText().equals("") && _struct.getText().equals("")) {
- _seq.setText(DEFAULT_SEQUENCE);
- _struct.setText(DEFAULT_STRUCTURE);
- }
- try {
- _vp.drawRNA(_seq.getText(), _struct.getText(), _algoCode);
- } catch (ExceptionNonEqualLength e) {
- e.printStackTrace();
- }
-
- }
-
- public VARNAPanel get_varnaPanel() {
- return _vp;
- }
-
- public void set_varnaPanel(VARNAPanel surface) {
- _vp = surface;
- }
-
- public JTextField get_struct() {
- return _struct;
- }
-
- public void set_struct(JTextField _struct) {
- this._struct = _struct;
- }
-
- public JTextField get_seq() {
- return _seq;
- }
-
- public void set_seq(JTextField _seq) {
- this._seq = _seq;
- }
-
- public JLabel get_info() {
- return _info;
- }
-
- public void set_info(JLabel _info) {
- this._info = _info;
- }
-}
git://source.jalview.org / jalview.git / blobdiff