Merge branch 'feature/JAL-3063JAXB' into Jalview-BH/JAL-3026-JAL-3063-JAXB

[jalview.git] / test / jalview / datamodel / xdb / embl / EmblTestHelper.java

diff --git a/test/jalview/datamodel/xdb/embl/EmblTestHelper.java b/test/jalview/datamodel/xdb/embl/EmblTestHelper.java
deleted file mode 100644 (file)
index 0c7624f..0000000
--- a/test/jalview/datamodel/xdb/embl/EmblTestHelper.java
+++ /dev/null
@@ -1,81 +0,0 @@
-/*
- * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
- * Copyright (C) $$Year-Rel$$ The Jalview Authors
- * 
- * This file is part of Jalview.
- * 
- * Jalview is free software: you can redistribute it and/or
- * modify it under the terms of the GNU General Public License 
- * as published by the Free Software Foundation, either version 3
- * of the License, or (at your option) any later version.
- *  
- * Jalview is distributed in the hope that it will be useful, but 
- * WITHOUT ANY WARRANTY; without even the implied warranty 
- * of MERCHANTABILITY or FITNESS FOR A PARTICULAR 
- * PURPOSE.  See the GNU General Public License for more details.
- * 
- * You should have received a copy of the GNU General Public License
- * along with Jalview.  If not, see <http://www.gnu.org/licenses/>.
- * The Jalview Authors are detailed in the 'AUTHORS' file.
- */
-package jalview.datamodel.xdb.embl;
-
-import java.io.StringReader;
-
-public class EmblTestHelper
-{
-  // adapted from http://www.ebi.ac.uk/ena/data/view/X07547&display=xml
-  // dna and translations truncated for convenience
-  private static final String TESTDATA = "<?xml version=\"1.0\" encoding=\"UTF-8\" ?>"
-          + "<ROOT>"
-          + "<entry accession=\"X07547\" version=\"1\" entryVersion=\"8\""
-          + " dataClass=\"STD\" taxonomicDivision=\"PRO\""
-          + " moleculeType=\"genomic DNA\" sequenceLength=\"7499\" topology=\"linear\""
-          + " firstPublic=\"1988-11-10\" firstPublicRelease=\"18\""
-          + " lastUpdated=\"1999-02-10\" lastUpdatedRelease=\"58\">"
-          + "<secondaryAccession>X07574</secondaryAccession>"
-          + "<description>C. trachomatis plasmid</description>"
-          + "<keyword>plasmid</keyword><keyword>unidentified reading frame</keyword>"
-          + "<xref db=\"EuropePMC\" id=\"PMC107176\" secondaryId=\"9573186\" />"
-          + "<xref db=\"MD5\" id=\"ac73317\" />"
-          /*
-           * first CDS (range and translation changed to keep test data manageable)
-           */
-          + "<feature name=\"CDS\" location=\"complement(46..57)\">"
-          // test the case of >1 cross-ref to the same database (JAL-2029)
-          + "<xref db=\"UniProtKB/Swiss-Prot\" id=\"B0BCM4\" secondaryId=\"2.1\" />"
-          + "<xref db=\"UniProtKB/Swiss-Prot\" id=\"P0CE20\" />"
-          + "<qualifier name=\"note\"><value>ORF 8 (AA 1-330)</value><value>pickle</value></qualifier>"
-          + "<qualifier name=\"protein_id\"><value>CAA30420.1</value></qualifier>"
-          + "<qualifier name=\"translation\"><value>MLCF</value><evidence>Keith</evidence></qualifier>"
-          + "</feature>"
-          /*
-           * second CDS (range and translation changed to keep test data manageable)
-           */
-          + "<feature name=\"CDS\" location=\"4..15\">"
-          + "<xref db=\"UniProtKB/Swiss-Prot\" id=\"B0BCM3\" />"
-          + "<qualifier name=\"protein_id\"><value>CAA30421.1</value></qualifier>"
-          + "<qualifier name=\"translation\"><value>MSSS</value></qualifier>"
-          + "</feature>"
-          /*
-           * third CDS is made up - has no xref - code should synthesize 
-           * one to an assumed EMBLCDSPROTEIN accession
-           */
-          + "<feature name=\"CDS\" location=\"join(4..6,10..15)\">"
-          + "<qualifier name=\"protein_id\"><value>CAA12345.6</value></qualifier>"
-          + "<qualifier name=\"translation\"><value>MSS</value></qualifier>"
-          + "</feature>"
-          /*
-           * sequence (modified for test purposes)
-           * emulates EMBL XML 1.2 which splits sequence data every 60 characters
-           * see EmblSequence.setSequence
-           */
-          + "<sequence>GGTATGTCCTCTAGTACAAAC\n"
-          + "ACCCCCAATATTGTGATATAATTAAAAACATAGCAT"
-          + "</sequence></entry></ROOT>";
-
-  static EmblFile getEmblFile()
-  {
-    return EmblFile.getEmblFile(new StringReader(TESTDATA));
-  }
-}