help/html/menus/alwcalculate.html

   1 <html>
   2 <!--
   3  * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
   4  * Copyright (C) $$Year-Rel$$ The Jalview Authors
   5  *
   6  * This file is part of Jalview.
   7  *
   8  * Jalview is free software: you can redistribute it and/or
   9  * modify it under the terms of the GNU General Public License
  10  * as published by the Free Software Foundation, either version 3
  11  * of the License, or (at your option) any later version.
  12  *
  13  * Jalview is distributed in the hope that it will be useful, but
  14  * WITHOUT ANY WARRANTY; without even the implied warranty
  15  * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
  16  * PURPOSE.  See the GNU General Public License for more details.
  17  *
  18  * You should have received a copy of the GNU General Public License
  19  * along with Jalview.  If not, see <http://www.gnu.org/licenses/>.
  20  * The Jalview Authors are detailed in the 'AUTHORS' file.
  21  -->
  22 <head>
  23 <title>Alignment Window Menus</title>
  24 </head>
  25
  26 <body>
  27   <p>
  28     <strong>Alignment Window Calculate Menu</strong>
  29   </p>
  30   <ul>
  31     <li><strong>Sort </strong>
  32       <ul>
  33         <li><strong>By ID</strong><em><br> This will sort
  34             the sequences according to sequence name. If the sort is
  35             repeated, the order of the sorted sequences will be
  36             inverted. </em></li>
  37         <li><strong>By Length</strong><em><br> This will
  38             sort the sequences according to their length (excluding gap
  39             characters). If the sort is repeated, the order of the
  40             sorted sequences will be inverted. </em></li>
  41         <li><strong>By Group</strong><strong><br> </strong><em>This
  42             will sort the sequences according to sequence name. If the
  43             sort is repeated, the order of the sorted sequences will be
  44             inverted. </em><strong></strong></li>
  45         <li><strong>By Pairwise Identity<br>
  46         </strong><em>This will sort the selected sequences by their
  47             percentage identity to the consensus sequence. The most
  48             similar sequence is put at the top. </em></li>
  49         <li><em>The <a href="../calculations/sorting.html">Sort
  50               menu</a> will have some additional options if the alignment
  51             has any associated score annotation, or you have just done a
  52             multiple alignment calculation or opened a tree viewer
  53             window.
  54         </em><br></li>
  55       </ul></li>
  56     <li><strong>Calculate Tree </strong> <br> <em>Functions
  57         for calculating trees on the alignment or the currently selected
  58         region. See <a href="../calculations/tree.html">calculating
  59           trees</a>.
  60     </em>
  61       <ul>
  62         <li><strong>Neighbour Joining Using PAM250<br>
  63         </strong></li>
  64         <li><strong>Neighbour Joining Using Sequence
  65             Feature Similarity</strong></li>
  66         <li><strong>Neighbour Joining Using Blosum62<br>
  67         </strong></li>
  68         <li><strong>Neighbour Joining Using % Identity</strong></li>
  69         <li><strong>Average Distance Using PAM250<br>
  70         </strong></li>
  71         <li><strong>Average Distance Using Sequence
  72             Feature Similarity</strong></li>
  73         <li><strong>Average Distance Using Blosum62</strong></li>
  74         <li><strong>Average Distance Using % Identity</strong></li>
  75       </ul></li>
  76     <li><strong>Pairwise Alignments</strong><br> <em>Applies
  77         Smith and Waterman algorithm to selected sequences. See <a
  78         href="../calculations/pairwise.html">pairwise
  79           alignments</a>.
  80     </em><br></li>
  81     <li><strong>Principal Component Analysis</strong><br> <em>Shows
  82         a spatial clustering of the sequences based on similarity scores
  83         calculated over the alignment.. See <a
  84         href="../calculations/pca.html">Principal Component
  85           Analysis</a>.
  86     </em> <br></li>
  87     <li><strong>Extract Scores ... (optional)</strong><br> <em>This
  88         option is only visible if Jalview detects one or more
  89         white-space separated values in the description line of the
  90         alignment sequences.<br> When selected, these numbers are
  91         parsed into sequence associated annotation which can then be
  92         used to sort the alignment via the Sort by&#8594;Score menu.
  93     </em> <br></li>
  94     <li><strong>Translate as cDNA</strong> (not applet)<br> <em>This
  95         option is visible for nucleotide alignments. Selecting this
  96         option shows the DNA's calculated protein product in a new <a
  97         href="../features/splitView.html">split frame</a> window. Note
  98         that the translation is not frame- or intron-aware; it simply
  99         translates all codons in each sequence, using the standard <a
 100         href="../misc/geneticCode.html">genetic code</a> (any incomplete
 101         final codon is discarded). You can perform this action on the
 102         whole alignment, or selected rows, columns, or regions.
 103     </em> <br></li>
 104     <li><strong>Reverse, Reverse Complement</strong> (not applet)<br>
 105       <em>These options are visible for nucleotide alignments.
 106         Selecting them adds the reverse (or reverse complement) of the
 107         sequences (or selected region) as new sequences in the
 108         alignment. To try this out, add this sequence and perform
 109         'Reverse Complement' followed by 'Translate as cDNA': <br>
 110       <small> Seq
 111           GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC
 112           TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG</small>
 113     </em> <br></li>
 114     <li><strong>Get Cross-References</strong> (not applet)<br>
 115       <em>This option is visible where sequences have
 116         cross-references to other standard databases; for example, an
 117         EMBL entry may have cross-references to one or more UNIPROT
 118         entries. Select the database to view all cross-referenced
 119         sequences in a new <a href="../features/splitView.html">split
 120           frame</a> window.
 121     </em> <br></li>
 122     <li><strong>Autocalculate Consensus</strong><br> <em>For
 123         large alignments it can be useful to deselect
 124         &quot;Autocalculate Consensus&quot; when editing. This prevents
 125         the sometimes lengthy calculations performed after each sequence
 126         edit.</em> <br></li>
 127     <li><strong>Sort Alignment With New Tree</strong><br> <em>If
 128         this option is selected, the alignment will be automatically
 129         sorted whenever a new tree is calculated or loaded.</em> <br></li>
 130     <li><strong>Show Flanking Regions</strong><br> <em>Opens
 131         a new alignment window showing any additional sequence data
 132         either side of the current alignment. Useful in conjunction with
 133         'Fetch Database References' when the 'Trim Retrieved Sequences'
 134         option is disabled to retrieve full length sequences for a set
 135         of aligned peptides. </em></li>
 136   </ul>
 137 </body>
 138 </html>