3 * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
4 * Copyright (C) $$Year-Rel$$ The Jalview Authors
6 * This file is part of Jalview.
8 * Jalview is free software: you can redistribute it and/or
9 * modify it under the terms of the GNU General Public License
10 * as published by the Free Software Foundation, either version 3
11 * of the License, or (at your option) any later version.
13 * Jalview is distributed in the hope that it will be useful, but
14 * WITHOUT ANY WARRANTY; without even the implied warranty
15 * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
16 * PURPOSE. See the GNU General Public License for more details.
18 * You should have received a copy of the GNU General Public License
19 * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
20 * The Jalview Authors are detailed in the 'AUTHORS' file.
23 <title>Alignment Window Menus</title>
28 <strong>Alignment Window Calculate Menu</strong>
31 <li><strong>Sort </strong>
33 <li><strong>By ID</strong><em><br> This will sort
34 the sequences according to sequence name. If the sort is
35 repeated, the order of the sorted sequences will be
37 <li><strong>By Length</strong><em><br> This will
38 sort the sequences according to their length (excluding gap
39 characters). If the sort is repeated, the order of the
40 sorted sequences will be inverted. </em></li>
41 <li><strong>By Group</strong><strong><br> </strong><em>This
42 will sort the sequences according to sequence name. If the
43 sort is repeated, the order of the sorted sequences will be
44 inverted. </em><strong></strong></li>
45 <li><strong>By Pairwise Identity<br>
46 </strong><em>This will sort the selected sequences by their
47 percentage identity to the consensus sequence. The most
48 similar sequence is put at the top. </em></li>
49 <li><em>The <a href="../calculations/sorting.html">Sort
50 menu</a> will have some additional options if the alignment
51 has any associated score annotation, or you have just done a
52 multiple alignment calculation or opened a tree viewer
56 <li><strong>Calculate Tree or PCA ...</strong> <br> <em>Opens the
57 <a href="../calculations/calculations.html">calculations dialog</a> for
58 for calculating <a href="../calculations/tree.html">trees</a> or
59 <a href="../calculations/pca.html">principle component analysis
60 plots</a> on the alignment or the currently selected
64 <li><strong>Pairwise Alignments</strong><br> <em>Applies
65 Smith and Waterman algorithm to selected sequences. See <a
66 href="../calculations/pairwise.html">pairwise
69 <li><strong>Extract Scores ... (optional)</strong><br> <em>This
70 option is only visible if Jalview detects one or more
71 white-space separated values in the description line of the
72 alignment sequences.<br> When selected, these numbers are
73 parsed into sequence associated annotation which can then be
74 used to sort the alignment via the Sort by→Score menu.
76 <li><strong>Translate as cDNA</strong> (not applet)<br> <em>This
77 option is visible for nucleotide alignments. Selecting this
78 option shows the DNA's calculated protein product in a new <a
79 href="../features/splitView.html">split frame</a> window. Note
80 that the translation is not frame- or intron-aware; it simply
81 translates all codons in each sequence, using the standard <a
82 href="../misc/geneticCode.html">genetic code</a> (any incomplete
83 final codon is discarded). You can perform this action on the
84 whole alignment, or selected rows, columns, or regions.
86 <li><strong>Reverse, Reverse Complement</strong> (not applet)<br>
87 <em>These options are visible for nucleotide alignments.
88 Selecting them adds the reverse (or reverse complement) of the
89 sequences (or selected region) as new sequences in the
90 alignment. To try this out, add this sequence and perform
91 'Reverse Complement' followed by 'Translate as cDNA': <br>
93 GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC
94 TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG</small>
96 <li><strong>Get Cross-References</strong> (not applet)<br>
97 <em>This option is visible where sequences have
98 cross-references to other standard databases; for example, an
99 EMBL entry may have cross-references to one or more UNIPROT
100 entries. Select the database to view all cross-referenced
101 sequences in a new <a href="../features/splitView.html">split
104 <li><strong>Autocalculate Consensus</strong><br> <em>For
105 large alignments it can be useful to deselect
106 "Autocalculate Consensus" when editing. This prevents
107 the sometimes lengthy calculations performed after each sequence
109 <li><strong>Sort Alignment With New Tree</strong><br> <em>If
110 this option is selected, the alignment will be automatically
111 sorted whenever a new tree is calculated or loaded.</em> <br></li>
112 <li><strong>Show Flanking Regions</strong><br> <em>Opens
113 a new alignment window showing any additional sequence data
114 either side of the current alignment. Useful in conjunction with
115 'Fetch Database References' when the 'Trim Retrieved Sequences'
116 option is disabled to retrieve full length sequences for a set
117 of aligned peptides. </em></li>