2 * Jalview - A Sequence Alignment Editor and Viewer (Version 2.6)
3 * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
5 * This file is part of Jalview.
7 * Jalview is free software: you can redistribute it and/or
8 * modify it under the terms of the GNU General Public License
9 * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
11 * Jalview is distributed in the hope that it will be useful, but
12 * WITHOUT ANY WARRANTY; without even the implied warranty
13 * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
14 * PURPOSE. See the GNU General Public License for more details.
16 * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
20 import java.awt.BorderLayout;
21 import java.awt.Color;
22 import java.awt.Component;
23 import java.awt.Dimension;
25 import java.awt.GridLayout;
26 import java.awt.datatransfer.DataFlavor;
27 import java.awt.datatransfer.Transferable;
28 import java.awt.dnd.DnDConstants;
29 import java.awt.dnd.DropTarget;
30 import java.awt.dnd.DropTargetDragEvent;
31 import java.awt.dnd.DropTargetDropEvent;
32 import java.awt.dnd.DropTargetEvent;
33 import java.awt.dnd.DropTargetListener;
34 import java.awt.event.ActionEvent;
35 import java.awt.event.ActionListener;
36 import java.awt.event.ComponentEvent;
37 import java.awt.event.MouseEvent;
38 import java.awt.event.MouseListener;
40 import java.text.DateFormat;
41 import java.util.ArrayList;
42 import java.util.Date;
43 import java.util.List;
45 import javax.swing.DefaultListModel;
46 import javax.swing.DefaultListSelectionModel;
47 import javax.swing.Icon;
48 import javax.swing.JButton;
49 import javax.swing.JFrame;
50 import javax.swing.JLabel;
51 import javax.swing.JList;
52 import javax.swing.JOptionPane;
53 import javax.swing.JPanel;
54 import javax.swing.JScrollPane;
55 import javax.swing.JSplitPane;
56 import javax.swing.JTextField;
57 import javax.swing.ListModel;
58 import javax.swing.ListSelectionModel;
59 import javax.swing.UIManager;
60 import javax.swing.UnsupportedLookAndFeelException;
61 import javax.swing.event.ListSelectionEvent;
62 import javax.swing.event.ListSelectionListener;
64 import fr.orsay.lri.varna.VARNAPanel;
65 import fr.orsay.lri.varna.components.ReorderableJList;
66 import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax;
67 import fr.orsay.lri.varna.exceptions.ExceptionLoadingFailed;
68 import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
69 import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses;
70 import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener;
71 import fr.orsay.lri.varna.models.FullBackup;
72 import fr.orsay.lri.varna.models.VARNAConfig;
73 import fr.orsay.lri.varna.models.rna.Mapping;
74 import fr.orsay.lri.varna.models.rna.RNA;
76 public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding implements DropTargetListener, InterfaceVARNAListener, MouseListener {
81 //private static final long serialVersionUID = -790155708306987257L;
83 private String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA";
84 private String DEFAULT_STRUCTURE1 = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...)))))..";
85 private String DEFAULT_STRUCTURE2 = "..(((((...(((((...(((((........(((((...(((((.....)))))...)))))..................))))).....)))))...)))))..";
88 protected JPanel _tools = new JPanel();
89 private JPanel _input = new JPanel();
91 private JPanel _seqPanel = new JPanel();
92 private JPanel _strPanel = new JPanel();
93 private JLabel _info = new JLabel();
94 private JTextField _str = new JTextField();
95 private JTextField _seq = new JTextField();
96 private JLabel _strLabel = new JLabel(" Str:");
97 private JLabel _seqLabel = new JLabel(" Seq:");
98 private JButton _createButton = new JButton("Create");
99 private JButton _updateButton = new JButton("Update");
100 private JButton _deleteButton = new JButton("Delete");
101 private JButton _duplicateButton = new JButton("Snapshot");
103 protected JPanel _listPanel = new JPanel();
104 private ReorderableJList _sideList = null;
107 private static String errorOpt = "error";
108 @SuppressWarnings("unused")
109 private boolean _error;
111 private Color _backgroundColor = Color.white;
113 private static int _nextID = 1;
114 @SuppressWarnings("unused")
115 private int _algoCode;
117 private BackupHolder _rnaList;
120 /*public AppVarnaBinding() {
121 //super("VARNA in Jalview");
122 //this.set_seq("ATGC");
123 //this.set_str(".().");
124 //RNAPanelDemoInit();
126 //initVarna("ATGCATGATATATATATAT","....((((...))))....");
127 initVarna(this.DEFAULT_SEQUENCE,this.DEFAULT_STRUCTURE1);
130 public AppVarnaBinding(String seq,String struc){
131 //super("VARNA in Jalview");
132 initVarna(seq,struc);
135 public AppVarnaBinding(ArrayList<RNA> rnaList){
136 //super("VARNA in Jalview");
137 initVarnaEdit(rnaList);
142 private void initVarna(String seq, String str){
143 DefaultListModel dlm = new DefaultListModel();
145 DefaultListSelectionModel m = new DefaultListSelectionModel();
146 m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
147 m.setLeadAnchorNotificationEnabled(false);
149 _sideList = new ReorderableJList();
150 _sideList.setModel(dlm);
151 _sideList.addMouseListener(this);
152 _sideList.setSelectionModel(m);
153 _sideList.setPreferredSize(new Dimension(100, 0));
154 _sideList.addListSelectionListener( new ListSelectionListener(){
155 public void valueChanged(ListSelectionEvent arg0) {
156 if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
158 FullBackup sel = (FullBackup) _sideList.getSelectedValue();
159 Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA().getSize(), sel.rna.getSize());
160 vp.showRNAInterpolated(sel.rna,sel.config,map);
161 _seq.setText(sel.rna.getSeq());
162 _str.setText(sel.rna.getStructDBN());
167 _rnaList = new BackupHolder(dlm,_sideList);
168 RNA _RNA1 = new RNA("User defined 1");
171 vp = new VARNAPanel("0",".");
172 _RNA1.setRNA(seq, str);
173 _RNA1.drawRNARadiate(vp.getConfig());
174 } catch (ExceptionNonEqualLength e) {
176 } catch (ExceptionUnmatchedClosingParentheses e2) {
177 e2.printStackTrace();
178 } catch (ExceptionFileFormatOrSyntax e3) {
179 e3.printStackTrace();
181 vp.setPreferredSize(new Dimension(400, 400));
182 _rnaList.add(vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
184 //TODO setBackground(_backgroundColor);
185 vp.setBackground(_backgroundColor);
187 //TODO getContentPane().setLayout(new BorderLayout());
188 //TODO getContentPane().add(vp, BorderLayout.CENTER);
191 vp.addVARNAListener(this);
194 private void initVarnaEdit(ArrayList<RNA> rnaInList)
196 DefaultListModel dlm = new DefaultListModel();
199 int marginTools = 40;
201 DefaultListSelectionModel m = new DefaultListSelectionModel();
202 m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
203 m.setLeadAnchorNotificationEnabled(false);
206 _sideList = new ReorderableJList();
207 _sideList.setModel(dlm);
208 _sideList.addMouseListener(this);
209 _sideList.setSelectionModel(m);
210 _sideList.setPreferredSize(new Dimension(100, 0));
211 _sideList.addListSelectionListener( new ListSelectionListener(){
212 public void valueChanged(ListSelectionEvent arg0) {
213 //System.out.println(arg0);
214 if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
216 FullBackup sel = (FullBackup) _sideList.getSelectedValue();
217 Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA().getSize(), sel.rna.getSize());
218 vp.showRNAInterpolated(sel.rna,sel.config,map);
219 //_seq.setText(sel.rna.getSeq());
220 _str.setText(sel.rna.getStructDBN());
224 _rnaList = new BackupHolder(dlm,_sideList);
227 vp = new VARNAPanel("0",".");
228 for(int i=0;i<rnaInList.size();i++){
229 rnaInList.get(i).drawRNARadiate(vp.getConfig());
231 } catch (ExceptionNonEqualLength e) {
234 vp.setPreferredSize(new Dimension(400, 400));
235 for(int i=0;i<rnaInList.size();i++){
236 if(i<rnaInList.size()-1){
237 _rnaList.add(vp.getConfig().clone(),rnaInList.get(i),rnaInList.get(i).getName());
239 _rnaList.add(vp.getConfig().clone(),rnaInList.get(i),rnaInList.get(i).getName(),true);
243 /*_rnaList.add(vp.getConfig().clone(),_RNA2,generateDefaultName());
244 _rnaList.add(vp.getConfig().clone(),_RNA1,generateDefaultName(),true);*/
246 JScrollPane listScroller = new JScrollPane(_sideList);
247 listScroller.setPreferredSize(new Dimension(150, 0));
249 vp.setBackground(_backgroundColor);
252 Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
254 //_seqLabel.setHorizontalTextPosition(JLabel.LEFT);
255 //_seqLabel.setPreferredSize(new Dimension(marginTools, 15));
256 _seq.setFont(textFieldsFont);
257 _seq.setText(rnaInList.get(0).getSeq());
259 _updateButton.addActionListener(new ActionListener() {
260 public void actionPerformed(ActionEvent e) {
261 FullBackup sel = (FullBackup) _sideList.getSelectedValue();
262 sel.rna.setSequence("A");
266 //_seqPanel.setLayout(new BorderLayout());
267 //_seqPanel.add(_seqLabel, BorderLayout.WEST);
268 //_seqPanel.add(_seq, BorderLayout.CENTER);
270 _strLabel.setPreferredSize(new Dimension(marginTools, 15));
271 _strLabel.setHorizontalTextPosition(JLabel.LEFT);
272 _str.setFont(textFieldsFont);
273 _strPanel.setLayout(new BorderLayout());
274 _strPanel.add(_strLabel, BorderLayout.WEST);
275 _strPanel.add(_str, BorderLayout.CENTER);
277 _input.setLayout(new GridLayout(1, 0));
278 //_input.add(_seqPanel);
279 _input.add(_strPanel);
281 JPanel goPanel = new JPanel();
282 goPanel.setLayout(new BorderLayout());
284 _tools.setLayout(new BorderLayout());
285 _tools.add(_input, BorderLayout.CENTER);
286 //_tools.add(_info, BorderLayout.SOUTH);
287 _tools.add(goPanel, BorderLayout.EAST);
289 /*_deleteButton.addActionListener(new ActionListener() {
290 public void actionPerformed(ActionEvent e) {
291 _rnaList.removeSelected();
294 _duplicateButton.addActionListener(new ActionListener() {
295 public void actionPerformed(ActionEvent e) {
296 _rnaList.add((VARNAConfig)vp.getConfig().clone(),vp.getRNA().clone(),vp.getRNA().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new Date()),true);
299 goPanel.add(_updateButton, BorderLayout.CENTER);
302 JPanel ops = new JPanel();
303 ops.setLayout(new GridLayout(1,2));
304 ops.add(_deleteButton);
305 ops.add(_duplicateButton);
307 JLabel j = new JLabel("Structures Manager",JLabel.CENTER);
308 _listPanel.setLayout(new BorderLayout());
310 _listPanel.add(ops,BorderLayout.SOUTH);
311 _listPanel.add(j,BorderLayout.NORTH);
312 _listPanel.add(listScroller,BorderLayout.CENTER);
316 //JSplitPane split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,vp);
318 getContentPane().setLayout(new BorderLayout());
319 getContentPane().add(split, BorderLayout.CENTER);
320 getContentPane().add(_tools, BorderLayout.NORTH);
323 //TODO setVisible(true);
324 DropTarget dt = new DropTarget(vp, this);
326 vp.addVARNAListener(this);
329 public JPanel getTools(){
333 public JPanel getListPanel(){
338 * TODO: Is it effective to transfer the whole RNA?
339 * @return Currently selected RNA
341 public RNA getSelectedRNA(){
342 return _rnaList.getElementAt(_sideList.getSelectedIndex()).rna;
346 * Substitute currently selected RNA with the edited one
349 public void updateSelectedRNA(RNA rnaEdit){
355 private void RNAPanelDemoInit()
357 DefaultListModel dlm = new DefaultListModel();
360 int marginTools = 40;
362 DefaultListSelectionModel m = new DefaultListSelectionModel();
363 m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
364 m.setLeadAnchorNotificationEnabled(false);
367 _sideList = new ReorderableJList();
368 _sideList.setModel(dlm);
369 _sideList.addMouseListener(this);
370 _sideList.setSelectionModel(m);
371 _sideList.setPreferredSize(new Dimension(100, 0));
372 _sideList.addListSelectionListener( new ListSelectionListener(){
373 public void valueChanged(ListSelectionEvent arg0) {
374 //System.out.println(arg0);
375 if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
377 FullBackup sel = (FullBackup) _sideList.getSelectedValue();
378 Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA().getSize(), sel.rna.getSize());
379 vp.showRNAInterpolated(sel.rna,sel.config,map);
380 _seq.setText(sel.rna.getSeq());
381 _str.setText(sel.rna.getStructDBN());
386 _rnaList = new BackupHolder(dlm,_sideList);
387 RNA _RNA1 = new RNA("User defined 1");
388 RNA _RNA2 = new RNA("User defined 2");
390 vp = new VARNAPanel("0",".");
391 _RNA1.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE1);
392 _RNA1.drawRNARadiate(vp.getConfig());
393 _RNA2.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE2);
394 _RNA2.drawRNARadiate(vp.getConfig());
395 } catch (ExceptionNonEqualLength e) {
397 } catch (ExceptionUnmatchedClosingParentheses e2) {
398 e2.printStackTrace();
399 } catch (ExceptionFileFormatOrSyntax e3) {
400 e3.printStackTrace();
402 vp.setPreferredSize(new Dimension(400, 400));
403 _rnaList.add(vp.getConfig().clone(),_RNA2,generateDefaultName());
404 _rnaList.add(vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
406 JScrollPane listScroller = new JScrollPane(_sideList);
407 listScroller.setPreferredSize(new Dimension(150, 0));
409 setBackground(_backgroundColor);
410 vp.setBackground(_backgroundColor);
413 Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
415 _seqLabel.setHorizontalTextPosition(JLabel.LEFT);
416 _seqLabel.setPreferredSize(new Dimension(marginTools, 15));
417 _seq.setFont(textFieldsFont);
418 _seq.setText(DEFAULT_SEQUENCE);
420 _createButton.addActionListener(new ActionListener() {
421 public void actionPerformed(ActionEvent e) {
423 RNA nRNA = new RNA(generateDefaultName());
424 nRNA.setRNA(_seq.getText(), _str.getText());
425 nRNA.drawRNARadiate(vp.getConfig());
426 _rnaList.add(new VARNAConfig(),nRNA,true);
427 } catch (ExceptionUnmatchedClosingParentheses e1) {
428 JOptionPane.showMessageDialog(vp, e1.getMessage(),"Error", JOptionPane.ERROR_MESSAGE);
429 } catch (ExceptionFileFormatOrSyntax e1) {
430 JOptionPane.showMessageDialog(vp, e1.getMessage(),"Error", JOptionPane.ERROR_MESSAGE);
436 _seqPanel.setLayout(new BorderLayout());
437 _seqPanel.add(_seqLabel, BorderLayout.WEST);
438 _seqPanel.add(_seq, BorderLayout.CENTER);
440 _strLabel.setPreferredSize(new Dimension(marginTools, 15));
441 _strLabel.setHorizontalTextPosition(JLabel.LEFT);
442 _str.setFont(textFieldsFont);
443 _strPanel.setLayout(new BorderLayout());
444 _strPanel.add(_strLabel, BorderLayout.WEST);
445 _strPanel.add(_str, BorderLayout.CENTER);
447 _input.setLayout(new GridLayout(2, 0));
448 _input.add(_seqPanel);
449 _input.add(_strPanel);
451 JPanel goPanel = new JPanel();
452 goPanel.setLayout(new BorderLayout());
454 _tools.setLayout(new BorderLayout());
455 _tools.add(_input, BorderLayout.CENTER);
456 _tools.add(_info, BorderLayout.SOUTH);
457 _tools.add(goPanel, BorderLayout.EAST);
459 _deleteButton.addActionListener(new ActionListener() {
460 public void actionPerformed(ActionEvent e) {
461 _rnaList.removeSelected();
464 _duplicateButton.addActionListener(new ActionListener() {
465 public void actionPerformed(ActionEvent e) {
466 _rnaList.add((VARNAConfig)vp.getConfig().clone(),vp.getRNA().clone(),vp.getRNA().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new Date()),true);
469 JPanel ops = new JPanel();
470 ops.setLayout(new GridLayout(1,2));
471 ops.add(_deleteButton);
472 ops.add(_duplicateButton);
474 JLabel j = new JLabel("Structures Manager",JLabel.CENTER);
475 _listPanel.setLayout(new BorderLayout());
477 _listPanel.add(ops,BorderLayout.SOUTH);
478 _listPanel.add(j,BorderLayout.NORTH);
479 _listPanel.add(listScroller,BorderLayout.CENTER);
481 goPanel.add(_createButton, BorderLayout.CENTER);
483 JSplitPane split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,vp);
484 getContentPane().setLayout(new BorderLayout());
485 getContentPane().add(split, BorderLayout.CENTER);
486 getContentPane().add(_tools, BorderLayout.NORTH);
489 DropTarget dt = new DropTarget(vp, this);
491 vp.addVARNAListener(this);
494 public static String generateDefaultName()
496 return "User file #"+_nextID++;
499 public RNA getRNA() {
500 return (RNA)_sideList.getSelectedValue();
505 public String[][] getParameterInfo() {
507 // Parameter Name Kind of Value Description,
508 { "sequenceDBN", "String", "A raw RNA sequence" },
509 { "structureDBN", "String",
510 "An RNA structure in dot bracket notation (DBN)" },
511 { errorOpt, "boolean", "To show errors" }, };
516 vp.setBackground(_backgroundColor);
520 @SuppressWarnings("unused")
521 private Color getSafeColor(String col, Color def) {
524 result = Color.decode(col);
525 } catch (Exception e) {
527 result = Color.getColor(col, def);
528 } catch (Exception e2) {
535 public VARNAPanel get_varnaPanel() {
539 public void set_varnaPanel(VARNAPanel surface) {
544 public String get_seq() {
545 return _seq.getText();
548 public void set_seq(String _seq) {
549 this._seq.setText(_seq);
552 public String get_str(){
553 return _str.getText();
556 public void set_str(String _str){
557 this._str.setText(_str);
560 public JLabel get_info() {
564 public void set_info(JLabel _info) {
568 /*public static void main(String[] args) {
569 AppVarnaBinding d = new AppVarnaBinding();
570 d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
576 public void dragEnter(DropTargetDragEvent arg0) {
577 // TODO Auto-generated method stub
581 public void dragExit(DropTargetEvent arg0) {
582 // TODO Auto-generated method stub
586 public void dragOver(DropTargetDragEvent arg0) {
587 // TODO Auto-generated method stub
591 public void drop(DropTargetDropEvent dtde) {
593 Transferable tr = dtde.getTransferable();
594 DataFlavor[] flavors = tr.getTransferDataFlavors();
595 for (int i = 0; i < flavors.length; i++) {
596 if (flavors[i].isFlavorJavaFileListType()) {
597 dtde.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
598 Object ob = tr.getTransferData(flavors[i]);
599 if (ob instanceof List)
601 List list = (List) ob;
602 for (int j = 0; j < list.size(); j++) {
603 Object o = list.get(j);
605 if (dtde.getSource() instanceof DropTarget)
607 DropTarget dt = (DropTarget) dtde.getSource();
608 Component c = dt.getComponent();
609 if (c instanceof VARNAPanel)
611 String path = o.toString();
612 VARNAPanel vp = (VARNAPanel) c;
614 FullBackup bck = VARNAPanel.importSession(path);
615 _rnaList.add(bck.config, bck.rna,bck.name,true);
617 catch (ExceptionLoadingFailed e3)
621 r.drawRNA(vp.getConfig());
622 String name =r.getName();
625 name = path.substring(path.lastIndexOf(File.separatorChar)+1);
627 _rnaList.add(vp.getConfig().clone(),r,name,true);
633 // If we made it this far, everything worked.
634 dtde.dropComplete(true);
638 // Hmm, the user must not have dropped a file list
640 } catch (Exception e) {
647 public void dropActionChanged(DropTargetDragEvent arg0) {
650 private class BackupHolder{
651 private DefaultListModel _rnaList;
652 private ArrayList<RNA> _rnas = new ArrayList<RNA>();
655 public BackupHolder(DefaultListModel rnaList, JList l)
661 public void add(VARNAConfig c, RNA r)
663 add(c, r, r.getName(),false);
666 public void add(VARNAConfig c, RNA r,boolean select)
668 add(c, r, r.getName(),select);
671 public void add(VARNAConfig c, RNA r, String name)
673 add(c, r, name,false);
675 public void add(VARNAConfig c, RNA r, String name, boolean select)
678 _l.removeSelectionInterval(0, _rnaList.size());
682 name = generateDefaultName();
684 FullBackup bck = new FullBackup(c,r,name);
688 _l.setSelectedIndex(0);
692 public void remove(int i)
698 public DefaultListModel getModel()
702 public boolean contains(RNA r)
704 return _rnas.contains(r);
706 /*public int getSize()
708 return _rnaList.getSize();
710 public FullBackup getElementAt(int i)
712 return (FullBackup) _rnaList.getElementAt(i);
715 public void removeSelected()
717 int i = _l.getSelectedIndex();
720 if (_rnaList.getSize()==1)
725 } catch (ExceptionUnmatchedClosingParentheses e1) {
726 } catch (ExceptionFileFormatOrSyntax e1) {
734 if (newi==_rnaList.getSize())
736 newi = _rnaList.getSize()-2;
738 FullBackup bck = (FullBackup) _rnaList.getElementAt(newi);
739 _l.setSelectedValue(bck,true);
747 public void onLayoutChanged() {
748 // TODO Auto-generated method stub
752 public void onUINewStructure(VARNAConfig v, RNA r) {
753 _rnaList.add(v, r,"",true);
756 public void onWarningEmitted(String s) {
757 // TODO Auto-generated method stub
761 public void mouseClicked(MouseEvent e) {
762 if(e.getClickCount() == 2){
763 int index = _sideList.locationToIndex(e.getPoint());
764 ListModel dlm = _sideList.getModel();
765 FullBackup item = (FullBackup) dlm.getElementAt(index);;
766 _sideList.ensureIndexIsVisible(index);
767 /*TODO Object newName = JOptionPane.showInputDialog(
769 "Specify a new name for this RNA",
771 JOptionPane.QUESTION_MESSAGE,
777 item.name = newName.toString();
778 this._sideList.repaint();
783 public void mouseEntered(MouseEvent arg0) {
784 // TODO Auto-generated method stub
788 public void mouseExited(MouseEvent arg0) {
789 // TODO Auto-generated method stub
793 public void mousePressed(MouseEvent arg0) {
794 // TODO Auto-generated method stub
798 public void mouseReleased(MouseEvent arg0) {
799 // TODO Auto-generated method stub
804 public Color getColour(int atomIndex, int pdbResNum, String chain,
806 // TODO Auto-generated method stub
811 public String[] getPdbFile() {
812 // TODO Auto-generated method stub
817 public void highlightAtom(int atomIndex, int pdbResNum, String chain,
819 // TODO Auto-generated method stub
824 public void mouseOverStructure(int atomIndex, String strInfo) {
825 // TODO Auto-generated method stub
830 public void releaseReferences(Object svl) {
831 // TODO Auto-generated method stub
836 public void updateColours(Object source) {
837 // TODO Auto-generated method stub
842 public void componentHidden(ComponentEvent e) {
843 // TODO Auto-generated method stub
848 public void componentMoved(ComponentEvent e) {
849 // TODO Auto-generated method stub
854 public void componentResized(ComponentEvent e) {
855 // TODO Auto-generated method stub
860 public void componentShown(ComponentEvent e) {
861 // TODO Auto-generated method stub
868 public static void main(String[] args)
870 JTextField str = new JTextField("ATGC");
872 AppVarnaBinding vab = new AppVarnaBinding();
873 vab.varnagui.set_seq(str);
874 vab.varnagui.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
876 vab.varnagui.setVisible(true);