2 * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
3 * Copyright (C) $$Year-Rel$$ The Jalview Authors
5 * This file is part of Jalview.
7 * Jalview is free software: you can redistribute it and/or
8 * modify it under the terms of the GNU General Public License
9 * as published by the Free Software Foundation, either version 3
10 * of the License, or (at your option) any later version.
12 * Jalview is distributed in the hope that it will be useful, but
13 * WITHOUT ANY WARRANTY; without even the implied warranty
14 * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
15 * PURPOSE. See the GNU General Public License for more details.
17 * You should have received a copy of the GNU General Public License
18 * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
19 * The Jalview Authors are detailed in the 'AUTHORS' file.
21 package jalview.datamodel;
23 import static org.testng.AssertJUnit.assertEquals;
24 import static org.testng.AssertJUnit.assertFalse;
25 import static org.testng.AssertJUnit.assertNotNull;
26 import static org.testng.AssertJUnit.assertNotSame;
27 import static org.testng.AssertJUnit.assertNull;
28 import static org.testng.AssertJUnit.assertSame;
29 import static org.testng.AssertJUnit.assertTrue;
31 import jalview.datamodel.PDBEntry.Type;
32 import jalview.gui.JvOptionPane;
33 import jalview.util.MapList;
36 import java.util.ArrayList;
37 import java.util.Arrays;
38 import java.util.List;
39 import java.util.Vector;
41 import junit.extensions.PA;
43 import org.testng.Assert;
44 import org.testng.annotations.BeforeClass;
45 import org.testng.annotations.BeforeMethod;
46 import org.testng.annotations.Test;
48 public class SequenceTest
51 @BeforeClass(alwaysRun = true)
52 public void setUpJvOptionPane()
54 JvOptionPane.setInteractiveMode(false);
55 JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
60 @BeforeMethod(alwaysRun = true)
63 seq = new Sequence("FER1", "AKPNGVL");
66 @Test(groups = { "Functional" })
67 public void testInsertGapsAndGapmaps()
69 SequenceI aseq = seq.deriveSequence();
70 aseq.insertCharAt(2, 3, '-');
71 aseq.insertCharAt(6, 3, '-');
72 assertEquals("Gap insertions not correct", "AK---P---NGVL",
73 aseq.getSequenceAsString());
74 List<int[]> gapInt = aseq.getInsertions();
75 assertEquals("Gap interval 1 start wrong", 2, gapInt.get(0)[0]);
76 assertEquals("Gap interval 1 end wrong", 4, gapInt.get(0)[1]);
77 assertEquals("Gap interval 2 start wrong", 6, gapInt.get(1)[0]);
78 assertEquals("Gap interval 2 end wrong", 8, gapInt.get(1)[1]);
81 @Test(groups = ("Functional"))
82 public void testIsProtein()
85 assertTrue(new Sequence("prot", "ASDFASDFASDF").isProtein());
87 assertFalse(new Sequence("prot", "ACGTACGTACGT").isProtein());
89 SequenceI sq = new Sequence("prot", "ACGUACGUACGU");
90 assertFalse(sq.isProtein());
91 // change sequence, should trigger an update of cached result
92 sq.setSequence("ASDFASDFADSF");
93 assertTrue(sq.isProtein());
95 * in situ change of sequence doesn't change hashcode :-O
96 * (sequence should not expose internal implementation)
98 for (int i = 0; i < sq.getSequence().length; i++)
100 sq.getSequence()[i] = "acgtu".charAt(i % 5);
102 assertTrue(sq.isProtein()); // but it isn't
105 @Test(groups = { "Functional" })
106 public void testGetAnnotation()
108 // initial state returns null not an empty array
109 assertNull(seq.getAnnotation());
110 AlignmentAnnotation ann = addAnnotation("label1", "desc1", "calcId1",
112 AlignmentAnnotation[] anns = seq.getAnnotation();
113 assertEquals(1, anns.length);
114 assertSame(ann, anns[0]);
116 // removing all annotations reverts array to null
117 seq.removeAlignmentAnnotation(ann);
118 assertNull(seq.getAnnotation());
121 @Test(groups = { "Functional" })
122 public void testGetAnnotation_forLabel()
124 AlignmentAnnotation ann1 = addAnnotation("label1", "desc1", "calcId1",
126 addAnnotation("label2", "desc2", "calcId2", 1f);
127 AlignmentAnnotation ann3 = addAnnotation("label1", "desc3", "calcId3",
129 AlignmentAnnotation[] anns = seq.getAnnotation("label1");
130 assertEquals(2, anns.length);
131 assertSame(ann1, anns[0]);
132 assertSame(ann3, anns[1]);
135 private AlignmentAnnotation addAnnotation(String label,
136 String description, String calcId, float value)
138 final AlignmentAnnotation annotation = new AlignmentAnnotation(label,
140 annotation.setCalcId(calcId);
141 seq.addAlignmentAnnotation(annotation);
145 @Test(groups = { "Functional" })
146 public void testGetAlignmentAnnotations_forCalcIdAndLabel()
148 addAnnotation("label1", "desc1", "calcId1", 1f);
149 AlignmentAnnotation ann2 = addAnnotation("label2", "desc2", "calcId2",
151 addAnnotation("label2", "desc3", "calcId3", 1f);
152 AlignmentAnnotation ann4 = addAnnotation("label2", "desc3", "calcId2",
154 addAnnotation("label5", "desc3", null, 1f);
155 addAnnotation(null, "desc3", "calcId3", 1f);
157 List<AlignmentAnnotation> anns = seq.getAlignmentAnnotations("calcId2",
159 assertEquals(2, anns.size());
160 assertSame(ann2, anns.get(0));
161 assertSame(ann4, anns.get(1));
163 assertTrue(seq.getAlignmentAnnotations("calcId2", "label3").isEmpty());
164 assertTrue(seq.getAlignmentAnnotations("calcId3", "label5").isEmpty());
165 assertTrue(seq.getAlignmentAnnotations("calcId2", null).isEmpty());
166 assertTrue(seq.getAlignmentAnnotations(null, "label3").isEmpty());
167 assertTrue(seq.getAlignmentAnnotations(null, null).isEmpty());
171 * Tests for addAlignmentAnnotation. Note this method has the side-effect of
172 * setting the sequenceRef on the annotation. Adding the same annotation twice
175 @Test(groups = { "Functional" })
176 public void testAddAlignmentAnnotation()
178 assertNull(seq.getAnnotation());
179 final AlignmentAnnotation annotation = new AlignmentAnnotation("a",
181 assertNull(annotation.sequenceRef);
182 seq.addAlignmentAnnotation(annotation);
183 assertSame(seq, annotation.sequenceRef);
184 AlignmentAnnotation[] anns = seq.getAnnotation();
185 assertEquals(1, anns.length);
186 assertSame(annotation, anns[0]);
188 // re-adding does nothing
189 seq.addAlignmentAnnotation(annotation);
190 anns = seq.getAnnotation();
191 assertEquals(1, anns.length);
192 assertSame(annotation, anns[0]);
194 // an identical but different annotation can be added
195 final AlignmentAnnotation annotation2 = new AlignmentAnnotation("a",
197 seq.addAlignmentAnnotation(annotation2);
198 anns = seq.getAnnotation();
199 assertEquals(2, anns.length);
200 assertSame(annotation, anns[0]);
201 assertSame(annotation2, anns[1]);
204 @Test(groups = { "Functional" })
205 public void testGetStartGetEnd()
207 SequenceI sq = new Sequence("test", "ABCDEF");
208 assertEquals(1, sq.getStart());
209 assertEquals(6, sq.getEnd());
211 sq = new Sequence("test", "--AB-C-DEF--");
212 assertEquals(1, sq.getStart());
213 assertEquals(6, sq.getEnd());
215 sq = new Sequence("test", "----");
216 assertEquals(1, sq.getStart());
217 assertEquals(0, sq.getEnd()); // ??
221 * Tests for the method that returns an alignment column position (base 1) for
222 * a given sequence position (base 1).
224 @Test(groups = { "Functional" })
225 public void testFindIndex()
227 SequenceI sq = new Sequence("test", "ABCDEF");
228 assertEquals(0, sq.findIndex(0));
229 assertEquals(1, sq.findIndex(1));
230 assertEquals(5, sq.findIndex(5));
231 assertEquals(6, sq.findIndex(6));
232 assertEquals(6, sq.findIndex(9));
234 sq = new Sequence("test/8-13", "-A--B-C-D-E-F--");
235 assertEquals(2, sq.findIndex(8));
236 assertEquals(5, sq.findIndex(9));
237 assertEquals(7, sq.findIndex(10));
239 // before start returns 0
240 assertEquals(0, sq.findIndex(0));
241 assertEquals(0, sq.findIndex(-1));
243 // beyond end returns last residue column
244 assertEquals(13, sq.findIndex(99));
249 * Tests for the method that returns a dataset sequence position (base 1) for
250 * an aligned column position (base 0).
252 @Test(groups = { "Functional" })
253 public void testFindPosition()
255 SequenceI sq = new Sequence("test", "ABCDEF");
256 assertEquals(1, sq.findPosition(0));
257 assertEquals(6, sq.findPosition(5));
258 // assertEquals(-1, seq.findPosition(6)); // fails
260 sq = new Sequence("test", "AB-C-D--");
261 assertEquals(1, sq.findPosition(0));
262 assertEquals(2, sq.findPosition(1));
263 // gap position 'finds' residue to the right (not the left as per javadoc)
264 assertEquals(3, sq.findPosition(2));
265 assertEquals(3, sq.findPosition(3));
266 assertEquals(4, sq.findPosition(4));
267 assertEquals(4, sq.findPosition(5));
268 // returns 1 more than sequence length if off the end ?!?
269 assertEquals(5, sq.findPosition(6));
270 assertEquals(5, sq.findPosition(7));
272 sq = new Sequence("test", "--AB-C-DEF--");
273 assertEquals(1, sq.findPosition(0));
274 assertEquals(1, sq.findPosition(1));
275 assertEquals(1, sq.findPosition(2));
276 assertEquals(2, sq.findPosition(3));
277 assertEquals(3, sq.findPosition(4));
278 assertEquals(3, sq.findPosition(5));
279 assertEquals(4, sq.findPosition(6));
280 assertEquals(4, sq.findPosition(7));
281 assertEquals(5, sq.findPosition(8));
282 assertEquals(6, sq.findPosition(9));
283 assertEquals(7, sq.findPosition(10));
284 assertEquals(7, sq.findPosition(11));
287 @Test(groups = { "Functional" })
288 public void testDeleteChars()
293 SequenceI sq = new Sequence("test", "ABCDEF");
294 assertNull(PA.getValue(sq, "datasetSequence"));
295 assertEquals(1, sq.getStart());
296 assertEquals(6, sq.getEnd());
297 sq.deleteChars(2, 3);
298 assertEquals("ABDEF", sq.getSequenceAsString());
299 assertEquals(1, sq.getStart());
300 assertEquals(5, sq.getEnd());
301 assertNull(PA.getValue(sq, "datasetSequence"));
306 sq = new Sequence("test", "ABCDEF");
307 sq.deleteChars(0, 2);
308 assertEquals("CDEF", sq.getSequenceAsString());
309 assertEquals(3, sq.getStart());
310 assertEquals(6, sq.getEnd());
311 assertNull(PA.getValue(sq, "datasetSequence"));
316 sq = new Sequence("test", "ABCDEF");
317 sq.deleteChars(4, 6);
318 assertEquals("ABCD", sq.getSequenceAsString());
319 assertEquals(1, sq.getStart());
320 assertEquals(4, sq.getEnd());
321 assertNull(PA.getValue(sq, "datasetSequence"));
324 @Test(groups = { "Functional" })
325 public void testDeleteChars_withDbRefsAndFeatures()
328 * internal delete - new dataset sequence created
329 * gets a copy of any dbrefs
331 SequenceI sq = new Sequence("test", "ABCDEF");
332 sq.createDatasetSequence();
333 DBRefEntry dbr1 = new DBRefEntry("Uniprot", "0", "a123");
335 Object ds = PA.getValue(sq, "datasetSequence");
337 assertEquals(1, sq.getStart());
338 assertEquals(6, sq.getEnd());
339 sq.deleteChars(2, 3);
340 assertEquals("ABDEF", sq.getSequenceAsString());
341 assertEquals(1, sq.getStart());
342 assertEquals(5, sq.getEnd());
343 Object newDs = PA.getValue(sq, "datasetSequence");
344 assertNotNull(newDs);
345 assertNotSame(ds, newDs);
346 assertNotNull(sq.getDBRefs());
347 assertEquals(1, sq.getDBRefs().length);
348 assertNotSame(dbr1, sq.getDBRefs()[0]);
349 assertEquals(dbr1, sq.getDBRefs()[0]);
352 * internal delete with sequence features
353 * (failure case for JAL-2541)
355 sq = new Sequence("test", "ABCDEF");
356 sq.createDatasetSequence();
357 SequenceFeature sf1 = new SequenceFeature("Cath", "desc", 2, 4, 2f,
359 sq.addSequenceFeature(sf1);
360 ds = PA.getValue(sq, "datasetSequence");
362 assertEquals(1, sq.getStart());
363 assertEquals(6, sq.getEnd());
364 sq.deleteChars(2, 4);
365 assertEquals("ABEF", sq.getSequenceAsString());
366 assertEquals(1, sq.getStart());
367 assertEquals(4, sq.getEnd());
368 newDs = PA.getValue(sq, "datasetSequence");
369 assertNotNull(newDs);
370 assertNotSame(ds, newDs);
371 List<SequenceFeature> sfs = sq.getSequenceFeatures();
372 assertEquals(1, sfs.size());
373 assertNotSame(sf1, sfs.get(0));
374 assertEquals(sf1, sfs.get(0));
377 * delete at start - no new dataset sequence created
378 * any sequence features remain as before
380 sq = new Sequence("test", "ABCDEF");
381 sq.createDatasetSequence();
382 ds = PA.getValue(sq, "datasetSequence");
383 sf1 = new SequenceFeature("Cath", "desc", 2, 4, 2f, "CathGroup");
384 sq.addSequenceFeature(sf1);
385 sq.deleteChars(0, 2);
386 assertEquals("CDEF", sq.getSequenceAsString());
387 assertEquals(3, sq.getStart());
388 assertEquals(6, sq.getEnd());
389 assertSame(ds, PA.getValue(sq, "datasetSequence"));
390 sfs = sq.getSequenceFeatures();
392 assertEquals(1, sfs.size());
393 assertSame(sf1, sfs.get(0));
396 * delete at end - no new dataset sequence created
397 * any dbrefs remain as before
399 sq = new Sequence("test", "ABCDEF");
400 sq.createDatasetSequence();
401 ds = PA.getValue(sq, "datasetSequence");
402 dbr1 = new DBRefEntry("Uniprot", "0", "a123");
404 sq.deleteChars(4, 6);
405 assertEquals("ABCD", sq.getSequenceAsString());
406 assertEquals(1, sq.getStart());
407 assertEquals(4, sq.getEnd());
408 assertSame(ds, PA.getValue(sq, "datasetSequence"));
409 assertNotNull(sq.getDBRefs());
410 assertEquals(1, sq.getDBRefs().length);
411 assertSame(dbr1, sq.getDBRefs()[0]);
414 @Test(groups = { "Functional" })
415 public void testInsertCharAt()
417 // non-static methods:
418 SequenceI sq = new Sequence("test", "ABCDEF");
419 sq.insertCharAt(0, 'z');
420 assertEquals("zABCDEF", sq.getSequenceAsString());
421 sq.insertCharAt(2, 2, 'x');
422 assertEquals("zAxxBCDEF", sq.getSequenceAsString());
424 // for static method see StringUtilsTest
428 * Test the method that returns an array of aligned sequence positions where
429 * the array index is the data sequence position (both base 0).
431 @Test(groups = { "Functional" })
432 public void testGapMap()
434 SequenceI sq = new Sequence("test", "-A--B-CD-E--F-");
435 sq.createDatasetSequence();
436 assertEquals("[1, 4, 6, 7, 9, 12]", Arrays.toString(sq.gapMap()));
440 * Test the method that gets sequence features, either from the sequence or
443 @Test(groups = { "Functional" })
444 public void testGetSequenceFeatures()
446 SequenceI sq = new Sequence("test", "GATCAT");
447 sq.createDatasetSequence();
449 assertTrue(sq.getSequenceFeatures().isEmpty());
452 * SequenceFeature on sequence
454 SequenceFeature sf = new SequenceFeature("Cath", "desc", 2, 4, 2f, null);
455 sq.addSequenceFeature(sf);
456 List<SequenceFeature> sfs = sq.getSequenceFeatures();
457 assertEquals(1, sfs.size());
458 assertSame(sf, sfs.get(0));
461 * SequenceFeature on sequence and dataset sequence; returns that on
464 * Note JAL-2046: spurious: we have no use case for this at the moment.
465 * This test also buggy - as sf2.equals(sf), no new feature is added
467 SequenceFeature sf2 = new SequenceFeature("Cath", "desc", 2, 4, 2f,
469 sq.getDatasetSequence().addSequenceFeature(sf2);
470 sfs = sq.getSequenceFeatures();
471 assertEquals(1, sfs.size());
472 assertSame(sf, sfs.get(0));
475 * SequenceFeature on dataset sequence only
476 * Note JAL-2046: spurious: we have no use case for setting a non-dataset sequence's feature array to null at the moment.
478 sq.setSequenceFeatures(null);
479 assertTrue(sq.getDatasetSequence().getSequenceFeatures().isEmpty());
482 * Corrupt case - no SequenceFeature, dataset's dataset is the original
483 * sequence. Test shows no infinite loop results.
485 sq.getDatasetSequence().setSequenceFeatures(null);
487 * is there a usecase for this ? setDatasetSequence should throw an error if
488 * this actually occurs.
492 sq.getDatasetSequence().setDatasetSequence(sq); // loop!
493 Assert.fail("Expected Error to be raised when calling setDatasetSequence with self reference");
494 } catch (IllegalArgumentException e)
496 // TODO Jalview error/exception class for raising implementation errors
497 assertTrue(e.getMessage().toLowerCase()
498 .contains("implementation error"));
500 assertTrue(sq.getSequenceFeatures().isEmpty());
504 * Test the method that returns an array, indexed by sequence position, whose
505 * entries are the residue positions at the sequence position (or to the right
508 @Test(groups = { "Functional" })
509 public void testFindPositionMap()
512 * Note: Javadoc for findPosition says it returns the residue position to
513 * the left of a gapped position; in fact it returns the position to the
514 * right. Also it returns a non-existent residue position for a gap beyond
517 Sequence sq = new Sequence("TestSeq", "AB.C-D E.");
518 int[] map = sq.findPositionMap();
519 assertEquals(Arrays.toString(new int[] { 1, 2, 3, 3, 4, 4, 5, 5, 6 }),
520 Arrays.toString(map));
524 * Test for getSubsequence
526 @Test(groups = { "Functional" })
527 public void testGetSubsequence()
529 SequenceI sq = new Sequence("TestSeq", "ABCDEFG");
530 sq.createDatasetSequence();
532 // positions are base 0, end position is exclusive
533 SequenceI subseq = sq.getSubSequence(2, 4);
535 assertEquals("CD", subseq.getSequenceAsString());
536 // start/end are base 1 positions
537 assertEquals(3, subseq.getStart());
538 assertEquals(4, subseq.getEnd());
539 // subsequence shares the full dataset sequence
540 assertSame(sq.getDatasetSequence(), subseq.getDatasetSequence());
544 * test createDatasetSequence behaves to doc
546 @Test(groups = { "Functional" })
547 public void testCreateDatasetSequence()
549 SequenceI sq = new Sequence("my", "ASDASD");
550 sq.addSequenceFeature(new SequenceFeature("type", "desc", 1, 10, 1f,
552 sq.addDBRef(new DBRefEntry("source", "version", "accession"));
553 assertNull(sq.getDatasetSequence());
554 assertNotNull(PA.getValue(sq, "sequenceFeatureStore"));
555 assertNotNull(PA.getValue(sq, "dbrefs"));
557 SequenceI rds = sq.createDatasetSequence();
559 assertNull(rds.getDatasetSequence());
560 assertSame(sq.getDatasetSequence(), rds);
562 // sequence features and dbrefs transferred to dataset sequence
563 assertNull(PA.getValue(sq, "sequenceFeatureStore"));
564 assertNull(PA.getValue(sq, "dbrefs"));
565 assertNotNull(PA.getValue(rds, "sequenceFeatureStore"));
566 assertNotNull(PA.getValue(rds, "dbrefs"));
570 * Test for deriveSequence applied to a sequence with a dataset
572 @Test(groups = { "Functional" })
573 public void testDeriveSequence_existingDataset()
575 Sequence sq = new Sequence("Seq1", "CD");
576 sq.setDatasetSequence(new Sequence("Seq1", "ABCDEF"));
577 sq.getDatasetSequence().addSequenceFeature(
578 new SequenceFeature("", "", 1, 2, 0f, null));
582 sq.setDescription("Test sequence description..");
583 sq.setVamsasId("TestVamsasId");
584 sq.addDBRef(new DBRefEntry("PDB", "version0", "1TST"));
586 sq.addDBRef(new DBRefEntry("PDB", "version1", "1PDB"));
587 sq.addDBRef(new DBRefEntry("PDB", "version2", "2PDB"));
588 sq.addDBRef(new DBRefEntry("PDB", "version3", "3PDB"));
589 sq.addDBRef(new DBRefEntry("PDB", "version4", "4PDB"));
591 sq.addPDBId(new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1"));
592 sq.addPDBId(new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1"));
593 sq.addPDBId(new PDBEntry("2PDB", "A", Type.MMCIF, "filePath/test2"));
594 sq.addPDBId(new PDBEntry("2PDB", "B", Type.MMCIF, "filePath/test2"));
596 // these are the same as ones already added
597 DBRefEntry pdb1pdb = new DBRefEntry("PDB", "version1", "1PDB");
598 DBRefEntry pdb2pdb = new DBRefEntry("PDB", "version2", "2PDB");
600 List<DBRefEntry> primRefs = Arrays.asList(new DBRefEntry[] { pdb1pdb,
603 sq.getDatasetSequence().addDBRef(pdb1pdb); // should do nothing
604 sq.getDatasetSequence().addDBRef(pdb2pdb); // should do nothing
605 sq.getDatasetSequence().addDBRef(
606 new DBRefEntry("PDB", "version3", "3PDB")); // should do nothing
607 sq.getDatasetSequence().addDBRef(
608 new DBRefEntry("PDB", "version4", "4PDB")); // should do nothing
610 PDBEntry pdbe1a = new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1");
611 PDBEntry pdbe1b = new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1");
612 PDBEntry pdbe2a = new PDBEntry("2PDB", "A", Type.MMCIF,
614 PDBEntry pdbe2b = new PDBEntry("2PDB", "B", Type.MMCIF,
616 sq.getDatasetSequence().addPDBId(pdbe1a);
617 sq.getDatasetSequence().addPDBId(pdbe1b);
618 sq.getDatasetSequence().addPDBId(pdbe2a);
619 sq.getDatasetSequence().addPDBId(pdbe2b);
622 * test we added pdb entries to the dataset sequence
624 Assert.assertEquals(sq.getDatasetSequence().getAllPDBEntries(), Arrays
625 .asList(new PDBEntry[] { pdbe1a, pdbe1b, pdbe2a, pdbe2b }),
626 "PDB Entries were not found on dataset sequence.");
629 * we should recover a pdb entry that is on the dataset sequence via PDBEntry
631 Assert.assertEquals(pdbe1a,
632 sq.getDatasetSequence().getPDBEntry("1PDB"),
633 "PDB Entry '1PDB' not found on dataset sequence via getPDBEntry.");
634 ArrayList<Annotation> annotsList = new ArrayList<Annotation>();
635 System.out.println(">>>>>> " + sq.getSequenceAsString().length());
636 annotsList.add(new Annotation("A", "A", 'X', 0.1f));
637 annotsList.add(new Annotation("A", "A", 'X', 0.1f));
638 Annotation[] annots = annotsList.toArray(new Annotation[0]);
639 sq.addAlignmentAnnotation(new AlignmentAnnotation("Test annot",
640 "Test annot description", annots));
641 sq.getDatasetSequence().addAlignmentAnnotation(
642 new AlignmentAnnotation("Test annot", "Test annot description",
644 Assert.assertEquals(sq.getDescription(), "Test sequence description..");
645 Assert.assertEquals(sq.getDBRefs().length, 5); // DBRefs are on dataset
647 Assert.assertEquals(sq.getAllPDBEntries().size(), 4);
648 Assert.assertNotNull(sq.getAnnotation());
649 Assert.assertEquals(sq.getAnnotation()[0].annotations.length, 2);
650 Assert.assertEquals(sq.getDatasetSequence().getDBRefs().length, 5); // same
653 Assert.assertEquals(sq.getDatasetSequence().getAllPDBEntries().size(),
655 Assert.assertNotNull(sq.getDatasetSequence().getAnnotation());
657 Sequence derived = (Sequence) sq.deriveSequence();
659 Assert.assertEquals(derived.getDescription(),
660 "Test sequence description..");
661 Assert.assertEquals(derived.getDBRefs().length, 5); // come from dataset
662 Assert.assertEquals(derived.getAllPDBEntries().size(), 4);
663 Assert.assertNotNull(derived.getAnnotation());
664 Assert.assertEquals(derived.getAnnotation()[0].annotations.length, 2);
665 Assert.assertEquals(derived.getDatasetSequence().getDBRefs().length, 5);
666 Assert.assertEquals(derived.getDatasetSequence().getAllPDBEntries()
668 Assert.assertNotNull(derived.getDatasetSequence().getAnnotation());
670 assertEquals("CD", derived.getSequenceAsString());
671 assertSame(sq.getDatasetSequence(), derived.getDatasetSequence());
673 // derived sequence should access dataset sequence features
674 assertNotNull(sq.getSequenceFeatures());
675 assertEquals(sq.getSequenceFeatures(), derived.getSequenceFeatures());
678 * verify we have primary db refs *just* for PDB IDs with associated
682 assertEquals(primRefs, sq.getPrimaryDBRefs());
683 assertEquals(primRefs, sq.getDatasetSequence().getPrimaryDBRefs());
685 assertEquals(sq.getPrimaryDBRefs(), derived.getPrimaryDBRefs());
690 * Test for deriveSequence applied to an ungapped sequence with no dataset
692 @Test(groups = { "Functional" })
693 public void testDeriveSequence_noDatasetUngapped()
695 SequenceI sq = new Sequence("Seq1", "ABCDEF");
696 assertEquals(1, sq.getStart());
697 assertEquals(6, sq.getEnd());
698 SequenceI derived = sq.deriveSequence();
699 assertEquals("ABCDEF", derived.getSequenceAsString());
700 assertEquals("ABCDEF", derived.getDatasetSequence()
701 .getSequenceAsString());
705 * Test for deriveSequence applied to a gapped sequence with no dataset
707 @Test(groups = { "Functional" })
708 public void testDeriveSequence_noDatasetGapped()
710 SequenceI sq = new Sequence("Seq1", "AB-C.D EF");
711 assertEquals(1, sq.getStart());
712 assertEquals(6, sq.getEnd());
713 assertNull(sq.getDatasetSequence());
714 SequenceI derived = sq.deriveSequence();
715 assertEquals("AB-C.D EF", derived.getSequenceAsString());
716 assertEquals("ABCDEF", derived.getDatasetSequence()
717 .getSequenceAsString());
720 @Test(groups = { "Functional" })
721 public void testCopyConstructor_noDataset()
723 SequenceI seq1 = new Sequence("Seq1", "AB-C.D EF");
724 seq1.setDescription("description");
725 seq1.addAlignmentAnnotation(new AlignmentAnnotation("label", "desc",
727 seq1.addSequenceFeature(new SequenceFeature("type", "desc", 22, 33,
729 seq1.addPDBId(new PDBEntry("1A70", "B", Type.PDB, "File"));
730 seq1.addDBRef(new DBRefEntry("EMBL", "1.2", "AZ12345"));
732 SequenceI copy = new Sequence(seq1);
734 assertNull(copy.getDatasetSequence());
736 verifyCopiedSequence(seq1, copy);
738 // copy has a copy of the DBRefEntry
739 // this is murky - DBrefs are only copied for dataset sequences
740 // where the test for 'dataset sequence' is 'dataset is null'
741 // but that doesn't distinguish it from an aligned sequence
742 // which has not yet generated a dataset sequence
743 // NB getDBRef looks inside dataset sequence if not null
744 DBRefEntry[] dbrefs = copy.getDBRefs();
745 assertEquals(1, dbrefs.length);
746 assertFalse(dbrefs[0] == seq1.getDBRefs()[0]);
747 assertTrue(dbrefs[0].equals(seq1.getDBRefs()[0]));
750 @Test(groups = { "Functional" })
751 public void testCopyConstructor_withDataset()
753 SequenceI seq1 = new Sequence("Seq1", "AB-C.D EF");
754 seq1.createDatasetSequence();
755 seq1.setDescription("description");
756 seq1.addAlignmentAnnotation(new AlignmentAnnotation("label", "desc",
758 // JAL-2046 - what is the contract for using a derived sequence's
759 // addSequenceFeature ?
760 seq1.addSequenceFeature(new SequenceFeature("type", "desc", 22, 33,
762 seq1.addPDBId(new PDBEntry("1A70", "B", Type.PDB, "File"));
763 // here we add DBRef to the dataset sequence:
764 seq1.getDatasetSequence().addDBRef(
765 new DBRefEntry("EMBL", "1.2", "AZ12345"));
767 SequenceI copy = new Sequence(seq1);
769 assertNotNull(copy.getDatasetSequence());
770 assertSame(copy.getDatasetSequence(), seq1.getDatasetSequence());
772 verifyCopiedSequence(seq1, copy);
774 // getDBRef looks inside dataset sequence and this is shared,
775 // so holds the same dbref objects
776 DBRefEntry[] dbrefs = copy.getDBRefs();
777 assertEquals(1, dbrefs.length);
778 assertSame(dbrefs[0], seq1.getDBRefs()[0]);
782 * Helper to make assertions about a copied sequence
787 protected void verifyCopiedSequence(SequenceI seq1, SequenceI copy)
789 // verify basic properties:
790 assertEquals(copy.getName(), seq1.getName());
791 assertEquals(copy.getDescription(), seq1.getDescription());
792 assertEquals(copy.getStart(), seq1.getStart());
793 assertEquals(copy.getEnd(), seq1.getEnd());
794 assertEquals(copy.getSequenceAsString(), seq1.getSequenceAsString());
796 // copy has a copy of the annotation:
797 AlignmentAnnotation[] anns = copy.getAnnotation();
798 assertEquals(1, anns.length);
799 assertFalse(anns[0] == seq1.getAnnotation()[0]);
800 assertEquals(anns[0].label, seq1.getAnnotation()[0].label);
801 assertEquals(anns[0].description, seq1.getAnnotation()[0].description);
802 assertEquals(anns[0].score, seq1.getAnnotation()[0].score);
804 // copy has a copy of the sequence feature:
805 List<SequenceFeature> sfs = copy.getSequenceFeatures();
806 assertEquals(1, sfs.size());
807 if (seq1.getDatasetSequence() != null
808 && copy.getDatasetSequence() == seq1.getDatasetSequence())
810 assertSame(sfs.get(0), seq1.getSequenceFeatures().get(0));
814 assertNotSame(sfs.get(0), seq1.getSequenceFeatures().get(0));
816 assertEquals(sfs.get(0), seq1.getSequenceFeatures().get(0));
818 // copy has a copy of the PDB entry
819 Vector<PDBEntry> pdbs = copy.getAllPDBEntries();
820 assertEquals(1, pdbs.size());
821 assertFalse(pdbs.get(0) == seq1.getAllPDBEntries().get(0));
822 assertTrue(pdbs.get(0).equals(seq1.getAllPDBEntries().get(0)));
825 @Test(groups = "Functional")
826 public void testGetCharAt()
828 SequenceI sq = new Sequence("", "abcde");
829 assertEquals('a', sq.getCharAt(0));
830 assertEquals('e', sq.getCharAt(4));
831 assertEquals(' ', sq.getCharAt(5));
832 assertEquals(' ', sq.getCharAt(-1));
835 @Test(groups = { "Functional" })
836 public void testAddSequenceFeatures()
838 SequenceI sq = new Sequence("", "abcde");
839 // type may not be null
840 assertFalse(sq.addSequenceFeature(new SequenceFeature(null, "desc", 4,
842 assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 4,
844 // can't add a duplicate feature
845 assertFalse(sq.addSequenceFeature(new SequenceFeature("Cath", "desc",
847 // can add a different feature
848 assertTrue(sq.addSequenceFeature(new SequenceFeature("Scop", "desc", 4,
849 8, 0f, null))); // different type
850 assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath",
851 "description", 4, 8, 0f, null)));// different description
852 assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 3,
853 8, 0f, null))); // different start position
854 assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 4,
855 9, 0f, null))); // different end position
856 assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 4,
857 8, 1f, null))); // different score
858 assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 4,
859 8, Float.NaN, null))); // score NaN
860 assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 4,
861 8, 0f, "Metal"))); // different group
862 assertEquals(8, sq.getFeatures().getAllFeatures().size());
866 * Tests for adding (or updating) dbrefs
868 * @see DBRefEntry#updateFrom(DBRefEntry)
870 @Test(groups = { "Functional" })
871 public void testAddDBRef()
873 SequenceI sq = new Sequence("", "abcde");
874 assertNull(sq.getDBRefs());
875 DBRefEntry dbref = new DBRefEntry("Uniprot", "1", "P00340");
877 assertEquals(1, sq.getDBRefs().length);
878 assertSame(dbref, sq.getDBRefs()[0]);
881 * change of version - new entry
883 DBRefEntry dbref2 = new DBRefEntry("Uniprot", "2", "P00340");
885 assertEquals(2, sq.getDBRefs().length);
886 assertSame(dbref, sq.getDBRefs()[0]);
887 assertSame(dbref2, sq.getDBRefs()[1]);
890 * matches existing entry - not added
892 sq.addDBRef(new DBRefEntry("UNIPROT", "1", "p00340"));
893 assertEquals(2, sq.getDBRefs().length);
896 * different source = new entry
898 DBRefEntry dbref3 = new DBRefEntry("UniRef", "1", "p00340");
900 assertEquals(3, sq.getDBRefs().length);
901 assertSame(dbref3, sq.getDBRefs()[2]);
904 * different ref = new entry
906 DBRefEntry dbref4 = new DBRefEntry("UniRef", "1", "p00341");
908 assertEquals(4, sq.getDBRefs().length);
909 assertSame(dbref4, sq.getDBRefs()[3]);
912 * matching ref with a mapping - map updated
914 DBRefEntry dbref5 = new DBRefEntry("UniRef", "1", "p00341");
915 Mapping map = new Mapping(new MapList(new int[] { 1, 3 }, new int[] {
919 assertEquals(4, sq.getDBRefs().length);
920 assertSame(dbref4, sq.getDBRefs()[3]);
921 assertSame(map, dbref4.getMap());
924 * 'real' version replaces "0" version
926 dbref2.setVersion("0");
927 DBRefEntry dbref6 = new DBRefEntry(dbref2.getSource(), "3",
928 dbref2.getAccessionId());
930 assertEquals(4, sq.getDBRefs().length);
931 assertSame(dbref2, sq.getDBRefs()[1]);
932 assertEquals("3", dbref2.getVersion());
935 * 'real' version replaces "source:0" version
937 dbref3.setVersion("Uniprot:0");
938 DBRefEntry dbref7 = new DBRefEntry(dbref3.getSource(), "3",
939 dbref3.getAccessionId());
941 assertEquals(4, sq.getDBRefs().length);
942 assertSame(dbref3, sq.getDBRefs()[2]);
943 assertEquals("3", dbref2.getVersion());
946 @Test(groups = { "Functional" })
947 public void testGetPrimaryDBRefs_peptide()
949 SequenceI sq = new Sequence("aseq", "ASDFKYLMQPRST", 10, 22);
952 List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs();
953 assertTrue(primaryDBRefs.isEmpty());
956 sq.setDBRefs(new DBRefEntry[] {});
957 primaryDBRefs = sq.getPrimaryDBRefs();
958 assertTrue(primaryDBRefs.isEmpty());
961 DBRefEntry upentry1 = new DBRefEntry("UNIPROT", "0", "Q04760");
962 sq.addDBRef(upentry1);
964 // primary - uniprot with congruent map
965 DBRefEntry upentry2 = new DBRefEntry("UNIPROT", "0", "Q04762");
966 upentry2.setMap(new Mapping(null, new MapList(new int[] { 10, 22 },
967 new int[] { 10, 22 }, 1, 1)));
968 sq.addDBRef(upentry2);
970 // primary - uniprot with map of enclosing sequence
971 DBRefEntry upentry3 = new DBRefEntry("UNIPROT", "0", "Q04763");
972 upentry3.setMap(new Mapping(null, new MapList(new int[] { 8, 24 },
973 new int[] { 8, 24 }, 1, 1)));
974 sq.addDBRef(upentry3);
976 // not primary - uniprot with map of sub-sequence (5')
977 DBRefEntry upentry4 = new DBRefEntry("UNIPROT", "0", "Q04764");
978 upentry4.setMap(new Mapping(null, new MapList(new int[] { 10, 18 },
979 new int[] { 10, 18 }, 1, 1)));
980 sq.addDBRef(upentry4);
982 // not primary - uniprot with map that overlaps 3'
983 DBRefEntry upentry5 = new DBRefEntry("UNIPROT", "0", "Q04765");
984 upentry5.setMap(new Mapping(null, new MapList(new int[] { 12, 22 },
985 new int[] { 12, 22 }, 1, 1)));
986 sq.addDBRef(upentry5);
988 // not primary - uniprot with map to different coordinates frame
989 DBRefEntry upentry6 = new DBRefEntry("UNIPROT", "0", "Q04766");
990 upentry6.setMap(new Mapping(null, new MapList(new int[] { 12, 18 },
991 new int[] { 112, 118 }, 1, 1)));
992 sq.addDBRef(upentry6);
994 // not primary - dbref to 'non-core' database
995 DBRefEntry upentry7 = new DBRefEntry("Pfam", "0", "PF00903");
996 sq.addDBRef(upentry7);
998 // primary - type is PDB
999 DBRefEntry pdbentry = new DBRefEntry("PDB", "0", "1qip");
1000 sq.addDBRef(pdbentry);
1002 // not primary - PDBEntry has no file
1003 sq.addDBRef(new DBRefEntry("PDB", "0", "1AAA"));
1005 // not primary - no PDBEntry
1006 sq.addDBRef(new DBRefEntry("PDB", "0", "1DDD"));
1008 // add corroborating PDB entry for primary DBref -
1009 // needs to have a file as well as matching ID
1010 // note PDB ID is not treated as case sensitive
1011 sq.addPDBId(new PDBEntry("1QIP", null, Type.PDB, new File("/blah")
1014 // not valid DBRef - no file..
1015 sq.addPDBId(new PDBEntry("1AAA", null, null, null));
1017 primaryDBRefs = sq.getPrimaryDBRefs();
1018 assertEquals(4, primaryDBRefs.size());
1019 assertTrue("Couldn't find simple primary reference (UNIPROT)",
1020 primaryDBRefs.contains(upentry1));
1021 assertTrue("Couldn't find mapped primary reference (UNIPROT)",
1022 primaryDBRefs.contains(upentry2));
1023 assertTrue("Couldn't find mapped context reference (UNIPROT)",
1024 primaryDBRefs.contains(upentry3));
1025 assertTrue("Couldn't find expected PDB primary reference",
1026 primaryDBRefs.contains(pdbentry));
1029 @Test(groups = { "Functional" })
1030 public void testGetPrimaryDBRefs_nucleotide()
1032 SequenceI sq = new Sequence("aseq", "TGATCACTCGACTAGCATCAGCATA", 10, 34);
1034 // primary - Ensembl
1035 DBRefEntry dbr1 = new DBRefEntry("ENSEMBL", "0", "ENSG1234");
1038 // not primary - Ensembl 'transcript' mapping of sub-sequence
1039 DBRefEntry dbr2 = new DBRefEntry("ENSEMBL", "0", "ENST1234");
1040 dbr2.setMap(new Mapping(null, new MapList(new int[] { 15, 25 },
1041 new int[] { 1, 11 }, 1, 1)));
1044 // primary - EMBL with congruent map
1045 DBRefEntry dbr3 = new DBRefEntry("EMBL", "0", "J1234");
1046 dbr3.setMap(new Mapping(null, new MapList(new int[] { 10, 34 },
1047 new int[] { 10, 34 }, 1, 1)));
1050 // not primary - to non-core database
1051 DBRefEntry dbr4 = new DBRefEntry("CCDS", "0", "J1234");
1054 // not primary - to protein
1055 DBRefEntry dbr5 = new DBRefEntry("UNIPROT", "0", "Q87654");
1058 List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs();
1059 assertEquals(2, primaryDBRefs.size());
1060 assertTrue(primaryDBRefs.contains(dbr1));
1061 assertTrue(primaryDBRefs.contains(dbr3));
1065 * Test the method that updates the list of PDBEntry from any new DBRefEntry
1068 @Test(groups = { "Functional" })
1069 public void testUpdatePDBIds()
1071 PDBEntry pdbe1 = new PDBEntry("3A6S", null, null, null);
1072 seq.addPDBId(pdbe1);
1073 seq.addDBRef(new DBRefEntry("Ensembl", "8", "ENST1234"));
1074 seq.addDBRef(new DBRefEntry("PDB", "0", "1A70"));
1075 seq.addDBRef(new DBRefEntry("PDB", "0", "4BQGa"));
1076 seq.addDBRef(new DBRefEntry("PDB", "0", "3a6sB"));
1077 // 7 is not a valid chain code:
1078 seq.addDBRef(new DBRefEntry("PDB", "0", "2GIS7"));
1081 List<PDBEntry> pdbIds = seq.getAllPDBEntries();
1082 assertEquals(4, pdbIds.size());
1083 assertSame(pdbe1, pdbIds.get(0));
1084 // chain code got added to 3A6S:
1085 assertEquals("B", pdbe1.getChainCode());
1086 assertEquals("1A70", pdbIds.get(1).getId());
1087 // 4BQGA is parsed into id + chain
1088 assertEquals("4BQG", pdbIds.get(2).getId());
1089 assertEquals("a", pdbIds.get(2).getChainCode());
1090 assertEquals("2GIS7", pdbIds.get(3).getId());
1091 assertNull(pdbIds.get(3).getChainCode());
1095 * Test the method that either adds a pdbid or updates an existing one
1097 @Test(groups = { "Functional" })
1098 public void testAddPDBId()
1100 PDBEntry pdbe = new PDBEntry("3A6S", null, null, null);
1102 assertEquals(1, seq.getAllPDBEntries().size());
1103 assertSame(pdbe, seq.getPDBEntry("3A6S"));
1104 assertSame(pdbe, seq.getPDBEntry("3a6s")); // case-insensitive
1106 // add the same entry
1108 assertEquals(1, seq.getAllPDBEntries().size());
1109 assertSame(pdbe, seq.getPDBEntry("3A6S"));
1111 // add an identical entry
1112 seq.addPDBId(new PDBEntry("3A6S", null, null, null));
1113 assertEquals(1, seq.getAllPDBEntries().size());
1114 assertSame(pdbe, seq.getPDBEntry("3A6S"));
1116 // add a different entry
1117 PDBEntry pdbe2 = new PDBEntry("1A70", null, null, null);
1118 seq.addPDBId(pdbe2);
1119 assertEquals(2, seq.getAllPDBEntries().size());
1120 assertSame(pdbe, seq.getAllPDBEntries().get(0));
1121 assertSame(pdbe2, seq.getAllPDBEntries().get(1));
1123 // update pdbe with chain code, file, type
1124 PDBEntry pdbe3 = new PDBEntry("3a6s", "A", Type.PDB, "filepath");
1125 seq.addPDBId(pdbe3);
1126 assertEquals(2, seq.getAllPDBEntries().size());
1127 assertSame(pdbe, seq.getAllPDBEntries().get(0)); // updated in situ
1128 assertEquals("3A6S", pdbe.getId()); // unchanged
1129 assertEquals("A", pdbe.getChainCode()); // updated
1130 assertEquals(Type.PDB.toString(), pdbe.getType()); // updated
1131 assertEquals("filepath", pdbe.getFile()); // updated
1132 assertSame(pdbe2, seq.getAllPDBEntries().get(1));
1134 // add with a different file path
1135 PDBEntry pdbe4 = new PDBEntry("3a6s", "A", Type.PDB, "filepath2");
1136 seq.addPDBId(pdbe4);
1137 assertEquals(3, seq.getAllPDBEntries().size());
1138 assertSame(pdbe4, seq.getAllPDBEntries().get(2));
1140 // add with a different chain code
1141 PDBEntry pdbe5 = new PDBEntry("3a6s", "B", Type.PDB, "filepath");
1142 seq.addPDBId(pdbe5);
1143 assertEquals(4, seq.getAllPDBEntries().size());
1144 assertSame(pdbe5, seq.getAllPDBEntries().get(3));
1148 groups = { "Functional" },
1149 expectedExceptions = { IllegalArgumentException.class })
1150 public void testSetDatasetSequence_toSelf()
1152 seq.setDatasetSequence(seq);
1156 groups = { "Functional" },
1157 expectedExceptions = { IllegalArgumentException.class })
1158 public void testSetDatasetSequence_cascading()
1160 SequenceI seq2 = new Sequence("Seq2", "xyz");
1161 seq2.createDatasetSequence();
1162 seq.setDatasetSequence(seq2);
1165 @Test(groups = { "Functional" })
1166 public void testFindFeatures()
1168 SequenceI sq = new Sequence("test/8-16", "-ABC--DEF--GHI--");
1169 sq.createDatasetSequence();
1171 assertTrue(sq.findFeatures(1, 99).isEmpty());
1173 // add non-positional feature
1174 SequenceFeature sf0 = new SequenceFeature("Cath", "desc", 0, 0, 2f,
1176 sq.addSequenceFeature(sf0);
1177 // add feature on BCD
1178 SequenceFeature sf1 = new SequenceFeature("Cath", "desc", 9, 11, 2f,
1180 sq.addSequenceFeature(sf1);
1181 // add feature on DE
1182 SequenceFeature sf2 = new SequenceFeature("Cath", "desc", 11, 12, 2f,
1184 sq.addSequenceFeature(sf2);
1185 // add contact feature at [B, H]
1186 SequenceFeature sf3 = new SequenceFeature("Disulphide bond", "desc", 9,
1189 sq.addSequenceFeature(sf3);
1190 // add contact feature at [F, G]
1191 SequenceFeature sf4 = new SequenceFeature("Disulfide Bond", "desc", 13,
1194 sq.addSequenceFeature(sf4);
1196 // no features in columns 1-2 (-A)
1197 List<SequenceFeature> found = sq.findFeatures(1, 2);
1198 assertTrue(found.isEmpty());
1200 // columns 1-6 (-ABC--) includes BCD and B/H feature but not DE
1201 found = sq.findFeatures(1, 6);
1202 assertEquals(2, found.size());
1203 assertTrue(found.contains(sf1));
1204 assertTrue(found.contains(sf3));
1206 // columns 5-6 (--) includes (enclosing) BCD but not (contact) B/H feature
1207 found = sq.findFeatures(5, 6);
1208 assertEquals(1, found.size());
1209 assertTrue(found.contains(sf1));
1211 // columns 7-10 (DEF-) includes BCD, DE, F/G but not B/H feature
1212 found = sq.findFeatures(7, 10);
1213 assertEquals(3, found.size());
1214 assertTrue(found.contains(sf1));
1215 assertTrue(found.contains(sf2));
1216 assertTrue(found.contains(sf4));