2 * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
3 * Copyright (C) $$Year-Rel$$ The Jalview Authors
5 * This file is part of Jalview.
7 * Jalview is free software: you can redistribute it and/or
8 * modify it under the terms of the GNU General Public License
9 * as published by the Free Software Foundation, either version 3
10 * of the License, or (at your option) any later version.
12 * Jalview is distributed in the hope that it will be useful, but
13 * WITHOUT ANY WARRANTY; without even the implied warranty
14 * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
15 * PURPOSE. See the GNU General Public License for more details.
17 * You should have received a copy of the GNU General Public License
18 * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
19 * The Jalview Authors are detailed in the 'AUTHORS' file.
21 package jalview.datamodel;
23 import static org.testng.AssertJUnit.assertEquals;
24 import static org.testng.AssertJUnit.assertFalse;
25 import static org.testng.AssertJUnit.assertNotNull;
26 import static org.testng.AssertJUnit.assertNotSame;
27 import static org.testng.AssertJUnit.assertNull;
28 import static org.testng.AssertJUnit.assertSame;
29 import static org.testng.AssertJUnit.assertTrue;
32 import java.util.ArrayList;
33 import java.util.Arrays;
34 import java.util.BitSet;
35 import java.util.Iterator;
36 import java.util.List;
37 import java.util.Locale;
38 import java.util.Vector;
40 import org.testng.Assert;
41 import org.testng.annotations.BeforeClass;
42 import org.testng.annotations.BeforeMethod;
43 import org.testng.annotations.Test;
45 import jalview.analysis.AlignmentGenerator;
46 import jalview.bin.Cache;
47 import jalview.commands.EditCommand;
48 import jalview.commands.EditCommand.Action;
49 import jalview.datamodel.PDBEntry.Type;
50 import jalview.gui.JvOptionPane;
51 import jalview.util.MapList;
52 import junit.extensions.PA;
54 public class SequenceTest
56 @BeforeClass(alwaysRun = true)
57 public void setUpJvOptionPane()
59 JvOptionPane.setInteractiveMode(false);
60 JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
63 @BeforeMethod(alwaysRun = true)
64 public void loadProperties()
66 Cache.loadProperties("test/jalview/util/comparisonTestProps.jvprops");
71 @BeforeMethod(alwaysRun = true)
74 seq = new Sequence("FER1", "AKPNGVL");
77 @Test(groups = { "Functional" })
78 public void testInsertGapsAndGapmaps()
80 SequenceI aseq = seq.deriveSequence();
81 aseq.insertCharAt(2, 3, '-');
82 aseq.insertCharAt(6, 3, '-');
83 assertEquals("Gap insertions not correct", "AK---P---NGVL",
84 aseq.getSequenceAsString());
85 List<int[]> gapInt = aseq.getInsertions();
86 assertEquals("Gap interval 1 start wrong", 2, gapInt.get(0)[0]);
87 assertEquals("Gap interval 1 end wrong", 4, gapInt.get(0)[1]);
88 assertEquals("Gap interval 2 start wrong", 6, gapInt.get(1)[0]);
89 assertEquals("Gap interval 2 end wrong", 8, gapInt.get(1)[1]);
91 BitSet gapfield = aseq.getInsertionsAsBits();
92 BitSet expectedgaps = new BitSet();
93 expectedgaps.set(2, 5);
94 expectedgaps.set(6, 9);
96 assertEquals(6, expectedgaps.cardinality());
98 assertEquals("getInsertionsAsBits didn't mark expected number of gaps",
99 6, gapfield.cardinality());
101 assertEquals("getInsertionsAsBits not correct.", expectedgaps,
105 @Test(groups = ("Functional"))
106 public void testIsProtein()
109 assertTrue(new Sequence("prot", "ASDFASDFASDF").isProtein());
111 assertFalse(new Sequence("prot", "ACGTACGTACGT").isProtein());
113 SequenceI sq = new Sequence("prot", "ACGUACGUACGU");
114 assertFalse(sq.isProtein());
115 // change sequence, should trigger an update of cached result
116 sq.setSequence("ASDFASDFADSF");
117 assertTrue(sq.isProtein());
120 @Test(groups = ("Functional"))
121 public void testIsProteinWithXorNAmbiguityCodes()
123 // test Protein with N - poly asparagine
124 assertTrue(new Sequence("prot", "ASDFASDFASDFNNNNNNNNN").isProtein());
125 assertTrue(new Sequence("prot", "NNNNNNNNNNNNNNNNNNNNN").isProtein());
126 // test Protein with X
127 assertTrue(new Sequence("prot", "ASDFASDFASDFXXXXXXXXX").isProtein());
129 assertFalse(new Sequence("prot", "ACGTACGTACGTXXXXXXXX").isProtein());
130 // short sequence is nucleotide only if 50% is nucleotide and remaining N/X
131 // is either N or X only
132 assertTrue(new Sequence("prot", "ACGTACGTACGTXN").isProtein());
134 assertFalse(new Sequence("prot", "ACGTACGTACGTNNNNNNNN").isProtein());
136 assertFalse(new Sequence("prot", "ACGUACGUACGUACTGACAXX").isProtein());
137 assertFalse(new Sequence("prot", "ACGUACGUACGUNNNNNNNNN").isProtein());
140 @Test(groups = { "Functional" })
141 public void testGetAnnotation()
143 // initial state returns null not an empty array
144 assertNull(seq.getAnnotation());
145 AlignmentAnnotation ann = addAnnotation("label1", "desc1", "calcId1",
147 AlignmentAnnotation[] anns = seq.getAnnotation();
148 assertEquals(1, anns.length);
149 assertSame(ann, anns[0]);
151 // removing all annotations reverts array to null
152 seq.removeAlignmentAnnotation(ann);
153 assertNull(seq.getAnnotation());
156 @Test(groups = { "Functional" })
157 public void testGetAnnotation_forLabel()
159 AlignmentAnnotation ann1 = addAnnotation("label1", "desc1", "calcId1",
161 addAnnotation("label2", "desc2", "calcId2", 1f);
162 AlignmentAnnotation ann3 = addAnnotation("label1", "desc3", "calcId3",
164 AlignmentAnnotation[] anns = seq.getAnnotation("label1");
165 assertEquals(2, anns.length);
166 assertSame(ann1, anns[0]);
167 assertSame(ann3, anns[1]);
170 private AlignmentAnnotation addAnnotation(String label,
171 String description, String calcId, float value)
173 final AlignmentAnnotation annotation = new AlignmentAnnotation(label,
175 annotation.setCalcId(calcId);
176 seq.addAlignmentAnnotation(annotation);
180 @Test(groups = { "Functional" })
181 public void testGetAlignmentAnnotations_forCalcIdAndLabel()
183 addAnnotation("label1", "desc1", "calcId1", 1f);
184 AlignmentAnnotation ann2 = addAnnotation("label2", "desc2", "calcId2",
186 addAnnotation("label2", "desc3", "calcId3", 1f);
187 AlignmentAnnotation ann4 = addAnnotation("label2", "desc3", "calcId2",
189 addAnnotation("label5", "desc3", null, 1f);
190 addAnnotation(null, "desc3", "calcId3", 1f);
192 List<AlignmentAnnotation> anns = seq.getAlignmentAnnotations("calcId2",
194 assertEquals(2, anns.size());
195 assertSame(ann2, anns.get(0));
196 assertSame(ann4, anns.get(1));
198 assertTrue(seq.getAlignmentAnnotations("calcId2", "label3").isEmpty());
199 assertTrue(seq.getAlignmentAnnotations("calcId3", "label5").isEmpty());
200 assertTrue(seq.getAlignmentAnnotations("calcId2", null).isEmpty());
201 assertTrue(seq.getAlignmentAnnotations(null, "label3").isEmpty());
202 assertTrue(seq.getAlignmentAnnotations(null, null).isEmpty());
205 @Test(groups = { "Functional" })
206 public void testGetAlignmentAnnotations_forCalcIdLabelAndDescription()
208 addAnnotation("label1", "desc1", "calcId1", 1f);
209 AlignmentAnnotation ann2 = addAnnotation("label2", "desc2", "calcId2",
211 addAnnotation("label2", "desc3", "calcId3", 1f);
212 AlignmentAnnotation ann4 = addAnnotation("label2", "desc3", "calcId2",
214 addAnnotation("label5", "desc3", null, 1f);
215 addAnnotation(null, "desc3", "calcId3", 1f);
217 List<AlignmentAnnotation> anns = seq.getAlignmentAnnotations("calcId2",
219 assertEquals(1, anns.size());
220 assertSame(ann4, anns.get(0));
222 * null matching should fail
224 assertTrue(seq.getAlignmentAnnotations("calcId3", "label2", null)
227 assertTrue(seq.getAlignmentAnnotations("calcId2", "label3", null)
229 assertTrue(seq.getAlignmentAnnotations("calcId3", "label5", null)
232 seq.getAlignmentAnnotations("calcId2", null, null).isEmpty());
233 assertTrue(seq.getAlignmentAnnotations(null, "label3", null).isEmpty());
234 assertTrue(seq.getAlignmentAnnotations(null, null, null).isEmpty());
238 * Tests for addAlignmentAnnotation. Note this method has the side-effect of
239 * setting the sequenceRef on the annotation. Adding the same annotation twice
242 @Test(groups = { "Functional" })
243 public void testAddAlignmentAnnotation()
245 assertNull(seq.getAnnotation());
246 final AlignmentAnnotation annotation = new AlignmentAnnotation("a", "b",
248 assertNull(annotation.sequenceRef);
249 seq.addAlignmentAnnotation(annotation);
250 assertSame(seq, annotation.sequenceRef);
251 AlignmentAnnotation[] anns = seq.getAnnotation();
252 assertEquals(1, anns.length);
253 assertSame(annotation, anns[0]);
255 // re-adding does nothing
256 seq.addAlignmentAnnotation(annotation);
257 anns = seq.getAnnotation();
258 assertEquals(1, anns.length);
259 assertSame(annotation, anns[0]);
261 // an identical but different annotation can be added
262 final AlignmentAnnotation annotation2 = new AlignmentAnnotation("a",
264 seq.addAlignmentAnnotation(annotation2);
265 anns = seq.getAnnotation();
266 assertEquals(2, anns.length);
267 assertSame(annotation, anns[0]);
268 assertSame(annotation2, anns[1]);
271 @Test(groups = { "Functional" })
272 public void testGetStartGetEnd()
274 SequenceI sq = new Sequence("test", "ABCDEF");
275 assertEquals(1, sq.getStart());
276 assertEquals(6, sq.getEnd());
278 sq = new Sequence("test", "--AB-C-DEF--");
279 assertEquals(1, sq.getStart());
280 assertEquals(6, sq.getEnd());
282 sq = new Sequence("test", "----");
283 assertEquals(1, sq.getStart());
284 assertEquals(0, sq.getEnd()); // ??
288 * Tests for the method that returns an alignment column position (base 1) for
289 * a given sequence position (base 1).
291 @Test(groups = { "Functional" })
292 public void testFindIndex()
295 * call sequenceChanged() after each test to invalidate any cursor,
296 * forcing the 1-arg findIndex to be executed
298 SequenceI sq = new Sequence("test", "ABCDEF");
299 assertEquals(0, sq.findIndex(0));
300 sq.sequenceChanged();
301 assertEquals(1, sq.findIndex(1));
302 sq.sequenceChanged();
303 assertEquals(5, sq.findIndex(5));
304 sq.sequenceChanged();
305 assertEquals(6, sq.findIndex(6));
306 sq.sequenceChanged();
307 assertEquals(6, sq.findIndex(9));
309 final String aligned = "-A--B-C-D-E-F--";
310 assertEquals(15, aligned.length());
311 sq = new Sequence("test/8-13", aligned);
312 assertEquals(2, sq.findIndex(8));
313 sq.sequenceChanged();
314 assertEquals(5, sq.findIndex(9));
315 sq.sequenceChanged();
316 assertEquals(7, sq.findIndex(10));
318 // before start returns 0
319 sq.sequenceChanged();
320 assertEquals(0, sq.findIndex(0));
321 sq.sequenceChanged();
322 assertEquals(0, sq.findIndex(-1));
324 // beyond end returns last residue column
325 sq.sequenceChanged();
326 assertEquals(13, sq.findIndex(99));
329 * residue before sequence 'end' but beyond end of sequence returns
330 * length of sequence (last column) (rightly or wrongly!)
332 sq = new Sequence("test/8-15", "A-B-C-"); // trailing gap case
333 assertEquals(6, sq.getLength());
334 sq.sequenceChanged();
335 assertEquals(sq.getLength(), sq.findIndex(14));
336 sq = new Sequence("test/8-99", "-A--B-C-D"); // trailing residue case
337 sq.sequenceChanged();
338 assertEquals(sq.getLength(), sq.findIndex(65));
341 * residue after sequence 'start' but before first residue returns
342 * zero (before first column) (rightly or wrongly!)
344 sq = new Sequence("test/8-15", "-A-B-C-"); // leading gap case
345 sq.sequenceChanged();
346 assertEquals(0, sq.findIndex(3));
347 sq = new Sequence("test/8-15", "A-B-C-"); // leading residue case
348 sq.sequenceChanged();
349 assertEquals(0, sq.findIndex(2));
352 @Test(groups = { "Functional" })
353 public void testFindPositions()
355 SequenceI sq = new Sequence("test/8-13", "-ABC---DE-F--");
360 assertNull(sq.findPositions(6, 5));
361 assertNull(sq.findPositions(0, 5));
362 assertNull(sq.findPositions(-1, 5));
367 assertNull(sq.findPositions(1, 1)); // 1-based columns
368 assertNull(sq.findPositions(5, 5));
369 assertNull(sq.findPositions(5, 6));
370 assertNull(sq.findPositions(5, 7));
373 * all ungapped ranges
375 assertEquals(new Range(8, 8), sq.findPositions(2, 2)); // A
376 assertEquals(new Range(8, 9), sq.findPositions(2, 3)); // AB
377 assertEquals(new Range(8, 10), sq.findPositions(2, 4)); // ABC
378 assertEquals(new Range(9, 10), sq.findPositions(3, 4)); // BC
381 * gap to ungapped range
383 assertEquals(new Range(8, 10), sq.findPositions(1, 4)); // ABC
384 assertEquals(new Range(11, 12), sq.findPositions(6, 9)); // DE
387 * ungapped to gapped range
389 assertEquals(new Range(10, 10), sq.findPositions(4, 5)); // C
390 assertEquals(new Range(9, 13), sq.findPositions(3, 11)); // BCDEF
393 * ungapped to ungapped enclosing gaps
395 assertEquals(new Range(10, 11), sq.findPositions(4, 8)); // CD
396 assertEquals(new Range(8, 13), sq.findPositions(2, 11)); // ABCDEF
399 * gapped to gapped enclosing ungapped
401 assertEquals(new Range(8, 10), sq.findPositions(1, 5)); // ABC
402 assertEquals(new Range(11, 12), sq.findPositions(5, 10)); // DE
403 assertEquals(new Range(8, 13), sq.findPositions(1, 13)); // the lot
404 assertEquals(new Range(8, 13), sq.findPositions(1, 99));
408 * Tests for the method that returns a dataset sequence position (start..) for
409 * an aligned column position (base 0).
411 @Test(groups = { "Functional" })
412 public void testFindPosition()
415 * call sequenceChanged() after each test to invalidate any cursor,
416 * forcing the 1-arg findPosition to be executed
418 SequenceI sq = new Sequence("test/8-13", "ABCDEF");
419 assertEquals(8, sq.findPosition(0));
420 // Sequence should now hold a cursor at [8, 0]
421 assertEquals("test:Pos8:Col1:startCol1:endCol0:tok1",
422 PA.getValue(sq, "cursor").toString());
423 SequenceCursor cursor = (SequenceCursor) PA.getValue(sq, "cursor");
424 int token = (int) PA.getValue(sq, "changeCount");
425 assertEquals(new SequenceCursor(sq, 8, 1, token), cursor);
427 sq.sequenceChanged();
430 * find F13 at column offset 5, cursor should update to [13, 6]
431 * endColumn is found and saved in cursor
433 assertEquals(13, sq.findPosition(5));
434 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
435 assertEquals(++token, (int) PA.getValue(sq, "changeCount"));
436 assertEquals(new SequenceCursor(sq, 13, 6, token), cursor);
437 assertEquals("test:Pos13:Col6:startCol1:endCol6:tok2",
438 PA.getValue(sq, "cursor").toString());
440 // assertEquals(-1, seq.findPosition(6)); // fails
442 sq = new Sequence("test/8-11", "AB-C-D--");
443 token = (int) PA.getValue(sq, "changeCount"); // 1 for setStart
444 assertEquals(8, sq.findPosition(0));
445 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
446 assertEquals(new SequenceCursor(sq, 8, 1, token), cursor);
447 assertEquals("test:Pos8:Col1:startCol1:endCol0:tok1",
448 PA.getValue(sq, "cursor").toString());
450 sq.sequenceChanged();
451 assertEquals(9, sq.findPosition(1));
452 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
453 assertEquals(new SequenceCursor(sq, 9, 2, ++token), cursor);
454 assertEquals("test:Pos9:Col2:startCol1:endCol0:tok2",
455 PA.getValue(sq, "cursor").toString());
457 sq.sequenceChanged();
458 // gap position 'finds' residue to the right (not the left as per javadoc)
459 // cursor is set to the last residue position found [B 2]
460 assertEquals(10, sq.findPosition(2));
461 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
462 assertEquals(new SequenceCursor(sq, 9, 2, ++token), cursor);
463 assertEquals("test:Pos9:Col2:startCol1:endCol0:tok3",
464 PA.getValue(sq, "cursor").toString());
466 sq.sequenceChanged();
467 assertEquals(10, sq.findPosition(3));
468 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
469 assertEquals(new SequenceCursor(sq, 10, 4, ++token), cursor);
470 assertEquals("test:Pos10:Col4:startCol1:endCol0:tok4",
471 PA.getValue(sq, "cursor").toString());
473 sq.sequenceChanged();
474 // column[4] is the gap after C - returns D11
475 // cursor is set to [C 4]
476 assertEquals(11, sq.findPosition(4));
477 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
478 assertEquals(new SequenceCursor(sq, 10, 4, ++token), cursor);
479 assertEquals("test:Pos10:Col4:startCol1:endCol0:tok5",
480 PA.getValue(sq, "cursor").toString());
482 sq.sequenceChanged();
483 assertEquals(11, sq.findPosition(5)); // D
484 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
485 assertEquals(new SequenceCursor(sq, 11, 6, ++token), cursor);
486 // lastCol has been found and saved in the cursor
487 assertEquals("test:Pos11:Col6:startCol1:endCol6:tok6",
488 PA.getValue(sq, "cursor").toString());
490 sq.sequenceChanged();
491 // returns 1 more than sequence length if off the end ?!?
492 assertEquals(12, sq.findPosition(6));
494 sq.sequenceChanged();
495 assertEquals(12, sq.findPosition(7));
498 * first findPosition should also set firstResCol in cursor
500 sq = new Sequence("test/8-13", "--AB-C-DEF--");
501 assertEquals(8, sq.findPosition(0));
502 assertNull(PA.getValue(sq, "cursor"));
503 assertEquals(1, PA.getValue(sq, "changeCount"));
505 sq.sequenceChanged();
506 assertEquals(8, sq.findPosition(1));
507 assertNull(PA.getValue(sq, "cursor"));
509 sq.sequenceChanged();
510 assertEquals(8, sq.findPosition(2));
511 assertEquals("test:Pos8:Col3:startCol3:endCol0:tok3",
512 PA.getValue(sq, "cursor").toString());
514 sq.sequenceChanged();
515 assertEquals(9, sq.findPosition(3));
516 assertEquals("test:Pos9:Col4:startCol3:endCol0:tok4",
517 PA.getValue(sq, "cursor").toString());
519 sq.sequenceChanged();
520 // column[4] is a gap, returns next residue pos (C10)
521 // cursor is set to last residue found [B]
522 assertEquals(10, sq.findPosition(4));
523 assertEquals("test:Pos9:Col4:startCol3:endCol0:tok5",
524 PA.getValue(sq, "cursor").toString());
526 sq.sequenceChanged();
527 assertEquals(10, sq.findPosition(5));
528 assertEquals("test:Pos10:Col6:startCol3:endCol0:tok6",
529 PA.getValue(sq, "cursor").toString());
531 sq.sequenceChanged();
532 // column[6] is a gap, returns next residue pos (D11)
533 // cursor is set to last residue found [C]
534 assertEquals(11, sq.findPosition(6));
535 assertEquals("test:Pos10:Col6:startCol3:endCol0:tok7",
536 PA.getValue(sq, "cursor").toString());
538 sq.sequenceChanged();
539 assertEquals(11, sq.findPosition(7));
540 assertEquals("test:Pos11:Col8:startCol3:endCol0:tok8",
541 PA.getValue(sq, "cursor").toString());
543 sq.sequenceChanged();
544 assertEquals(12, sq.findPosition(8));
545 assertEquals("test:Pos12:Col9:startCol3:endCol0:tok9",
546 PA.getValue(sq, "cursor").toString());
549 * when the last residue column is found, it is set in the cursor
551 sq.sequenceChanged();
552 assertEquals(13, sq.findPosition(9));
553 assertEquals("test:Pos13:Col10:startCol3:endCol10:tok10",
554 PA.getValue(sq, "cursor").toString());
556 sq.sequenceChanged();
557 assertEquals(14, sq.findPosition(10));
558 assertEquals("test:Pos13:Col10:startCol3:endCol10:tok11",
559 PA.getValue(sq, "cursor").toString());
562 * findPosition for column beyond sequence length
563 * returns 1 more than last residue position
565 sq.sequenceChanged();
566 assertEquals(14, sq.findPosition(11));
567 assertEquals("test:Pos13:Col10:startCol3:endCol10:tok12",
568 PA.getValue(sq, "cursor").toString());
570 sq.sequenceChanged();
571 assertEquals(14, sq.findPosition(99));
572 assertEquals("test:Pos13:Col10:startCol3:endCol10:tok13",
573 PA.getValue(sq, "cursor").toString());
576 * gapped sequence ending in non-gap
578 sq = new Sequence("test/8-13", "--AB-C-DEF");
579 assertEquals(13, sq.findPosition(9));
580 assertEquals("test:Pos13:Col10:startCol3:endCol10:tok1",
581 PA.getValue(sq, "cursor").toString());
582 sq.sequenceChanged();
583 assertEquals(12, sq.findPosition(8)); // E12
584 // sequenceChanged() invalidates cursor.lastResidueColumn
585 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
586 assertEquals("test:Pos12:Col9:startCol3:endCol0:tok2",
588 // findPosition with cursor accepts base 1 column values
589 assertEquals(13, ((Sequence) sq).findPosition(10, cursor));
590 assertEquals(13, sq.findPosition(9)); // F13
591 // lastResidueColumn has now been found and saved in cursor
592 assertEquals("test:Pos13:Col10:startCol3:endCol10:tok2",
593 PA.getValue(sq, "cursor").toString());
596 @Test(groups = { "Functional" })
597 public void testDeleteChars()
602 SequenceI sq = new Sequence("test", "ABCDEF");
603 assertNull(PA.getValue(sq, "datasetSequence"));
604 assertEquals(1, sq.getStart());
605 assertEquals(6, sq.getEnd());
606 sq.deleteChars(2, 3);
607 assertEquals("ABDEF", sq.getSequenceAsString());
608 assertEquals(1, sq.getStart());
609 assertEquals(5, sq.getEnd());
610 assertNull(PA.getValue(sq, "datasetSequence"));
615 sq = new Sequence("test", "ABCDEF");
616 sq.deleteChars(0, 2);
617 assertEquals("CDEF", sq.getSequenceAsString());
618 assertEquals(3, sq.getStart());
619 assertEquals(6, sq.getEnd());
620 assertNull(PA.getValue(sq, "datasetSequence"));
622 sq = new Sequence("test", "ABCDE");
623 sq.deleteChars(0, 3);
624 assertEquals("DE", sq.getSequenceAsString());
625 assertEquals(4, sq.getStart());
626 assertEquals(5, sq.getEnd());
627 assertNull(PA.getValue(sq, "datasetSequence"));
632 sq = new Sequence("test", "ABCDEF");
633 sq.deleteChars(4, 6);
634 assertEquals("ABCD", sq.getSequenceAsString());
635 assertEquals(1, sq.getStart());
636 assertEquals(4, sq.getEnd());
637 assertNull(PA.getValue(sq, "datasetSequence"));
640 * delete more positions than there are
642 sq = new Sequence("test/8-11", "ABCD");
643 sq.deleteChars(0, 99);
644 assertEquals("", sq.getSequenceAsString());
645 assertEquals(12, sq.getStart()); // = findPosition(99) ?!?
646 assertEquals(11, sq.getEnd());
648 sq = new Sequence("test/8-11", "----");
649 sq.deleteChars(0, 99); // ArrayIndexOutOfBoundsException <= 2.10.2
650 assertEquals("", sq.getSequenceAsString());
651 assertEquals(8, sq.getStart());
652 assertEquals(11, sq.getEnd());
655 @Test(groups = { "Functional" })
656 public void testDeleteChars_withDbRefsAndFeatures()
659 * internal delete - new dataset sequence created
660 * gets a copy of any dbrefs
662 SequenceI sq = new Sequence("test", "ABCDEF");
663 sq.createDatasetSequence();
664 DBRefEntry dbr1 = new DBRefEntry("Uniprot", "0", "a123");
666 Object ds = PA.getValue(sq, "datasetSequence");
668 assertEquals(1, sq.getStart());
669 assertEquals(6, sq.getEnd());
670 sq.deleteChars(2, 3);
671 assertEquals("ABDEF", sq.getSequenceAsString());
672 assertEquals(1, sq.getStart());
673 assertEquals(5, sq.getEnd());
674 Object newDs = PA.getValue(sq, "datasetSequence");
675 assertNotNull(newDs);
676 assertNotSame(ds, newDs);
677 assertNotNull(sq.getDBRefs());
678 assertEquals(1, sq.getDBRefs().size());
679 assertNotSame(dbr1, sq.getDBRefs().get(0));
680 assertEquals(dbr1, sq.getDBRefs().get(0));
683 * internal delete with sequence features
684 * (failure case for JAL-2541)
686 sq = new Sequence("test", "ABCDEF");
687 sq.createDatasetSequence();
688 SequenceFeature sf1 = new SequenceFeature("Cath", "desc", 2, 4, 2f,
690 sq.addSequenceFeature(sf1);
691 ds = PA.getValue(sq, "datasetSequence");
693 assertEquals(1, sq.getStart());
694 assertEquals(6, sq.getEnd());
695 sq.deleteChars(2, 4);
696 assertEquals("ABEF", sq.getSequenceAsString());
697 assertEquals(1, sq.getStart());
698 assertEquals(4, sq.getEnd());
699 newDs = PA.getValue(sq, "datasetSequence");
700 assertNotNull(newDs);
701 assertNotSame(ds, newDs);
702 List<SequenceFeature> sfs = sq.getSequenceFeatures();
703 assertEquals(1, sfs.size());
704 assertNotSame(sf1, sfs.get(0));
705 assertEquals(sf1, sfs.get(0));
708 * delete at start - no new dataset sequence created
709 * any sequence features remain as before
711 sq = new Sequence("test", "ABCDEF");
712 sq.createDatasetSequence();
713 ds = PA.getValue(sq, "datasetSequence");
714 sf1 = new SequenceFeature("Cath", "desc", 2, 4, 2f, "CathGroup");
715 sq.addSequenceFeature(sf1);
716 sq.deleteChars(0, 2);
717 assertEquals("CDEF", sq.getSequenceAsString());
718 assertEquals(3, sq.getStart());
719 assertEquals(6, sq.getEnd());
720 assertSame(ds, PA.getValue(sq, "datasetSequence"));
721 sfs = sq.getSequenceFeatures();
723 assertEquals(1, sfs.size());
724 assertSame(sf1, sfs.get(0));
727 * delete at end - no new dataset sequence created
728 * any dbrefs remain as before
730 sq = new Sequence("test", "ABCDEF");
731 sq.createDatasetSequence();
732 ds = PA.getValue(sq, "datasetSequence");
733 dbr1 = new DBRefEntry("Uniprot", "0", "a123");
735 sq.deleteChars(4, 6);
736 assertEquals("ABCD", sq.getSequenceAsString());
737 assertEquals(1, sq.getStart());
738 assertEquals(4, sq.getEnd());
739 assertSame(ds, PA.getValue(sq, "datasetSequence"));
740 assertNotNull(sq.getDBRefs());
741 assertEquals(1, sq.getDBRefs().size());
742 assertSame(dbr1, sq.getDBRefs().get(0));
745 @Test(groups = { "Functional" })
746 public void testInsertCharAt()
748 // non-static methods:
749 SequenceI sq = new Sequence("test", "ABCDEF");
750 sq.insertCharAt(0, 'z');
751 assertEquals("zABCDEF", sq.getSequenceAsString());
752 sq.insertCharAt(2, 2, 'x');
753 assertEquals("zAxxBCDEF", sq.getSequenceAsString());
755 // for static method see StringUtilsTest
759 * Test the method that returns an array of aligned sequence positions where
760 * the array index is the data sequence position (both base 0).
762 @Test(groups = { "Functional" })
763 public void testGapMap()
765 SequenceI sq = new Sequence("test", "-A--B-CD-E--F-");
766 sq.createDatasetSequence();
767 assertEquals("[1, 4, 6, 7, 9, 12]", Arrays.toString(sq.gapMap()));
771 * Test the method that gets sequence features, either from the sequence or
774 @Test(groups = { "Functional" })
775 public void testGetSequenceFeatures()
777 SequenceI sq = new Sequence("test", "GATCAT");
778 sq.createDatasetSequence();
780 assertTrue(sq.getSequenceFeatures().isEmpty());
783 * SequenceFeature on sequence
785 SequenceFeature sf = new SequenceFeature("Cath", "desc", 2, 4, 2f,
787 sq.addSequenceFeature(sf);
788 List<SequenceFeature> sfs = sq.getSequenceFeatures();
789 assertEquals(1, sfs.size());
790 assertSame(sf, sfs.get(0));
793 * SequenceFeature on sequence and dataset sequence; returns that on
796 * Note JAL-2046: spurious: we have no use case for this at the moment.
797 * This test also buggy - as sf2.equals(sf), no new feature is added
799 SequenceFeature sf2 = new SequenceFeature("Cath", "desc", 2, 4, 2f,
801 sq.getDatasetSequence().addSequenceFeature(sf2);
802 sfs = sq.getSequenceFeatures();
803 assertEquals(1, sfs.size());
804 assertSame(sf, sfs.get(0));
807 * SequenceFeature on dataset sequence only
808 * Note JAL-2046: spurious: we have no use case for setting a non-dataset sequence's feature array to null at the moment.
810 sq.setSequenceFeatures(null);
811 assertTrue(sq.getDatasetSequence().getSequenceFeatures().isEmpty());
814 * Corrupt case - no SequenceFeature, dataset's dataset is the original
815 * sequence. Test shows no infinite loop results.
817 sq.getDatasetSequence().setSequenceFeatures(null);
819 * is there a usecase for this ? setDatasetSequence should throw an error if
820 * this actually occurs.
824 sq.getDatasetSequence().setDatasetSequence(sq); // loop!
826 "Expected Error to be raised when calling setDatasetSequence with self reference");
827 } catch (IllegalArgumentException e)
829 // TODO Jalview error/exception class for raising implementation errors
830 assertTrue(e.getMessage().toLowerCase(Locale.ROOT)
831 .contains("implementation error"));
833 assertTrue(sq.getSequenceFeatures().isEmpty());
837 * Test the method that returns an array, indexed by sequence position, whose
838 * entries are the residue positions at the sequence position (or to the right
841 @Test(groups = { "Functional" })
842 public void testFindPositionMap()
845 * Note: Javadoc for findPosition says it returns the residue position to
846 * the left of a gapped position; in fact it returns the position to the
847 * right. Also it returns a non-existent residue position for a gap beyond
850 Sequence sq = new Sequence("TestSeq", "AB.C-D E.");
851 int[] map = sq.findPositionMap();
852 assertEquals(Arrays.toString(new int[] { 1, 2, 3, 3, 4, 4, 5, 5, 6 }),
853 Arrays.toString(map));
857 * Test for getSubsequence
859 @Test(groups = { "Functional" })
860 public void testGetSubsequence()
862 SequenceI sq = new Sequence("TestSeq", "ABCDEFG");
863 sq.createDatasetSequence();
865 // positions are base 0, end position is exclusive
866 SequenceI subseq = sq.getSubSequence(2, 4);
868 assertEquals("CD", subseq.getSequenceAsString());
869 // start/end are base 1 positions
870 assertEquals(3, subseq.getStart());
871 assertEquals(4, subseq.getEnd());
872 // subsequence shares the full dataset sequence
873 assertSame(sq.getDatasetSequence(), subseq.getDatasetSequence());
877 * test createDatasetSequence behaves to doc
879 @Test(groups = { "Functional" })
880 public void testCreateDatasetSequence()
882 SequenceI sq = new Sequence("my", "ASDASD");
883 sq.addSequenceFeature(
884 new SequenceFeature("type", "desc", 1, 10, 1f, "group"));
885 sq.addDBRef(new DBRefEntry("source", "version", "accession"));
886 assertNull(sq.getDatasetSequence());
887 assertNotNull(PA.getValue(sq, "sequenceFeatureStore"));
888 assertNotNull(PA.getValue(sq, "dbrefs"));
890 SequenceI rds = sq.createDatasetSequence();
892 assertNull(rds.getDatasetSequence());
893 assertSame(sq.getDatasetSequence(), rds);
895 // sequence features and dbrefs transferred to dataset sequence
896 assertNull(PA.getValue(sq, "sequenceFeatureStore"));
897 assertNull(PA.getValue(sq, "dbrefs"));
898 assertNotNull(PA.getValue(rds, "sequenceFeatureStore"));
899 assertNotNull(PA.getValue(rds, "dbrefs"));
903 * Test for deriveSequence applied to a sequence with a dataset
905 @Test(groups = { "Functional" })
906 public void testDeriveSequence_existingDataset()
908 Sequence sq = new Sequence("Seq1", "CD");
909 sq.setDatasetSequence(new Sequence("Seq1", "ABCDEF"));
910 sq.getDatasetSequence().addSequenceFeature(
911 new SequenceFeature("", "", 1, 2, 0f, null));
915 sq.setDescription("Test sequence description..");
916 sq.setVamsasId("TestVamsasId");
917 sq.addDBRef(new DBRefEntry("PDB", "version0", "1TST"));
919 sq.addDBRef(new DBRefEntry("PDB", "version1", "1PDB"));
920 sq.addDBRef(new DBRefEntry("PDB", "version2", "2PDB"));
921 sq.addDBRef(new DBRefEntry("PDB", "version3", "3PDB"));
922 sq.addDBRef(new DBRefEntry("PDB", "version4", "4PDB"));
924 sq.addPDBId(new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1"));
925 sq.addPDBId(new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1"));
926 sq.addPDBId(new PDBEntry("2PDB", "A", Type.MMCIF, "filePath/test2"));
927 sq.addPDBId(new PDBEntry("2PDB", "B", Type.MMCIF, "filePath/test2"));
929 // these are the same as ones already added
930 DBRefEntry pdb1pdb = new DBRefEntry("PDB", "version1", "1PDB");
931 DBRefEntry pdb2pdb = new DBRefEntry("PDB", "version2", "2PDB");
933 List<DBRefEntry> primRefs = Arrays
934 .asList(new DBRefEntry[]
935 { pdb1pdb, pdb2pdb });
937 sq.getDatasetSequence().addDBRef(pdb1pdb); // should do nothing
938 sq.getDatasetSequence().addDBRef(pdb2pdb); // should do nothing
939 sq.getDatasetSequence()
940 .addDBRef(new DBRefEntry("PDB", "version3", "3PDB")); // should do
942 sq.getDatasetSequence()
943 .addDBRef(new DBRefEntry("PDB", "version4", "4PDB")); // should do
946 PDBEntry pdbe1a = new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1");
947 PDBEntry pdbe1b = new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1");
948 PDBEntry pdbe2a = new PDBEntry("2PDB", "A", Type.MMCIF,
950 PDBEntry pdbe2b = new PDBEntry("2PDB", "B", Type.MMCIF,
952 sq.getDatasetSequence().addPDBId(pdbe1a);
953 sq.getDatasetSequence().addPDBId(pdbe1b);
954 sq.getDatasetSequence().addPDBId(pdbe2a);
955 sq.getDatasetSequence().addPDBId(pdbe2b);
958 * test we added pdb entries to the dataset sequence
960 Assert.assertEquals(sq.getDatasetSequence().getAllPDBEntries(),
961 Arrays.asList(new PDBEntry[]
962 { pdbe1a, pdbe1b, pdbe2a, pdbe2b }),
963 "PDB Entries were not found on dataset sequence.");
966 * we should recover a pdb entry that is on the dataset sequence via PDBEntry
968 Assert.assertEquals(pdbe1a, sq.getDatasetSequence().getPDBEntry("1PDB"),
969 "PDB Entry '1PDB' not found on dataset sequence via getPDBEntry.");
970 ArrayList<Annotation> annotsList = new ArrayList<>();
971 System.out.println(">>>>>> " + sq.getSequenceAsString().length());
972 annotsList.add(new Annotation("A", "A", 'X', 0.1f));
973 annotsList.add(new Annotation("A", "A", 'X', 0.1f));
974 Annotation[] annots = annotsList.toArray(new Annotation[0]);
975 sq.addAlignmentAnnotation(new AlignmentAnnotation("Test annot",
976 "Test annot description", annots));
977 sq.getDatasetSequence().addAlignmentAnnotation(new AlignmentAnnotation(
978 "Test annot", "Test annot description", annots));
979 Assert.assertEquals(sq.getDescription(), "Test sequence description..");
980 Assert.assertEquals(sq.getDBRefs().size(), 5); // DBRefs are on dataset
982 Assert.assertEquals(sq.getAllPDBEntries().size(), 4);
983 Assert.assertNotNull(sq.getAnnotation());
984 Assert.assertEquals(sq.getAnnotation()[0].annotations.length, 2);
985 Assert.assertEquals(sq.getDatasetSequence().getDBRefs().size(), 5); // same
988 Assert.assertEquals(sq.getDatasetSequence().getAllPDBEntries().size(),
990 Assert.assertNotNull(sq.getDatasetSequence().getAnnotation());
992 Sequence derived = (Sequence) sq.deriveSequence();
994 Assert.assertEquals(derived.getDescription(),
995 "Test sequence description..");
996 Assert.assertEquals(derived.getDBRefs().size(), 5); // come from dataset
997 Assert.assertEquals(derived.getAllPDBEntries().size(), 4);
998 Assert.assertNotNull(derived.getAnnotation());
999 Assert.assertEquals(derived.getAnnotation()[0].annotations.length, 2);
1000 Assert.assertEquals(derived.getDatasetSequence().getDBRefs().size(), 5);
1001 Assert.assertEquals(
1002 derived.getDatasetSequence().getAllPDBEntries().size(), 4);
1003 Assert.assertNotNull(derived.getDatasetSequence().getAnnotation());
1005 assertEquals("CD", derived.getSequenceAsString());
1006 assertSame(sq.getDatasetSequence(), derived.getDatasetSequence());
1008 // derived sequence should access dataset sequence features
1009 assertNotNull(sq.getSequenceFeatures());
1010 assertEquals(sq.getSequenceFeatures(), derived.getSequenceFeatures());
1013 * verify we have primary db refs *just* for PDB IDs with associated
1017 assertEquals(primRefs, sq.getPrimaryDBRefs());
1018 assertEquals(primRefs, sq.getDatasetSequence().getPrimaryDBRefs());
1020 assertEquals(sq.getPrimaryDBRefs(), derived.getPrimaryDBRefs());
1025 * Test for deriveSequence applied to an ungapped sequence with no dataset
1027 @Test(groups = { "Functional" })
1028 public void testDeriveSequence_noDatasetUngapped()
1030 SequenceI sq = new Sequence("Seq1", "ABCDEF");
1031 assertEquals(1, sq.getStart());
1032 assertEquals(6, sq.getEnd());
1033 SequenceI derived = sq.deriveSequence();
1034 assertEquals("ABCDEF", derived.getSequenceAsString());
1035 assertEquals("ABCDEF",
1036 derived.getDatasetSequence().getSequenceAsString());
1040 * Test for deriveSequence applied to a gapped sequence with no dataset
1042 @Test(groups = { "Functional" })
1043 public void testDeriveSequence_noDatasetGapped()
1045 SequenceI sq = new Sequence("Seq1", "AB-C.D EF");
1046 assertEquals(1, sq.getStart());
1047 assertEquals(6, sq.getEnd());
1048 assertNull(sq.getDatasetSequence());
1049 SequenceI derived = sq.deriveSequence();
1050 assertEquals("AB-C.D EF", derived.getSequenceAsString());
1051 assertEquals("ABCDEF",
1052 derived.getDatasetSequence().getSequenceAsString());
1055 @Test(groups = { "Functional" })
1056 public void testCopyConstructor_noDataset()
1058 SequenceI seq1 = new Sequence("Seq1", "AB-C.D EF");
1059 seq1.setDescription("description");
1060 seq1.addAlignmentAnnotation(
1061 new AlignmentAnnotation("label", "desc", 1.3d));
1062 seq1.addSequenceFeature(
1063 new SequenceFeature("type", "desc", 22, 33, 12.4f, "group"));
1064 seq1.addPDBId(new PDBEntry("1A70", "B", Type.PDB, "File"));
1065 seq1.addDBRef(new DBRefEntry("EMBL", "1.2", "AZ12345"));
1067 SequenceI copy = new Sequence(seq1);
1069 assertNull(copy.getDatasetSequence());
1071 verifyCopiedSequence(seq1, copy);
1073 // copy has a copy of the DBRefEntry
1074 // this is murky - DBrefs are only copied for dataset sequences
1075 // where the test for 'dataset sequence' is 'dataset is null'
1076 // but that doesn't distinguish it from an aligned sequence
1077 // which has not yet generated a dataset sequence
1078 // NB getDBRef looks inside dataset sequence if not null
1079 List<DBRefEntry> dbrefs = copy.getDBRefs();
1080 assertEquals(1, dbrefs.size());
1081 assertFalse(dbrefs.get(0) == seq1.getDBRefs().get(0));
1082 assertTrue(dbrefs.get(0).equals(seq1.getDBRefs().get(0)));
1085 @Test(groups = { "Functional" })
1086 public void testCopyConstructor_withDataset()
1088 SequenceI seq1 = new Sequence("Seq1", "AB-C.D EF");
1089 seq1.createDatasetSequence();
1090 seq1.setDescription("description");
1091 seq1.addAlignmentAnnotation(
1092 new AlignmentAnnotation("label", "desc", 1.3d));
1093 // JAL-2046 - what is the contract for using a derived sequence's
1094 // addSequenceFeature ?
1095 seq1.addSequenceFeature(
1096 new SequenceFeature("type", "desc", 22, 33, 12.4f, "group"));
1097 seq1.addPDBId(new PDBEntry("1A70", "B", Type.PDB, "File"));
1098 // here we add DBRef to the dataset sequence:
1099 seq1.getDatasetSequence()
1100 .addDBRef(new DBRefEntry("EMBL", "1.2", "AZ12345"));
1102 SequenceI copy = new Sequence(seq1);
1104 assertNotNull(copy.getDatasetSequence());
1105 assertSame(copy.getDatasetSequence(), seq1.getDatasetSequence());
1107 verifyCopiedSequence(seq1, copy);
1109 // getDBRef looks inside dataset sequence and this is shared,
1110 // so holds the same dbref objects
1111 List<DBRefEntry> dbrefs = copy.getDBRefs();
1112 assertEquals(1, dbrefs.size());
1113 assertSame(dbrefs.get(0), seq1.getDBRefs().get(0));
1117 * Helper to make assertions about a copied sequence
1122 protected void verifyCopiedSequence(SequenceI seq1, SequenceI copy)
1124 // verify basic properties:
1125 assertEquals(copy.getName(), seq1.getName());
1126 assertEquals(copy.getDescription(), seq1.getDescription());
1127 assertEquals(copy.getStart(), seq1.getStart());
1128 assertEquals(copy.getEnd(), seq1.getEnd());
1129 assertEquals(copy.getSequenceAsString(), seq1.getSequenceAsString());
1131 // copy has a copy of the annotation:
1132 AlignmentAnnotation[] anns = copy.getAnnotation();
1133 assertEquals(1, anns.length);
1134 assertFalse(anns[0] == seq1.getAnnotation()[0]);
1135 assertEquals(anns[0].label, seq1.getAnnotation()[0].label);
1136 assertEquals(anns[0].description, seq1.getAnnotation()[0].description);
1137 assertEquals(anns[0].score, seq1.getAnnotation()[0].score);
1139 // copy has a copy of the sequence feature:
1140 List<SequenceFeature> sfs = copy.getSequenceFeatures();
1141 assertEquals(1, sfs.size());
1142 if (seq1.getDatasetSequence() != null
1143 && copy.getDatasetSequence() == seq1.getDatasetSequence())
1145 assertSame(sfs.get(0), seq1.getSequenceFeatures().get(0));
1149 assertNotSame(sfs.get(0), seq1.getSequenceFeatures().get(0));
1151 assertEquals(sfs.get(0), seq1.getSequenceFeatures().get(0));
1153 // copy has a copy of the PDB entry
1154 Vector<PDBEntry> pdbs = copy.getAllPDBEntries();
1155 assertEquals(1, pdbs.size());
1156 assertFalse(pdbs.get(0) == seq1.getAllPDBEntries().get(0));
1157 assertTrue(pdbs.get(0).equals(seq1.getAllPDBEntries().get(0)));
1160 @Test(groups = "Functional")
1161 public void testGetCharAt()
1163 SequenceI sq = new Sequence("", "abcde");
1164 assertEquals('a', sq.getCharAt(0));
1165 assertEquals('e', sq.getCharAt(4));
1166 assertEquals(' ', sq.getCharAt(5));
1167 assertEquals(' ', sq.getCharAt(-1));
1170 @Test(groups = { "Functional" })
1171 public void testAddSequenceFeatures()
1173 SequenceI sq = new Sequence("", "abcde");
1174 // type may not be null
1175 assertFalse(sq.addSequenceFeature(
1176 new SequenceFeature(null, "desc", 4, 8, 0f, null)));
1177 assertTrue(sq.addSequenceFeature(
1178 new SequenceFeature("Cath", "desc", 4, 8, 0f, null)));
1179 // can't add a duplicate feature
1180 assertFalse(sq.addSequenceFeature(
1181 new SequenceFeature("Cath", "desc", 4, 8, 0f, null)));
1182 // can add a different feature
1183 assertTrue(sq.addSequenceFeature(
1184 new SequenceFeature("Scop", "desc", 4, 8, 0f, null))); // different
1186 assertTrue(sq.addSequenceFeature(
1187 new SequenceFeature("Cath", "description", 4, 8, 0f, null)));// different
1189 assertTrue(sq.addSequenceFeature(
1190 new SequenceFeature("Cath", "desc", 3, 8, 0f, null))); // different
1193 assertTrue(sq.addSequenceFeature(
1194 new SequenceFeature("Cath", "desc", 4, 9, 0f, null))); // different
1197 assertTrue(sq.addSequenceFeature(
1198 new SequenceFeature("Cath", "desc", 4, 8, 1f, null))); // different
1200 assertTrue(sq.addSequenceFeature(
1201 new SequenceFeature("Cath", "desc", 4, 8, Float.NaN, null))); // score
1203 assertTrue(sq.addSequenceFeature(
1204 new SequenceFeature("Cath", "desc", 4, 8, 0f, "Metal"))); // different
1206 assertEquals(8, sq.getFeatures().getAllFeatures().size());
1210 * Tests for adding (or updating) dbrefs
1212 * @see DBRefEntry#updateFrom(DBRefEntry)
1214 @Test(groups = { "Functional" })
1215 public void testAddDBRef()
1217 SequenceI sq = new Sequence("", "abcde");
1218 assertNull(sq.getDBRefs());
1219 DBRefEntry dbref = new DBRefEntry("Uniprot", "1", "P00340");
1221 assertEquals(1, sq.getDBRefs().size());
1222 assertSame(dbref, sq.getDBRefs().get(0));
1225 * change of version - new entry
1227 DBRefEntry dbref2 = new DBRefEntry("Uniprot", "2", "P00340");
1228 sq.addDBRef(dbref2);
1229 assertEquals(2, sq.getDBRefs().size());
1230 assertSame(dbref, sq.getDBRefs().get(0));
1231 assertSame(dbref2, sq.getDBRefs().get(1));
1234 * matches existing entry - not added
1236 sq.addDBRef(new DBRefEntry("UNIPROT", "1", "p00340"));
1237 assertEquals(2, sq.getDBRefs().size());
1240 * different source = new entry
1242 DBRefEntry dbref3 = new DBRefEntry("UniRef", "1", "p00340");
1243 sq.addDBRef(dbref3);
1244 assertEquals(3, sq.getDBRefs().size());
1245 assertSame(dbref3, sq.getDBRefs().get(2));
1248 * different ref = new entry
1250 DBRefEntry dbref4 = new DBRefEntry("UniRef", "1", "p00341");
1251 sq.addDBRef(dbref4);
1252 assertEquals(4, sq.getDBRefs().size());
1253 assertSame(dbref4, sq.getDBRefs().get(3));
1256 * matching ref with a mapping - map updated
1258 DBRefEntry dbref5 = new DBRefEntry("UniRef", "1", "p00341");
1259 Mapping map = new Mapping(
1260 new MapList(new int[]
1261 { 1, 3 }, new int[] { 1, 1 }, 3, 1));
1263 sq.addDBRef(dbref5);
1264 assertEquals(4, sq.getDBRefs().size());
1265 assertSame(dbref4, sq.getDBRefs().get(3));
1266 assertSame(map, dbref4.getMap());
1269 * 'real' version replaces "0" version
1271 dbref2.setVersion("0");
1272 DBRefEntry dbref6 = new DBRefEntry(dbref2.getSource(), "3",
1273 dbref2.getAccessionId());
1274 sq.addDBRef(dbref6);
1275 assertEquals(4, sq.getDBRefs().size());
1276 assertSame(dbref2, sq.getDBRefs().get(1));
1277 assertEquals("3", dbref2.getVersion());
1280 * 'real' version replaces "source:0" version
1282 dbref3.setVersion("Uniprot:0");
1283 DBRefEntry dbref7 = new DBRefEntry(dbref3.getSource(), "3",
1284 dbref3.getAccessionId());
1285 sq.addDBRef(dbref7);
1286 assertEquals(4, sq.getDBRefs().size());
1287 assertSame(dbref3, sq.getDBRefs().get(2));
1288 assertEquals("3", dbref2.getVersion());
1291 @Test(groups = { "Functional" })
1292 public void testGetPrimaryDBRefs_peptide()
1294 SequenceI sq = new Sequence("aseq", "ASDFKYLMQPRST", 10, 22);
1297 List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs();
1298 assertTrue(primaryDBRefs.isEmpty());
1302 primaryDBRefs = sq.getPrimaryDBRefs();
1303 assertTrue(primaryDBRefs.isEmpty());
1305 // primary - uniprot
1306 DBRefEntry upentry1 = new DBRefEntry("UNIPROT", "0", "Q04760");
1307 sq.addDBRef(upentry1);
1309 // primary - uniprot with congruent map
1310 DBRefEntry upentry2 = new DBRefEntry("UNIPROT", "0", "Q04762");
1312 new Mapping(null, new MapList(new int[]
1313 { 10, 22 }, new int[] { 10, 22 }, 1, 1)));
1314 sq.addDBRef(upentry2);
1316 // primary - uniprot with map of enclosing sequence
1317 DBRefEntry upentry3 = new DBRefEntry("UNIPROT", "0", "Q04763");
1319 new Mapping(null, new MapList(new int[]
1320 { 8, 24 }, new int[] { 8, 24 }, 1, 1)));
1321 sq.addDBRef(upentry3);
1323 // not primary - uniprot with map of sub-sequence (5')
1324 DBRefEntry upentry4 = new DBRefEntry("UNIPROT", "0", "Q04764");
1326 new Mapping(null, new MapList(new int[]
1327 { 10, 18 }, new int[] { 10, 18 }, 1, 1)));
1328 sq.addDBRef(upentry4);
1330 // not primary - uniprot with map that overlaps 3'
1331 DBRefEntry upentry5 = new DBRefEntry("UNIPROT", "0", "Q04765");
1333 new Mapping(null, new MapList(new int[]
1334 { 12, 22 }, new int[] { 12, 22 }, 1, 1)));
1335 sq.addDBRef(upentry5);
1337 // not primary - uniprot with map to different coordinates frame
1338 DBRefEntry upentry6 = new DBRefEntry("UNIPROT", "0", "Q04766");
1340 new Mapping(null, new MapList(new int[]
1341 { 12, 18 }, new int[] { 112, 118 }, 1, 1)));
1342 sq.addDBRef(upentry6);
1344 // not primary - dbref to 'non-core' database
1345 DBRefEntry upentry7 = new DBRefEntry("Pfam", "0", "PF00903");
1346 sq.addDBRef(upentry7);
1348 // primary - type is PDB
1349 DBRefEntry pdbentry = new DBRefEntry("PDB", "0", "1qip");
1350 sq.addDBRef(pdbentry);
1352 // not primary - PDBEntry has no file
1353 sq.addDBRef(new DBRefEntry("PDB", "0", "1AAA"));
1355 // not primary - no PDBEntry
1356 sq.addDBRef(new DBRefEntry("PDB", "0", "1DDD"));
1358 // add corroborating PDB entry for primary DBref -
1359 // needs to have a file as well as matching ID
1360 // note PDB ID is not treated as case sensitive
1361 sq.addPDBId(new PDBEntry("1QIP", null, Type.PDB,
1362 new File("/blah").toString()));
1364 // not valid DBRef - no file..
1365 sq.addPDBId(new PDBEntry("1AAA", null, null, null));
1367 primaryDBRefs = sq.getPrimaryDBRefs();
1368 assertEquals(4, primaryDBRefs.size());
1369 assertTrue("Couldn't find simple primary reference (UNIPROT)",
1370 primaryDBRefs.contains(upentry1));
1371 assertTrue("Couldn't find mapped primary reference (UNIPROT)",
1372 primaryDBRefs.contains(upentry2));
1373 assertTrue("Couldn't find mapped context reference (UNIPROT)",
1374 primaryDBRefs.contains(upentry3));
1375 assertTrue("Couldn't find expected PDB primary reference",
1376 primaryDBRefs.contains(pdbentry));
1379 @Test(groups = { "Functional" })
1380 public void testGetPrimaryDBRefs_nucleotide()
1382 SequenceI sq = new Sequence("aseq", "TGATCACTCGACTAGCATCAGCATA", 10,
1385 // primary - Ensembl
1386 DBRefEntry dbr1 = new DBRefEntry("ENSEMBL", "0", "ENSG1234");
1389 // not primary - Ensembl 'transcript' mapping of sub-sequence
1390 DBRefEntry dbr2 = new DBRefEntry("ENSEMBL", "0", "ENST1234");
1392 new Mapping(null, new MapList(new int[]
1393 { 15, 25 }, new int[] { 1, 11 }, 1, 1)));
1396 // primary - EMBL with congruent map
1397 DBRefEntry dbr3 = new DBRefEntry("EMBL", "0", "J1234");
1399 new Mapping(null, new MapList(new int[]
1400 { 10, 34 }, new int[] { 10, 34 }, 1, 1)));
1403 // not primary - to non-core database
1404 DBRefEntry dbr4 = new DBRefEntry("CCDS", "0", "J1234");
1407 // not primary - to protein
1408 DBRefEntry dbr5 = new DBRefEntry("UNIPROT", "0", "Q87654");
1411 List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs();
1412 assertEquals(2, primaryDBRefs.size());
1413 assertTrue(primaryDBRefs.contains(dbr1));
1414 assertTrue(primaryDBRefs.contains(dbr3));
1418 * Test the method that updates the list of PDBEntry from any new DBRefEntry
1421 @Test(groups = { "Functional" })
1422 public void testUpdatePDBIds()
1424 PDBEntry pdbe1 = new PDBEntry("3A6S", null, null, null);
1425 seq.addPDBId(pdbe1);
1426 seq.addDBRef(new DBRefEntry("Ensembl", "8", "ENST1234"));
1427 seq.addDBRef(new DBRefEntry("PDB", "0", "1A70"));
1428 seq.addDBRef(new DBRefEntry("PDB", "0", "4BQGa"));
1429 seq.addDBRef(new DBRefEntry("PDB", "0", "3a6sB"));
1430 // 7 is not a valid chain code:
1431 seq.addDBRef(new DBRefEntry("PDB", "0", "2GIS7"));
1434 List<PDBEntry> pdbIds = seq.getAllPDBEntries();
1435 assertEquals(4, pdbIds.size());
1436 assertSame(pdbe1, pdbIds.get(0));
1437 // chain code got added to 3A6S:
1438 assertEquals("B", pdbe1.getChainCode());
1439 assertEquals("1A70", pdbIds.get(1).getId());
1440 // 4BQGA is parsed into id + chain
1441 assertEquals("4BQG", pdbIds.get(2).getId());
1442 assertEquals("a", pdbIds.get(2).getChainCode());
1443 assertEquals("2GIS7", pdbIds.get(3).getId());
1444 assertNull(pdbIds.get(3).getChainCode());
1448 * Test the method that either adds a pdbid or updates an existing one
1450 @Test(groups = { "Functional" })
1451 public void testAddPDBId()
1453 PDBEntry pdbe = new PDBEntry("3A6S", null, null, null);
1455 assertEquals(1, seq.getAllPDBEntries().size());
1456 assertSame(pdbe, seq.getPDBEntry("3A6S"));
1457 assertSame(pdbe, seq.getPDBEntry("3a6s")); // case-insensitive
1459 // add the same entry
1461 assertEquals(1, seq.getAllPDBEntries().size());
1462 assertSame(pdbe, seq.getPDBEntry("3A6S"));
1464 // add an identical entry
1465 seq.addPDBId(new PDBEntry("3A6S", null, null, null));
1466 assertEquals(1, seq.getAllPDBEntries().size());
1467 assertSame(pdbe, seq.getPDBEntry("3A6S"));
1469 // add a different entry
1470 PDBEntry pdbe2 = new PDBEntry("1A70", null, null, null);
1471 seq.addPDBId(pdbe2);
1472 assertEquals(2, seq.getAllPDBEntries().size());
1473 assertSame(pdbe, seq.getAllPDBEntries().get(0));
1474 assertSame(pdbe2, seq.getAllPDBEntries().get(1));
1476 // update pdbe with chain code, file, type
1477 PDBEntry pdbe3 = new PDBEntry("3a6s", "A", Type.PDB, "filepath");
1478 seq.addPDBId(pdbe3);
1479 assertEquals(2, seq.getAllPDBEntries().size());
1480 assertSame(pdbe, seq.getAllPDBEntries().get(0)); // updated in situ
1481 assertEquals("3A6S", pdbe.getId()); // unchanged
1482 assertEquals("A", pdbe.getChainCode()); // updated
1483 assertEquals(Type.PDB.toString(), pdbe.getType()); // updated
1484 assertEquals("filepath", pdbe.getFile()); // updated
1485 assertSame(pdbe2, seq.getAllPDBEntries().get(1));
1487 // add with a different file path
1488 PDBEntry pdbe4 = new PDBEntry("3a6s", "A", Type.PDB, "filepath2");
1489 seq.addPDBId(pdbe4);
1490 assertEquals(3, seq.getAllPDBEntries().size());
1491 assertSame(pdbe4, seq.getAllPDBEntries().get(2));
1493 // add with a different chain code
1494 PDBEntry pdbe5 = new PDBEntry("3a6s", "B", Type.PDB, "filepath");
1495 seq.addPDBId(pdbe5);
1496 assertEquals(4, seq.getAllPDBEntries().size());
1497 assertSame(pdbe5, seq.getAllPDBEntries().get(3));
1499 // add with a fake pdbid
1500 // (models don't have an embedded ID)
1501 String realId = "RealIDQ";
1502 PDBEntry pdbe6 = new PDBEntry(realId, null, Type.PDB, "real/localpath");
1503 PDBEntry pdbe7 = new PDBEntry("RealID/real/localpath", "C", Type.MMCIF,
1505 pdbe7.setFakedPDBId(true);
1506 seq.addPDBId(pdbe6);
1507 assertEquals(5, seq.getAllPDBEntries().size());
1508 seq.addPDBId(pdbe7);
1509 assertEquals(5, seq.getAllPDBEntries().size());
1510 assertFalse(pdbe6.fakedPDBId());
1511 assertSame(pdbe6, seq.getAllPDBEntries().get(4));
1512 assertEquals("C", pdbe6.getChainCode());
1513 assertEquals(realId, pdbe6.getId());
1519 expectedExceptions =
1520 { IllegalArgumentException.class })
1521 public void testSetDatasetSequence_toSelf()
1523 seq.setDatasetSequence(seq);
1529 expectedExceptions =
1530 { IllegalArgumentException.class })
1531 public void testSetDatasetSequence_cascading()
1533 SequenceI seq2 = new Sequence("Seq2", "xyz");
1534 seq2.createDatasetSequence();
1535 seq.setDatasetSequence(seq2);
1538 @Test(groups = { "Functional" })
1539 public void testFindFeatures()
1541 SequenceI sq = new Sequence("test/8-16", "-ABC--DEF--GHI--");
1542 sq.createDatasetSequence();
1544 assertTrue(sq.findFeatures(1, 99).isEmpty());
1546 // add non-positional feature
1547 SequenceFeature sf0 = new SequenceFeature("Cath", "desc", 0, 0, 2f,
1549 sq.addSequenceFeature(sf0);
1550 // add feature on BCD
1551 SequenceFeature sfBCD = new SequenceFeature("Cath", "desc", 9, 11, 2f,
1553 sq.addSequenceFeature(sfBCD);
1554 // add feature on DE
1555 SequenceFeature sfDE = new SequenceFeature("Cath", "desc", 11, 12, 2f,
1557 sq.addSequenceFeature(sfDE);
1558 // add contact feature at [B, H]
1559 SequenceFeature sfContactBH = new SequenceFeature("Disulphide bond",
1560 "desc", 9, 15, 2f, null);
1561 sq.addSequenceFeature(sfContactBH);
1562 // add contact feature at [F, G]
1563 SequenceFeature sfContactFG = new SequenceFeature("Disulfide Bond",
1564 "desc", 13, 14, 2f, null);
1565 sq.addSequenceFeature(sfContactFG);
1566 // add single position feature at [I]
1567 SequenceFeature sfI = new SequenceFeature("Disulfide Bond", "desc", 16,
1569 sq.addSequenceFeature(sfI);
1571 // no features in columns 1-2 (-A)
1572 List<SequenceFeature> found = sq.findFeatures(1, 2);
1573 assertTrue(found.isEmpty());
1575 // columns 1-6 (-ABC--) includes BCD and B/H feature but not DE
1576 found = sq.findFeatures(1, 6);
1577 assertEquals(2, found.size());
1578 assertTrue(found.contains(sfBCD));
1579 assertTrue(found.contains(sfContactBH));
1581 // columns 5-6 (--) includes (enclosing) BCD but not (contact) B/H feature
1582 found = sq.findFeatures(5, 6);
1583 assertEquals(1, found.size());
1584 assertTrue(found.contains(sfBCD));
1586 // columns 7-10 (DEF-) includes BCD, DE, F/G but not B/H feature
1587 found = sq.findFeatures(7, 10);
1588 assertEquals(3, found.size());
1589 assertTrue(found.contains(sfBCD));
1590 assertTrue(found.contains(sfDE));
1591 assertTrue(found.contains(sfContactFG));
1593 // columns 10-11 (--) should find nothing
1594 found = sq.findFeatures(10, 11);
1595 assertEquals(0, found.size());
1597 // columns 14-14 (I) should find variant feature
1598 found = sq.findFeatures(14, 14);
1599 assertEquals(1, found.size());
1600 assertTrue(found.contains(sfI));
1603 @Test(groups = { "Functional" })
1604 public void testFindIndex_withCursor()
1606 Sequence sq = new Sequence("test/8-13", "-A--BCD-EF--");
1607 final int tok = (int) PA.getValue(sq, "changeCount");
1608 assertEquals(1, tok);
1610 // find F given A, check cursor is now at the found position
1611 assertEquals(10, sq.findIndex(13, new SequenceCursor(sq, 8, 2, tok)));
1612 SequenceCursor cursor = (SequenceCursor) PA.getValue(sq, "cursor");
1613 assertEquals(13, cursor.residuePosition);
1614 assertEquals(10, cursor.columnPosition);
1617 assertEquals(2, sq.findIndex(8, new SequenceCursor(sq, 13, 10, tok)));
1618 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
1619 assertEquals(8, cursor.residuePosition);
1620 assertEquals(2, cursor.columnPosition);
1622 // find C given C (no cursor update is done for this case)
1623 assertEquals(6, sq.findIndex(10, new SequenceCursor(sq, 10, 6, tok)));
1624 SequenceCursor cursor2 = (SequenceCursor) PA.getValue(sq, "cursor");
1625 assertSame(cursor2, cursor);
1628 * sequence 'end' beyond end of sequence returns length of sequence
1629 * (for compatibility with pre-cursor code)
1630 * - also verify the cursor is left in a valid state
1632 sq = new Sequence("test/8-99", "-A--B-C-D-E-F--"); // trailing gap case
1633 assertEquals(7, sq.findIndex(10)); // establishes a cursor
1634 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
1635 assertEquals(10, cursor.residuePosition);
1636 assertEquals(7, cursor.columnPosition);
1637 assertEquals(sq.getLength(), sq.findIndex(65));
1638 cursor2 = (SequenceCursor) PA.getValue(sq, "cursor");
1639 assertSame(cursor, cursor2); // not updated for this case!
1641 sq = new Sequence("test/8-99", "-A--B-C-D-E-F"); // trailing residue case
1642 sq.findIndex(10); // establishes a cursor
1643 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
1644 assertEquals(sq.getLength(), sq.findIndex(65));
1645 cursor2 = (SequenceCursor) PA.getValue(sq, "cursor");
1646 assertSame(cursor, cursor2); // not updated for this case!
1649 * residue after sequence 'start' but before first residue should return
1650 * zero (for compatibility with pre-cursor code)
1652 sq = new Sequence("test/8-15", "-A-B-C-"); // leading gap case
1653 sq.findIndex(10); // establishes a cursor
1654 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
1655 assertEquals(0, sq.findIndex(3));
1656 cursor2 = (SequenceCursor) PA.getValue(sq, "cursor");
1657 assertSame(cursor, cursor2); // not updated for this case!
1659 sq = new Sequence("test/8-15", "A-B-C-"); // leading residue case
1660 sq.findIndex(10); // establishes a cursor
1661 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
1662 assertEquals(0, sq.findIndex(2));
1663 cursor2 = (SequenceCursor) PA.getValue(sq, "cursor");
1664 assertSame(cursor, cursor2); // not updated for this case!
1667 @Test(groups = { "Functional" })
1668 public void testFindPosition_withCursor()
1670 Sequence sq = new Sequence("test/8-13", "-A--BCD-EF--");
1671 final int tok = (int) PA.getValue(sq, "changeCount");
1672 assertEquals(1, tok);
1674 // find F pos given A - lastCol gets set in cursor
1676 sq.findPosition(10, new SequenceCursor(sq, 8, 2, tok)));
1677 assertEquals("test:Pos13:Col10:startCol0:endCol10:tok1",
1678 PA.getValue(sq, "cursor").toString());
1680 // find A pos given F - first residue column is saved in cursor
1682 sq.findPosition(2, new SequenceCursor(sq, 13, 10, tok)));
1683 assertEquals("test:Pos8:Col2:startCol2:endCol10:tok1",
1684 PA.getValue(sq, "cursor").toString());
1686 // find C pos given C (neither startCol nor endCol is set)
1688 sq.findPosition(6, new SequenceCursor(sq, 10, 6, tok)));
1689 assertEquals("test:Pos10:Col6:startCol0:endCol0:tok1",
1690 PA.getValue(sq, "cursor").toString());
1692 // now the grey area - what residue position for a gapped column? JAL-2562
1694 // find 'residue' for column 3 given cursor for D (so working left)
1695 // returns B9; cursor is updated to [B 5]
1696 assertEquals(9, sq.findPosition(3, new SequenceCursor(sq, 11, 7, tok)));
1697 assertEquals("test:Pos9:Col5:startCol0:endCol0:tok1",
1698 PA.getValue(sq, "cursor").toString());
1700 // find 'residue' for column 8 given cursor for D (so working right)
1701 // returns E12; cursor is updated to [D 7]
1703 sq.findPosition(8, new SequenceCursor(sq, 11, 7, tok)));
1704 assertEquals("test:Pos11:Col7:startCol0:endCol0:tok1",
1705 PA.getValue(sq, "cursor").toString());
1707 // find 'residue' for column 12 given cursor for B
1708 // returns 1 more than last residue position; cursor is updated to [F 10]
1709 // lastCol position is saved in cursor
1711 sq.findPosition(12, new SequenceCursor(sq, 9, 5, tok)));
1712 assertEquals("test:Pos13:Col10:startCol0:endCol10:tok1",
1713 PA.getValue(sq, "cursor").toString());
1716 * findPosition for column beyond length of sequence
1717 * returns 1 more than the last residue position
1718 * cursor is set to last real residue position [F 10]
1721 sq.findPosition(99, new SequenceCursor(sq, 8, 2, tok)));
1722 assertEquals("test:Pos13:Col10:startCol0:endCol10:tok1",
1723 PA.getValue(sq, "cursor").toString());
1726 * and the case without a trailing gap
1728 sq = new Sequence("test/8-13", "-A--BCD-EF");
1729 // first find C from A
1730 assertEquals(10, sq.findPosition(6, new SequenceCursor(sq, 8, 2, tok)));
1731 SequenceCursor cursor = (SequenceCursor) PA.getValue(sq, "cursor");
1732 assertEquals("test:Pos10:Col6:startCol0:endCol0:tok1",
1734 // now 'find' 99 from C
1735 // cursor is set to [F 10] and saved lastCol
1736 assertEquals(14, sq.findPosition(99, cursor));
1737 assertEquals("test:Pos13:Col10:startCol0:endCol10:tok1",
1738 PA.getValue(sq, "cursor").toString());
1742 public void testIsValidCursor()
1744 Sequence sq = new Sequence("Seq", "ABC--DE-F", 8, 13);
1745 assertFalse(sq.isValidCursor(null));
1748 * cursor is valid if it has valid sequence ref and changeCount token
1749 * and positions within the range of the sequence
1751 int changeCount = (int) PA.getValue(sq, "changeCount");
1752 SequenceCursor cursor = new SequenceCursor(sq, 13, 1, changeCount);
1753 assertTrue(sq.isValidCursor(cursor));
1756 * column position outside [0 - length] is rejected
1758 cursor = new SequenceCursor(sq, 13, -1, changeCount);
1759 assertFalse(sq.isValidCursor(cursor));
1760 cursor = new SequenceCursor(sq, 13, 10, changeCount);
1761 assertFalse(sq.isValidCursor(cursor));
1762 cursor = new SequenceCursor(sq, 7, 8, changeCount);
1763 assertFalse(sq.isValidCursor(cursor));
1764 cursor = new SequenceCursor(sq, 14, 2, changeCount);
1765 assertFalse(sq.isValidCursor(cursor));
1768 * wrong sequence is rejected
1770 cursor = new SequenceCursor(null, 13, 1, changeCount);
1771 assertFalse(sq.isValidCursor(cursor));
1772 cursor = new SequenceCursor(new Sequence("Seq", "abc"), 13, 1,
1774 assertFalse(sq.isValidCursor(cursor));
1777 * wrong token value is rejected
1779 cursor = new SequenceCursor(sq, 13, 1, changeCount + 1);
1780 assertFalse(sq.isValidCursor(cursor));
1781 cursor = new SequenceCursor(sq, 13, 1, changeCount - 1);
1782 assertFalse(sq.isValidCursor(cursor));
1785 @Test(groups = { "Functional" })
1786 public void testFindPosition_withCursorAndEdits()
1788 Sequence sq = new Sequence("test/8-13", "-A--BCD-EF--");
1790 // find F pos given A
1791 assertEquals(13, sq.findPosition(10, new SequenceCursor(sq, 8, 2, 0)));
1792 int token = (int) PA.getValue(sq, "changeCount"); // 0
1793 SequenceCursor cursor = (SequenceCursor) PA.getValue(sq, "cursor");
1794 assertEquals(new SequenceCursor(sq, 13, 10, token), cursor);
1797 * setSequence should invalidate the cursor cached by the sequence
1799 sq.setSequence("-A-BCD-EF---"); // one gap removed
1800 assertEquals(8, sq.getStart()); // sanity check
1801 assertEquals(11, sq.findPosition(5)); // D11
1802 // cursor should now be at [D 6]
1803 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
1804 assertEquals(new SequenceCursor(sq, 11, 6, ++token), cursor);
1805 assertEquals(0, cursor.lastColumnPosition); // not yet found
1806 assertEquals(13, sq.findPosition(8)); // E13
1807 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
1808 assertEquals(9, cursor.lastColumnPosition); // found
1811 * deleteChars should invalidate the cached cursor
1813 sq.deleteChars(2, 5); // delete -BC
1814 assertEquals("-AD-EF---", sq.getSequenceAsString());
1815 assertEquals(8, sq.getStart()); // sanity check
1816 assertEquals(10, sq.findPosition(4)); // E10
1817 // cursor should now be at [E 5]
1818 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
1819 assertEquals(new SequenceCursor(sq, 10, 5, ++token), cursor);
1822 * Edit to insert gaps should invalidate the cached cursor
1823 * insert 2 gaps at column[3] to make -AD---EF---
1825 SequenceI[] seqs = new SequenceI[] { sq };
1826 AlignmentI al = new Alignment(seqs);
1827 new EditCommand().appendEdit(Action.INSERT_GAP, seqs, 3, 2, al, true);
1828 assertEquals("-AD---EF---", sq.getSequenceAsString());
1829 assertEquals(10, sq.findPosition(4)); // E10
1830 // cursor should now be at [D 3]
1831 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
1832 assertEquals(new SequenceCursor(sq, 9, 3, ++token), cursor);
1835 * insertCharAt should invalidate the cached cursor
1836 * insert CC at column[4] to make -AD-CC--EF---
1838 sq.insertCharAt(4, 2, 'C');
1839 assertEquals("-AD-CC--EF---", sq.getSequenceAsString());
1840 assertEquals(13, sq.findPosition(9)); // F13
1841 // cursor should now be at [F 10]
1842 cursor = (SequenceCursor) PA.getValue(sq, "cursor");
1843 assertEquals(new SequenceCursor(sq, 13, 10, ++token), cursor);
1846 * changing sequence start should invalidate cursor
1848 sq = new Sequence("test/8-13", "-A--BCD-EF--");
1849 assertEquals(8, sq.getStart());
1850 assertEquals(9, sq.findPosition(4)); // B(9)
1852 assertEquals(8, sq.findPosition(4)); // is now B(8)
1854 assertEquals(11, sq.findPosition(4)); // is now B(11)
1857 @Test(groups = { "Functional" })
1858 public void testGetSequence()
1860 String seqstring = "-A--BCD-EF--";
1861 Sequence sq = new Sequence("test/8-13", seqstring);
1862 sq.createDatasetSequence();
1863 assertTrue(Arrays.equals(sq.getSequence(), seqstring.toCharArray()));
1864 assertTrue(Arrays.equals(sq.getDatasetSequence().getSequence(),
1865 "ABCDEF".toCharArray()));
1867 // verify a copy of the sequence array is returned
1868 char[] theSeq = (char[]) PA.getValue(sq, "sequence");
1869 assertNotSame(theSeq, sq.getSequence());
1870 theSeq = (char[]) PA.getValue(sq.getDatasetSequence(), "sequence");
1871 assertNotSame(theSeq, sq.getDatasetSequence().getSequence());
1874 @Test(groups = { "Functional" })
1875 public void testReplace()
1877 String seqstring = "-A--BCD-EF--";
1878 SequenceI sq = new Sequence("test/8-13", seqstring);
1879 // changeCount is incremented for setStart
1880 assertEquals(1, PA.getValue(sq, "changeCount"));
1882 assertEquals(0, sq.replace('A', 'A')); // same char
1883 assertEquals(seqstring, sq.getSequenceAsString());
1884 assertEquals(1, PA.getValue(sq, "changeCount"));
1886 assertEquals(0, sq.replace('X', 'Y')); // not there
1887 assertEquals(seqstring, sq.getSequenceAsString());
1888 assertEquals(1, PA.getValue(sq, "changeCount"));
1890 assertEquals(1, sq.replace('A', 'K'));
1891 assertEquals("-K--BCD-EF--", sq.getSequenceAsString());
1892 assertEquals(2, PA.getValue(sq, "changeCount"));
1894 assertEquals(6, sq.replace('-', '.'));
1895 assertEquals(".K..BCD.EF..", sq.getSequenceAsString());
1896 assertEquals(3, PA.getValue(sq, "changeCount"));
1899 @Test(groups = { "Functional" })
1900 public void testGapBitset()
1902 SequenceI sq = new Sequence("test/8-13", "-ABC---DE-F--");
1903 BitSet bs = sq.gapBitset();
1904 BitSet expected = new BitSet();
1908 expected.set(11, 13);
1910 assertTrue(bs.equals(expected));
1914 public void testFindFeatures_largeEndPos()
1917 * imitate a PDB sequence where end is larger than end position
1919 SequenceI sq = new Sequence("test", "-ABC--DEF--", 1, 20);
1920 sq.createDatasetSequence();
1922 assertTrue(sq.findFeatures(1, 9).isEmpty());
1923 // should be no array bounds exception - JAL-2772
1924 assertTrue(sq.findFeatures(1, 15).isEmpty());
1926 // add feature on BCD
1927 SequenceFeature sfBCD = new SequenceFeature("Cath", "desc", 2, 4, 2f,
1929 sq.addSequenceFeature(sfBCD);
1931 // no features in columns 1-2 (-A)
1932 List<SequenceFeature> found = sq.findFeatures(1, 2);
1933 assertTrue(found.isEmpty());
1935 // columns 1-6 (-ABC--) includes BCD
1936 found = sq.findFeatures(1, 6);
1937 assertEquals(1, found.size());
1938 assertTrue(found.contains(sfBCD));
1940 // columns 10-11 (--) should find nothing
1941 found = sq.findFeatures(10, 11);
1942 assertEquals(0, found.size());
1945 @Test(groups = { "Functional" })
1946 public void testSetName()
1948 SequenceI sq = new Sequence("test", "-ABC---DE-F--");
1949 assertEquals("test", sq.getName());
1950 assertEquals(1, sq.getStart());
1951 assertEquals(6, sq.getEnd());
1953 sq.setName("testing");
1954 assertEquals("testing", sq.getName());
1956 sq.setName("test/8-10");
1957 assertEquals("test", sq.getName());
1958 assertEquals(8, sq.getStart());
1959 assertEquals(13, sq.getEnd()); // note end is recomputed
1961 sq.setName("testing/7-99");
1962 assertEquals("testing", sq.getName());
1963 assertEquals(7, sq.getStart());
1964 assertEquals(99, sq.getEnd()); // end may be beyond physical end
1967 assertEquals("", sq.getName());
1968 assertEquals(2, sq.getStart());
1969 assertEquals(7, sq.getEnd());
1971 sq.setName("test/"); // invalid
1972 assertEquals("test/", sq.getName());
1973 assertEquals(2, sq.getStart());
1974 assertEquals(7, sq.getEnd());
1976 sq.setName("test/6-13/7-99");
1977 assertEquals("test/6-13", sq.getName());
1978 assertEquals(7, sq.getStart());
1979 assertEquals(99, sq.getEnd());
1981 sq.setName("test/0-5"); // 0 is invalid - ignored
1982 assertEquals("test/0-5", sq.getName());
1983 assertEquals(7, sq.getStart());
1984 assertEquals(99, sq.getEnd());
1986 sq.setName("test/a-5"); // a is invalid - ignored
1987 assertEquals("test/a-5", sq.getName());
1988 assertEquals(7, sq.getStart());
1989 assertEquals(99, sq.getEnd());
1991 sq.setName("test/6-5"); // start > end is invalid - ignored
1992 assertEquals("test/6-5", sq.getName());
1993 assertEquals(7, sq.getStart());
1994 assertEquals(99, sq.getEnd());
1996 sq.setName("test/5"); // invalid - ignored
1997 assertEquals("test/5", sq.getName());
1998 assertEquals(7, sq.getStart());
1999 assertEquals(99, sq.getEnd());
2001 sq.setName("test/-5"); // invalid - ignored
2002 assertEquals("test/-5", sq.getName());
2003 assertEquals(7, sq.getStart());
2004 assertEquals(99, sq.getEnd());
2006 sq.setName("test/5-"); // invalid - ignored
2007 assertEquals("test/5-", sq.getName());
2008 assertEquals(7, sq.getStart());
2009 assertEquals(99, sq.getEnd());
2011 sq.setName("test/5-6-7"); // invalid - ignored
2012 assertEquals("test/5-6-7", sq.getName());
2013 assertEquals(7, sq.getStart());
2014 assertEquals(99, sq.getEnd());
2016 sq.setName(null); // invalid, gets converted to space
2017 assertEquals("", sq.getName());
2018 assertEquals(7, sq.getStart());
2019 assertEquals(99, sq.getEnd());
2022 @Test(groups = { "Functional" })
2023 public void testCheckValidRange()
2025 Sequence sq = new Sequence("test/7-12", "-ABC---DE-F--");
2026 assertEquals(7, sq.getStart());
2027 assertEquals(12, sq.getEnd());
2030 * checkValidRange ensures end is at least the last residue position
2032 PA.setValue(sq, "end", 2);
2033 sq.checkValidRange();
2034 assertEquals(12, sq.getEnd());
2037 * end may be beyond the last residue position
2039 PA.setValue(sq, "end", 22);
2040 sq.checkValidRange();
2041 assertEquals(22, sq.getEnd());
2044 @Test(groups = { "Functional" })
2045 public void testDeleteChars_withGaps()
2050 SequenceI sq = new Sequence("test/8-10", "A-B-C");
2051 sq.createDatasetSequence();
2052 assertEquals("ABC", sq.getDatasetSequence().getSequenceAsString());
2053 sq.deleteChars(1, 2); // delete first gap
2054 assertEquals("AB-C", sq.getSequenceAsString());
2055 assertEquals(8, sq.getStart());
2056 assertEquals(10, sq.getEnd());
2057 assertEquals("ABC", sq.getDatasetSequence().getSequenceAsString());
2060 * delete gaps and residues at start (no new dataset sequence)
2062 sq = new Sequence("test/8-10", "A-B-C");
2063 sq.createDatasetSequence();
2064 sq.deleteChars(0, 3); // delete A-B
2065 assertEquals("-C", sq.getSequenceAsString());
2066 assertEquals(10, sq.getStart());
2067 assertEquals(10, sq.getEnd());
2068 assertEquals("ABC", sq.getDatasetSequence().getSequenceAsString());
2071 * delete gaps and residues at end (no new dataset sequence)
2073 sq = new Sequence("test/8-10", "A-B-C");
2074 sq.createDatasetSequence();
2075 sq.deleteChars(2, 5); // delete B-C
2076 assertEquals("A-", sq.getSequenceAsString());
2077 assertEquals(8, sq.getStart());
2078 assertEquals(8, sq.getEnd());
2079 assertEquals("ABC", sq.getDatasetSequence().getSequenceAsString());
2082 * delete gaps and residues internally (new dataset sequence)
2083 * first delete from gap to residue
2085 sq = new Sequence("test/8-10", "A-B-C");
2086 sq.createDatasetSequence();
2087 sq.deleteChars(1, 3); // delete -B
2088 assertEquals("A-C", sq.getSequenceAsString());
2089 assertEquals(8, sq.getStart());
2090 assertEquals(9, sq.getEnd());
2091 assertEquals("AC", sq.getDatasetSequence().getSequenceAsString());
2092 assertEquals(8, sq.getDatasetSequence().getStart());
2093 assertEquals(9, sq.getDatasetSequence().getEnd());
2096 * internal delete from gap to gap
2098 sq = new Sequence("test/8-10", "A-B-C");
2099 sq.createDatasetSequence();
2100 sq.deleteChars(1, 4); // delete -B-
2101 assertEquals("AC", sq.getSequenceAsString());
2102 assertEquals(8, sq.getStart());
2103 assertEquals(9, sq.getEnd());
2104 assertEquals("AC", sq.getDatasetSequence().getSequenceAsString());
2105 assertEquals(8, sq.getDatasetSequence().getStart());
2106 assertEquals(9, sq.getDatasetSequence().getEnd());
2109 * internal delete from residue to residue
2111 sq = new Sequence("test/8-10", "A-B-C");
2112 sq.createDatasetSequence();
2113 sq.deleteChars(2, 3); // delete B
2114 assertEquals("A--C", sq.getSequenceAsString());
2115 assertEquals(8, sq.getStart());
2116 assertEquals(9, sq.getEnd());
2117 assertEquals("AC", sq.getDatasetSequence().getSequenceAsString());
2118 assertEquals(8, sq.getDatasetSequence().getStart());
2119 assertEquals(9, sq.getDatasetSequence().getEnd());
2123 * Test the code used to locate the reference sequence ruler origin
2125 @Test(groups = { "Functional" })
2126 public void testLocateVisibleStartofSequence()
2128 // create random alignment
2129 AlignmentGenerator gen = new AlignmentGenerator(false);
2130 AlignmentI al = gen.generate(50, 20, 123, 5, 5);
2132 HiddenColumns cs = al.getHiddenColumns();
2133 ColumnSelection colsel = new ColumnSelection();
2135 SequenceI seq = new Sequence("RefSeq", "-A-SD-ASD--E---");
2136 assertEquals(2, seq.findIndex(seq.getStart()));
2138 // no hidden columns
2139 assertEquals(seq.findIndex(seq.getStart()) - 1,
2140 seq.firstResidueOutsideIterator(cs.iterator()));
2142 // hidden column on gap after end of sequence - should not affect bounds
2143 colsel.hideSelectedColumns(13, al.getHiddenColumns());
2144 assertEquals(seq.findIndex(seq.getStart()) - 1,
2145 seq.firstResidueOutsideIterator(cs.iterator()));
2147 cs.revealAllHiddenColumns(colsel);
2148 // hidden column on gap before beginning of sequence - should vis bounds by
2150 colsel.hideSelectedColumns(0, al.getHiddenColumns());
2151 assertEquals(seq.findIndex(seq.getStart()) - 2,
2152 cs.absoluteToVisibleColumn(
2153 seq.firstResidueOutsideIterator(cs.iterator())));
2155 cs.revealAllHiddenColumns(colsel);
2156 // hide columns around most of sequence - leave one residue remaining
2157 cs.hideColumns(1, 3);
2158 cs.hideColumns(6, 11);
2160 Iterator<int[]> it = cs.getVisContigsIterator(0, 6, false);
2162 assertEquals("-D", seq.getSequenceStringFromIterator(it));
2163 // cs.getVisibleSequenceStrings(0, 5, new SequenceI[]
2166 assertEquals(4, seq.firstResidueOutsideIterator(cs.iterator()));
2167 cs.revealAllHiddenColumns(colsel);
2169 // hide whole sequence - should just get location of hidden region
2170 // containing sequence
2171 cs.hideColumns(1, 11);
2172 assertEquals(0, seq.firstResidueOutsideIterator(cs.iterator()));
2174 cs.revealAllHiddenColumns(colsel);
2175 cs.hideColumns(0, 15);
2176 assertEquals(0, seq.firstResidueOutsideIterator(cs.iterator()));
2178 SequenceI seq2 = new Sequence("RefSeq2", "-------A-SD-ASD--E---");
2180 cs.revealAllHiddenColumns(colsel);
2181 cs.hideColumns(7, 17);
2182 assertEquals(0, seq2.firstResidueOutsideIterator(cs.iterator()));
2184 cs.revealAllHiddenColumns(colsel);
2185 cs.hideColumns(3, 17);
2186 assertEquals(0, seq2.firstResidueOutsideIterator(cs.iterator()));
2188 cs.revealAllHiddenColumns(colsel);
2189 cs.hideColumns(3, 19);
2190 assertEquals(0, seq2.firstResidueOutsideIterator(cs.iterator()));
2192 cs.revealAllHiddenColumns(colsel);
2193 cs.hideColumns(0, 0);
2194 assertEquals(1, seq.firstResidueOutsideIterator(cs.iterator()));
2196 cs.revealAllHiddenColumns(colsel);
2197 cs.hideColumns(0, 1);
2198 assertEquals(3, seq.firstResidueOutsideIterator(cs.iterator()));
2200 cs.revealAllHiddenColumns(colsel);
2201 cs.hideColumns(0, 2);
2202 assertEquals(3, seq.firstResidueOutsideIterator(cs.iterator()));
2204 cs.revealAllHiddenColumns(colsel);
2205 cs.hideColumns(1, 1);
2206 assertEquals(3, seq.firstResidueOutsideIterator(cs.iterator()));
2208 cs.revealAllHiddenColumns(colsel);
2209 cs.hideColumns(1, 2);
2210 assertEquals(3, seq.firstResidueOutsideIterator(cs.iterator()));
2212 cs.revealAllHiddenColumns(colsel);
2213 cs.hideColumns(1, 3);
2214 assertEquals(4, seq.firstResidueOutsideIterator(cs.iterator()));
2216 cs.revealAllHiddenColumns(colsel);
2217 cs.hideColumns(0, 2);
2218 cs.hideColumns(5, 6);
2219 assertEquals(3, seq.firstResidueOutsideIterator(cs.iterator()));
2221 cs.revealAllHiddenColumns(colsel);
2222 cs.hideColumns(0, 2);
2223 cs.hideColumns(5, 6);
2224 cs.hideColumns(9, 10);
2225 assertEquals(3, seq.firstResidueOutsideIterator(cs.iterator()));
2227 cs.revealAllHiddenColumns(colsel);
2228 cs.hideColumns(0, 2);
2229 cs.hideColumns(7, 11);
2230 assertEquals(3, seq.firstResidueOutsideIterator(cs.iterator()));
2232 cs.revealAllHiddenColumns(colsel);
2233 cs.hideColumns(2, 4);
2234 cs.hideColumns(7, 11);
2235 assertEquals(1, seq.firstResidueOutsideIterator(cs.iterator()));
2237 cs.revealAllHiddenColumns(colsel);
2238 cs.hideColumns(2, 4);
2239 cs.hideColumns(7, 12);
2240 assertEquals(1, seq.firstResidueOutsideIterator(cs.iterator()));
2242 cs.revealAllHiddenColumns(colsel);
2243 cs.hideColumns(1, 11);
2244 assertEquals(0, seq.firstResidueOutsideIterator(cs.iterator()));
2246 cs.revealAllHiddenColumns(colsel);
2247 cs.hideColumns(0, 12);
2248 assertEquals(0, seq.firstResidueOutsideIterator(cs.iterator()));
2250 cs.revealAllHiddenColumns(colsel);
2251 cs.hideColumns(0, 4);
2252 cs.hideColumns(6, 12);
2253 assertEquals(0, seq.firstResidueOutsideIterator(cs.iterator()));
2255 cs.revealAllHiddenColumns(colsel);
2256 cs.hideColumns(0, 1);
2257 cs.hideColumns(3, 12);
2258 assertEquals(0, seq.firstResidueOutsideIterator(cs.iterator()));
2260 cs.revealAllHiddenColumns(colsel);
2261 cs.hideColumns(3, 14);
2262 cs.hideColumns(17, 19);
2263 assertEquals(0, seq2.firstResidueOutsideIterator(cs.iterator()));
2265 cs.revealAllHiddenColumns(colsel);
2266 cs.hideColumns(3, 7);
2267 cs.hideColumns(9, 14);
2268 cs.hideColumns(17, 19);
2269 assertEquals(0, seq2.firstResidueOutsideIterator(cs.iterator()));
2271 cs.revealAllHiddenColumns(colsel);
2272 cs.hideColumns(0, 1);
2273 cs.hideColumns(3, 4);
2274 cs.hideColumns(6, 8);
2275 cs.hideColumns(10, 12);
2276 assertEquals(0, seq.firstResidueOutsideIterator(cs.iterator()));
2280 @Test(groups = { "Functional" })
2281 public void testTransferAnnotation()
2283 Sequence origSeq = new Sequence("MYSEQ", "THISISASEQ");
2284 Sequence toSeq = new Sequence("MYSEQ", "THISISASEQ");
2285 origSeq.addDBRef(new DBRefEntry("UNIPROT", "0", "Q12345", null, true));
2286 toSeq.transferAnnotation(origSeq, null);
2287 assertTrue(toSeq.getDBRefs().size() == 1);
2289 assertTrue(toSeq.getDBRefs().get(0).isCanonical());
2291 // check for promotion of non-canonical
2292 // to canonical (e.g. fetch-db-refs on a jalview project pre 2.11.2)
2293 toSeq.setDBRefs(null);
2294 toSeq.addDBRef(new DBRefEntry("UNIPROT", "0", "Q12345", null, false));
2295 toSeq.transferAnnotation(origSeq, null);
2296 assertTrue(toSeq.getDBRefs().size() == 1);
2298 assertTrue("Promotion of non-canonical DBRefEntry failed",
2299 toSeq.getDBRefs().get(0).isCanonical());