3 import static org.testng.AssertJUnit.assertEquals;
4 import static org.testng.AssertJUnit.assertSame;
5 import static org.testng.AssertJUnit.assertTrue;
6 import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
8 import jalview.datamodel.AlignedCodonFrame;
9 import jalview.datamodel.Alignment;
10 import jalview.datamodel.AlignmentI;
11 import jalview.datamodel.Mapping;
12 import jalview.datamodel.Sequence;
13 import jalview.datamodel.SequenceDummy;
14 import jalview.datamodel.SequenceI;
15 import jalview.gui.AlignFrame;
19 import org.testng.annotations.Test;
22 * Tests of use cases that include parsing exonerate GFF 'similarity' features.
23 * These describe mappings between protein and cDNA
28 public class ExonerateGffTest
32 * Test the case where we load a protein ('query') sequence, then exonerateGff
33 * describing its mapping to cDNA, and then a DNA sequence including the
36 @Test(groups = "Functional")
37 public void testLoadProteinGffCdna()
39 String proteinSeq = ">prot1/10-16\nYCWRSGA";
40 AlignFrame af = new FileLoader(false).LoadFileWaitTillLoaded(
41 proteinSeq, FormatAdapter.PASTE);
44 * exonerate GFF output mapping residues 11-15 (CWRSG)
45 * to bases 24-10 in sequence 'dna1' (reverse strand)
47 String exonerateGff = "##gff-version 2\n"
48 + "prot1\tprotein2genome\tsimilarity\t11\t15\t99\t-\t.\talignment_id 0 ; Target dna1 ; Align 11 24 5";
49 af.loadJalviewDataFile(exonerateGff, FormatAdapter.PASTE, null, null);
52 * check we have a mapping from prot1 to SequenceDummy 'dna1'
54 AlignmentI dataset = af.getViewport().getAlignment().getDataset();
55 assertEquals(1, dataset.getSequences().size());
56 assertEquals("prot1", dataset.getSequenceAt(0).getName());
57 assertEquals("YCWRSGA", dataset.getSequenceAt(0).getSequenceAsString());
58 Set<AlignedCodonFrame> mappings = dataset.getCodonFrames();
59 assertEquals(1, mappings.size());
60 AlignedCodonFrame mapping = mappings.iterator().next();
61 SequenceI mappedDna = mapping.getDnaForAaSeq(dataset.getSequenceAt(0));
62 assertTrue(mappedDna instanceof SequenceDummy);
63 assertEquals("dna1", mappedDna.getName());
64 Mapping[] mapList = mapping.getProtMappings();
65 assertEquals(1, mapList.length);
66 // 11 in protein should map to codon [24, 23, 22] in dna
67 int[] mappedRegion = mapList[0].getMap().locateInFrom(11, 11);
68 assertArrayEquals(new int[] { 24, 22 }, mappedRegion);
69 // 15 in protein should map to codon [12, 11, 10] in dna
70 mappedRegion = mapList[0].getMap().locateInFrom(15, 15);
71 assertArrayEquals(new int[] { 12, 10 }, mappedRegion);
73 // so far so good; TODO: programmatically add mapped sequences
74 // and verify the mappings are 'realised'
75 SequenceI dna1 = new Sequence("dna1", "AAACCCGGGTTTAAACCCGGGTTT");
76 AlignmentI al = new Alignment(new SequenceI[] { dna1 });
80 * Now 'realise' the virtual mapping to the real DNA sequence;
81 * interactively this could be by a drag or fetch of the sequence data
83 mapping.realiseWith(dna1);
84 // verify the mapping is now from the real, not the dummy sequence
85 assertSame(dna1.getDatasetSequence(),
86 mapping.getDnaForAaSeq(dataset.getSequenceAt(0)));