1 package jalview.io.vcf;
3 import static jalview.io.gff.SequenceOntologyI.SEQUENCE_VARIANT;
4 import static org.testng.Assert.assertEquals;
5 import static org.testng.Assert.assertNull;
6 import static org.testng.Assert.assertTrue;
8 import jalview.bin.Cache;
9 import jalview.datamodel.AlignmentI;
10 import jalview.datamodel.DBRefEntry;
11 import jalview.datamodel.Mapping;
12 import jalview.datamodel.Sequence;
13 import jalview.datamodel.SequenceFeature;
14 import jalview.datamodel.SequenceI;
15 import jalview.datamodel.features.FeatureAttributes;
16 import jalview.datamodel.features.SequenceFeatures;
17 import jalview.gui.AlignFrame;
18 import jalview.io.DataSourceType;
19 import jalview.io.FileLoader;
20 import jalview.io.gff.Gff3Helper;
21 import jalview.util.MapList;
24 import java.io.IOException;
25 import java.io.PrintWriter;
26 import java.util.List;
29 import org.testng.annotations.BeforeClass;
30 import org.testng.annotations.BeforeTest;
31 import org.testng.annotations.Test;
33 public class VCFLoaderTest
35 private static final float DELTA = 0.00001f;
37 // columns 9717- of gene P30419 from Ensembl (much modified)
38 private static final String FASTA = ""
41 * forward strand 'gene' and 'transcript' with two exons
43 ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n"
44 + "CAAGCTGGCGGACGAGAGTGTGACA\n"
45 + ">transcript1/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
48 * reverse strand gene and transcript (reverse complement alleles!)
50 + ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n"
51 + "TGTCACACTCTCGTCCGCCAGCTTG\n"
52 + ">transcript2/1-18\n" + "-GTCACACTCT----CGCCAGCT--\n"
55 * 'gene' on chromosome 5 with two transcripts
57 + ">gene3/1-25 chromosome:GRCh38:5:45051610:45051634:1\n"
58 + "CAAGCTGGCGGACGAGAGTGTGACA\n"
59 + ">transcript3/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
60 + ">transcript4/1-18\n-----TGG-GGACGAGAGTGTGA-A\n";
62 private static final String[] VCF = { "##fileformat=VCFv4.2",
63 // fields other than AF are ignored when parsing as they have no INFO definition
64 "##INFO=<ID=AF,Number=A,Type=Float,Description=\"Allele Frequency, for each ALT allele, in the same order as listed\">",
65 "##INFO=<ID=AC_Female,Number=A,Type=Integer,Description=\"Allele count in Female genotypes\"",
66 "##INFO=<ID=AF_AFR,Number=A,Type=Float,Description=\"Allele Frequency among African/African American genotypes\"",
67 "##reference=Homo_sapiens/GRCh38",
68 "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO",
69 // A/T,C variants in position 2 of gene sequence (precedes transcript)
70 // should create 2 variant features with respective AF values
71 // malformed values for AC_Female and AF_AFR should be ignored
72 "17\t45051611\trs384765\tA\tT,C\t1666.64\tRF;XYZ\tAC=15;AF=5.0e-03,4.0e-03;AC_Female=12,3d;AF_AFR=low,2.3e-4",
73 // SNP G/C in position 4 of gene sequence, position 2 of transcript
74 // insertion G/GA is transferred to nucleotide but not to peptide
75 "17\t45051613\t.\tG\tGA,C\t1666.65\t.\tAC=15;AF=3.0e-03,2.0e-03",
76 // '.' in INFO field should be ignored
77 "17\t45051615\t.\tG\tC\t1666.66\tRF\tAC=16;AF=." };
79 @BeforeClass(alwaysRun = true)
83 * configure to capture all available VCF and VEP (CSQ) fields
85 Cache.loadProperties("test/jalview/io/testProps.jvprops");
86 Cache.setProperty("VCF_FIELDS", ".*");
87 Cache.setProperty("VEP_FIELDS", ".*");
88 Cache.setProperty("VCF_ASSEMBLY", "GRCh38=GRCh38");
92 @BeforeTest(alwaysRun = true)
93 public void setUpBeforeTest()
96 * clear down feature attributes metadata
98 FeatureAttributes.getInstance().clear();
101 @Test(groups = "Functional")
102 public void testDoLoad() throws IOException
104 AlignmentI al = buildAlignment();
106 File f = makeVcfFile();
107 VCFLoader loader = new VCFLoader(f.getPath());
109 loader.doLoad(al.getSequencesArray(), null);
112 * verify variant feature(s) added to gene
113 * NB alleles at a locus may not be processed, and features added,
114 * in the order in which they appear in the VCF record as method
115 * VariantContext.getAlternateAlleles() does not guarantee order
116 * - order of assertions here matches what we find (is not important)
118 List<SequenceFeature> geneFeatures = al.getSequenceAt(0)
119 .getSequenceFeatures();
120 SequenceFeatures.sortFeatures(geneFeatures, true);
121 assertEquals(geneFeatures.size(), 5);
122 SequenceFeature sf = geneFeatures.get(0);
123 assertEquals(sf.getFeatureGroup(), "VCF");
124 assertEquals(sf.getBegin(), 2);
125 assertEquals(sf.getEnd(), 2);
126 assertEquals(sf.getScore(), 0f);
127 assertEquals(sf.getValue("AF"), "4.0e-03");
128 assertEquals(sf.getValue("AF_AFR"), "2.3e-4");
129 assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,C");
130 assertEquals(sf.getType(), SEQUENCE_VARIANT);
131 assertEquals(sf.getValue("POS"), "45051611");
132 assertEquals(sf.getValue("ID"), "rs384765");
133 assertEquals(sf.getValue("QUAL"), "1666.64");
134 assertEquals(sf.getValue("FILTER"), "RF;XYZ");
135 // malformed integer for AC_Female is ignored (JAL-3375)
136 assertNull(sf.getValue("AC_Female"));
138 sf = geneFeatures.get(1);
139 assertEquals(sf.getFeatureGroup(), "VCF");
140 assertEquals(sf.getBegin(), 2);
141 assertEquals(sf.getEnd(), 2);
142 assertEquals(sf.getType(), SEQUENCE_VARIANT);
143 assertEquals(sf.getScore(), 0f);
144 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 5.0e-03,
146 assertEquals(sf.getValue("AC_Female"), "12");
147 // malformed float for AF_AFR is ignored (JAL-3375)
148 assertNull(sf.getValue("AC_AFR"));
149 assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,T");
151 sf = geneFeatures.get(2);
152 assertEquals(sf.getFeatureGroup(), "VCF");
153 assertEquals(sf.getBegin(), 4);
154 assertEquals(sf.getEnd(), 4);
155 assertEquals(sf.getType(), SEQUENCE_VARIANT);
156 assertEquals(sf.getScore(), 0f);
157 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
159 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
161 sf = geneFeatures.get(3);
162 assertEquals(sf.getFeatureGroup(), "VCF");
163 assertEquals(sf.getBegin(), 4);
164 assertEquals(sf.getEnd(), 4);
165 assertEquals(sf.getType(), SEQUENCE_VARIANT);
166 assertEquals(sf.getScore(), 0f);
167 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
169 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
170 assertNull(sf.getValue("ID")); // '.' is ignored
171 assertNull(sf.getValue("FILTER")); // '.' is ignored
173 sf = geneFeatures.get(4);
174 assertEquals(sf.getFeatureGroup(), "VCF");
175 assertEquals(sf.getBegin(), 6);
176 assertEquals(sf.getEnd(), 6);
177 assertEquals(sf.getType(), SEQUENCE_VARIANT);
178 assertEquals(sf.getScore(), 0f);
179 // AF=. should not have been captured
180 assertNull(sf.getValue("AF"));
181 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
184 * verify variant feature(s) added to transcript
186 List<SequenceFeature> transcriptFeatures = al.getSequenceAt(1)
187 .getSequenceFeatures();
188 assertEquals(transcriptFeatures.size(), 3);
189 sf = transcriptFeatures.get(0);
190 assertEquals(sf.getFeatureGroup(), "VCF");
191 assertEquals(sf.getBegin(), 2);
192 assertEquals(sf.getEnd(), 2);
193 assertEquals(sf.getType(), SEQUENCE_VARIANT);
194 assertEquals(sf.getScore(), 0f);
195 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
197 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
198 sf = transcriptFeatures.get(1);
199 assertEquals(sf.getFeatureGroup(), "VCF");
200 assertEquals(sf.getBegin(), 2);
201 assertEquals(sf.getEnd(), 2);
202 assertEquals(sf.getType(), SEQUENCE_VARIANT);
203 assertEquals(sf.getScore(), 0f);
204 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
206 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
209 * verify SNP variant feature(s) computed and added to protein
210 * first codon AGC varies to ACC giving S/T
212 DBRefEntry[] dbRefs = al.getSequenceAt(1).getDBRefs();
213 SequenceI peptide = null;
214 for (DBRefEntry dbref : dbRefs)
216 if (dbref.getMap().getMap().getFromRatio() == 3)
218 peptide = dbref.getMap().getTo();
221 List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
224 * JAL-3187 don't precompute protein features, do dynamically instead
226 assertTrue(proteinFeatures.isEmpty());
229 private File makeVcfFile() throws IOException
231 File f = File.createTempFile("Test", ".vcf");
233 PrintWriter pw = new PrintWriter(f);
234 for (String vcfLine : VCF)
243 * Make a simple alignment with one 'gene' and one 'transcript'
247 private AlignmentI buildAlignment()
249 AlignFrame af = new FileLoader().LoadFileWaitTillLoaded(FASTA,
250 DataSourceType.PASTE);
253 * map gene1 sequence to chromosome (normally done when the sequence is fetched
254 * from Ensembl and transcripts computed)
256 AlignmentI alignment = af.getViewport().getAlignment();
257 SequenceI gene1 = alignment.findName("gene1");
258 int[] to = new int[] { 45051610, 45051634 };
259 int[] from = new int[] { gene1.getStart(), gene1.getEnd() };
260 gene1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
264 * map 'transcript1' to chromosome via 'gene1'
265 * transcript1/1-18 is gene1/3-10,15-24
266 * which is chromosome 45051612-45051619,45051624-45051633
268 to = new int[] { 45051612, 45051619, 45051624, 45051633 };
269 SequenceI transcript1 = alignment.findName("transcript1");
270 from = new int[] { transcript1.getStart(), transcript1.getEnd() };
271 transcript1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
276 * map gene2 to chromosome reverse strand
278 SequenceI gene2 = alignment.findName("gene2");
279 to = new int[] { 45051634, 45051610 };
280 from = new int[] { gene2.getStart(), gene2.getEnd() };
281 gene2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
285 * map 'transcript2' to chromosome via 'gene2'
286 * transcript2/1-18 is gene2/2-11,16-23
287 * which is chromosome 45051633-45051624,45051619-45051612
289 to = new int[] { 45051633, 45051624, 45051619, 45051612 };
290 SequenceI transcript2 = alignment.findName("transcript2");
291 from = new int[] { transcript2.getStart(), transcript2.getEnd() };
292 transcript2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
297 * add a protein product as a DBRef on transcript1
299 SequenceI peptide1 = new Sequence("ENSP001", "SWRECD");
300 MapList mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 },
302 Mapping map = new Mapping(peptide1, mapList);
303 DBRefEntry product = new DBRefEntry("", "", "ENSP001", map);
304 transcript1.addDBRef(product);
307 * add a protein product as a DBRef on transcript2
309 SequenceI peptide2 = new Sequence("ENSP002", "VTLSPA");
310 mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
311 map = new Mapping(peptide2, mapList);
312 product = new DBRefEntry("", "", "ENSP002", map);
313 transcript2.addDBRef(product);
316 * map gene3 to chromosome
318 SequenceI gene3 = alignment.findName("gene3");
319 to = new int[] { 45051610, 45051634 };
320 from = new int[] { gene3.getStart(), gene3.getEnd() };
321 gene3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(from, to,
325 * map 'transcript3' to chromosome
327 SequenceI transcript3 = alignment.findName("transcript3");
328 to = new int[] { 45051612, 45051619, 45051624, 45051633 };
329 from = new int[] { transcript3.getStart(), transcript3.getEnd() };
330 transcript3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
335 * map 'transcript4' to chromosome
337 SequenceI transcript4 = alignment.findName("transcript4");
338 to = new int[] { 45051615, 45051617, 45051619, 45051632, 45051634,
340 from = new int[] { transcript4.getStart(), transcript4.getEnd() };
341 transcript4.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
346 * add a protein product as a DBRef on transcript3
348 SequenceI peptide3 = new Sequence("ENSP003", "SWRECD");
349 mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
350 map = new Mapping(peptide3, mapList);
351 product = new DBRefEntry("", "", "ENSP003", map);
352 transcript3.addDBRef(product);
358 * Test with 'gene' and 'transcript' mapped to the reverse strand of the
359 * chromosome. The VCF variant positions (in forward coordinates) should get
360 * correctly located on sequence positions.
362 * @throws IOException
364 @Test(groups = "Functional")
365 public void testDoLoad_reverseStrand() throws IOException
367 AlignmentI al = buildAlignment();
369 File f = makeVcfFile();
371 VCFLoader loader = new VCFLoader(f.getPath());
373 loader.doLoad(al.getSequencesArray(), null);
376 * verify variant feature(s) added to gene2
377 * gene2/1-25 maps to chromosome 45051634- reverse strand
379 List<SequenceFeature> geneFeatures = al.getSequenceAt(2)
380 .getSequenceFeatures();
381 SequenceFeatures.sortFeatures(geneFeatures, true);
382 assertEquals(geneFeatures.size(), 5);
386 * insertion G/GA at 45051613 maps to an insertion at
387 * the preceding position (21) on reverse strand gene
388 * reference: CAAGC -> GCTTG/21-25
389 * genomic variant: CAAGAC (G/GA)
390 * gene variant: GTCTTG (G/GT at 21)
392 sf = geneFeatures.get(1);
393 assertEquals(sf.getFeatureGroup(), "VCF");
394 assertEquals(sf.getBegin(), 21);
395 assertEquals(sf.getEnd(), 21);
396 assertEquals(sf.getType(), SEQUENCE_VARIANT);
397 assertEquals(sf.getScore(), 0f);
398 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
399 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
403 * variant G/C at 45051613 maps to C/G at gene position 22
405 sf = geneFeatures.get(2);
406 assertEquals(sf.getFeatureGroup(), "VCF");
407 assertEquals(sf.getBegin(), 22);
408 assertEquals(sf.getEnd(), 22);
409 assertEquals(sf.getType(), SEQUENCE_VARIANT);
410 assertEquals(sf.getScore(), 0f);
411 assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
412 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
416 * variant A/C at 45051611 maps to T/G at gene position 24
418 sf = geneFeatures.get(3);
419 assertEquals(sf.getFeatureGroup(), "VCF");
420 assertEquals(sf.getBegin(), 24);
421 assertEquals(sf.getEnd(), 24);
422 assertEquals(sf.getType(), SEQUENCE_VARIANT);
423 assertEquals(sf.getScore(), 0f);
424 assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,G");
425 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 4.0e-03,
429 * variant A/T at 45051611 maps to T/A at gene position 24
431 sf = geneFeatures.get(4);
432 assertEquals(sf.getFeatureGroup(), "VCF");
433 assertEquals(sf.getBegin(), 24);
434 assertEquals(sf.getEnd(), 24);
435 assertEquals(sf.getType(), SEQUENCE_VARIANT);
436 assertEquals(sf.getScore(), 0f);
437 assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,A");
438 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 5.0e-03,
442 * verify 3 variant features added to transcript2
444 List<SequenceFeature> transcriptFeatures = al.getSequenceAt(3)
445 .getSequenceFeatures();
446 assertEquals(transcriptFeatures.size(), 3);
449 * insertion G/GT at position 21 of gene maps to position 16 of transcript
451 sf = transcriptFeatures.get(1);
452 assertEquals(sf.getFeatureGroup(), "VCF");
453 assertEquals(sf.getBegin(), 16);
454 assertEquals(sf.getEnd(), 16);
455 assertEquals(sf.getType(), SEQUENCE_VARIANT);
456 assertEquals(sf.getScore(), 0f);
457 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
458 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
462 * SNP C/G at position 22 of gene maps to position 17 of transcript
464 sf = transcriptFeatures.get(2);
465 assertEquals(sf.getFeatureGroup(), "VCF");
466 assertEquals(sf.getBegin(), 17);
467 assertEquals(sf.getEnd(), 17);
468 assertEquals(sf.getType(), SEQUENCE_VARIANT);
469 assertEquals(sf.getScore(), 0f);
470 assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
471 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
475 * verify variant feature(s) computed and added to protein
476 * last codon GCT varies to GGT giving A/G in the last peptide position
478 DBRefEntry[] dbRefs = al.getSequenceAt(3).getDBRefs();
479 SequenceI peptide = null;
480 for (DBRefEntry dbref : dbRefs)
482 if (dbref.getMap().getMap().getFromRatio() == 3)
484 peptide = dbref.getMap().getTo();
487 List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
490 * JAL-3187 don't precompute protein features, do dynamically instead
492 assertTrue(proteinFeatures.isEmpty());
496 * Tests that if VEP consequence (CSQ) data is present in the VCF data, then
497 * it is added to the variant feature, but restricted where possible to the
498 * consequences for a specific transcript
500 * @throws IOException
502 @Test(groups = "Functional")
503 public void testDoLoad_vepCsq() throws IOException
505 AlignmentI al = buildAlignment();
507 VCFLoader loader = new VCFLoader("test/jalview/io/vcf/testVcf.vcf");
510 * VCF data file with variants at gene3 positions
515 * 17 A/AC (insertion), A/G
517 loader.doLoad(al.getSequencesArray(), null);
520 * verify variant feature(s) added to gene3
522 List<SequenceFeature> geneFeatures = al.findName("gene3")
523 .getSequenceFeatures();
524 SequenceFeatures.sortFeatures(geneFeatures, true);
525 assertEquals(geneFeatures.size(), 7);
526 SequenceFeature sf = geneFeatures.get(0);
527 assertEquals(sf.getBegin(), 1);
528 assertEquals(sf.getEnd(), 1);
529 assertEquals(sf.getScore(), 0f);
530 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.1f, DELTA);
531 assertEquals(sf.getValue("alleles"), "C,A");
532 // gene features include Consequence for all transcripts
533 Map map = (Map) sf.getValue("CSQ");
534 assertEquals(map.size(), 9);
535 assertEquals(map.get("PolyPhen"), "Bad");
537 sf = geneFeatures.get(1);
538 assertEquals(sf.getBegin(), 5);
539 assertEquals(sf.getEnd(), 5);
540 assertEquals(sf.getScore(), 0f);
541 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.2f, DELTA);
542 assertEquals(sf.getValue("alleles"), "C,T");
543 map = (Map) sf.getValue("CSQ");
544 assertEquals(map.size(), 9);
545 assertEquals(map.get("PolyPhen"), "Bad;;"); // %3B%3B decoded
547 sf = geneFeatures.get(2);
548 assertEquals(sf.getBegin(), 9);
549 assertEquals(sf.getEnd(), 11); // deletion over 3 positions
550 assertEquals(sf.getScore(), 0f);
551 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.3f, DELTA);
552 assertEquals(sf.getValue("alleles"), "CGG,C");
553 map = (Map) sf.getValue("CSQ");
554 assertEquals(map.size(), 9);
556 sf = geneFeatures.get(3);
557 assertEquals(sf.getBegin(), 13);
558 assertEquals(sf.getEnd(), 13);
559 assertEquals(sf.getScore(), 0f);
560 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.5f, DELTA);
561 assertEquals(sf.getValue("alleles"), "C,T");
562 map = (Map) sf.getValue("CSQ");
563 assertEquals(map.size(), 9);
565 sf = geneFeatures.get(4);
566 assertEquals(sf.getBegin(), 13);
567 assertEquals(sf.getEnd(), 13);
568 assertEquals(sf.getScore(), 0f);
569 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.4f, DELTA);
570 assertEquals(sf.getValue("alleles"), "C,G");
571 map = (Map) sf.getValue("CSQ");
572 assertEquals(map.size(), 9);
574 sf = geneFeatures.get(5);
575 assertEquals(sf.getBegin(), 17);
576 assertEquals(sf.getEnd(), 17);
577 assertEquals(sf.getScore(), 0f);
578 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
579 assertEquals(sf.getValue("alleles"), "A,G");
580 map = (Map) sf.getValue("CSQ");
581 assertEquals(map.size(), 9);
583 sf = geneFeatures.get(6);
584 assertEquals(sf.getBegin(), 17);
585 assertEquals(sf.getEnd(), 17); // insertion
586 assertEquals(sf.getScore(), 0f);
587 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
588 assertEquals(sf.getValue("alleles"), "A,AC");
589 map = (Map) sf.getValue("CSQ");
590 assertEquals(map.size(), 9);
593 * verify variant feature(s) added to transcript3
594 * at columns 5 (1), 17 (2), positions 3, 11
595 * note the deletion at columns 9-11 is not transferred since col 11
596 * has no mapping to transcript 3
598 List<SequenceFeature> transcriptFeatures = al.findName("transcript3")
599 .getSequenceFeatures();
600 SequenceFeatures.sortFeatures(transcriptFeatures, true);
601 assertEquals(transcriptFeatures.size(), 3);
602 sf = transcriptFeatures.get(0);
603 assertEquals(sf.getBegin(), 3);
604 assertEquals(sf.getEnd(), 3);
605 assertEquals(sf.getScore(), 0f);
606 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.2f, DELTA);
607 assertEquals(sf.getValue("alleles"), "C,T");
608 // transcript features only have Consequence for that transcripts
609 map = (Map) sf.getValue("CSQ");
610 assertEquals(map.size(), 9);
611 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
613 sf = transcriptFeatures.get(1);
614 assertEquals(sf.getBegin(), 11);
615 assertEquals(sf.getEnd(), 11);
616 assertEquals(sf.getScore(), 0f);
617 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
618 assertEquals(sf.getValue("alleles"), "A,G");
619 assertEquals(map.size(), 9);
620 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
622 sf = transcriptFeatures.get(2);
623 assertEquals(sf.getBegin(), 11);
624 assertEquals(sf.getEnd(), 11);
625 assertEquals(sf.getScore(), 0f);
626 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
627 assertEquals(sf.getValue("alleles"), "A,AC");
628 assertEquals(map.size(), 9);
629 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
632 * verify variants computed on protein product for transcript3
634 * codon variants are AGC/AGT position 1 which is synonymous
635 * and GAG/GGG which is E/G in position 4
636 * the insertion variant is not transferred to the peptide
638 DBRefEntry[] dbRefs = al.findName("transcript3").getDBRefs();
639 SequenceI peptide = null;
640 for (DBRefEntry dbref : dbRefs)
642 if (dbref.getMap().getMap().getFromRatio() == 3)
644 peptide = dbref.getMap().getTo();
647 List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
649 * JAL-3187 don't precompute protein features, do dynamically instead
651 assertTrue(proteinFeatures.isEmpty());
652 // SequenceFeatures.sortFeatures(proteinFeatures, true);
653 // assertEquals(proteinFeatures.size(), 2);
654 // sf = proteinFeatures.get(0);
655 // assertEquals(sf.getFeatureGroup(), "VCF");
656 // assertEquals(sf.getBegin(), 1);
657 // assertEquals(sf.getEnd(), 1);
658 // assertEquals(sf.getType(), SequenceOntologyI.SYNONYMOUS_VARIANT);
659 // assertEquals(sf.getDescription(), "agC/agT");
660 // sf = proteinFeatures.get(1);
661 // assertEquals(sf.getFeatureGroup(), "VCF");
662 // assertEquals(sf.getBegin(), 4);
663 // assertEquals(sf.getEnd(), 4);
664 // assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
665 // assertEquals(sf.getDescription(), "p.Glu4Gly");
668 * verify variant feature(s) added to transcript4
669 * at columns 13 (2) and 17 (2), positions 7 and 11
671 transcriptFeatures = al.findName("transcript4").getSequenceFeatures();
672 SequenceFeatures.sortFeatures(transcriptFeatures, true);
673 assertEquals(transcriptFeatures.size(), 4);
674 sf = transcriptFeatures.get(0);
675 assertEquals(sf.getBegin(), 7);
676 assertEquals(sf.getEnd(), 7);
677 assertEquals(sf.getScore(), 0f);
678 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.5f, DELTA);
679 assertEquals(sf.getValue("alleles"), "C,T");
680 assertEquals(map.size(), 9);
681 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
683 sf = transcriptFeatures.get(1);
684 assertEquals(sf.getBegin(), 7);
685 assertEquals(sf.getEnd(), 7);
686 assertEquals(sf.getScore(), 0f);
687 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.4f, DELTA);
688 assertEquals(sf.getValue("alleles"), "C,G");
689 assertEquals(map.size(), 9);
690 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
692 sf = transcriptFeatures.get(2);
693 assertEquals(sf.getBegin(), 11);
694 assertEquals(sf.getEnd(), 11);
695 assertEquals(sf.getScore(), 0f);
696 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
697 assertEquals(sf.getValue("alleles"), "A,G");
698 assertEquals(map.size(), 9);
699 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
701 sf = transcriptFeatures.get(3);
702 assertEquals(sf.getBegin(), 11);
703 assertEquals(sf.getEnd(), 11);
704 assertEquals(sf.getScore(), 0f);
705 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
706 assertEquals(sf.getValue("alleles"), "A,AC");
707 assertEquals(map.size(), 9);
708 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
712 * A test that demonstrates loading a contig sequence from an indexed sequence
713 * database which is the reference for a VCF file
715 * @throws IOException
717 @Test(groups = "Functional")
718 public void testLoadVCFContig() throws IOException
720 VCFLoader loader = new VCFLoader(
721 "test/jalview/io/vcf/testVcf2.vcf");
723 SequenceI seq = loader.loadVCFContig("contig123");
724 assertEquals(seq.getLength(), 15);
725 assertEquals(seq.getSequenceAsString(), "AAAAACCCCCGGGGG");
726 List<SequenceFeature> features = seq.getSequenceFeatures();
727 SequenceFeatures.sortFeatures(features, true);
728 assertEquals(features.size(), 2);
729 SequenceFeature sf = features.get(0);
730 assertEquals(sf.getBegin(), 8);
731 assertEquals(sf.getEnd(), 8);
732 assertEquals(sf.getDescription(), "C,A");
733 sf = features.get(1);
734 assertEquals(sf.getBegin(), 12);
735 assertEquals(sf.getEnd(), 12);
736 assertEquals(sf.getDescription(), "G,T");
738 seq = loader.loadVCFContig("contig789");
739 assertEquals(seq.getLength(), 25);
740 assertEquals(seq.getSequenceAsString(), "GGGGGTTTTTAAAAACCCCCGGGGG");
741 features = seq.getSequenceFeatures();
742 SequenceFeatures.sortFeatures(features, true);
743 assertEquals(features.size(), 2);
744 sf = features.get(0);
745 assertEquals(sf.getBegin(), 2);
746 assertEquals(sf.getEnd(), 2);
747 assertEquals(sf.getDescription(), "G,T");
748 sf = features.get(1);
749 assertEquals(sf.getBegin(), 21);
750 assertEquals(sf.getEnd(), 21);
751 assertEquals(sf.getDescription(), "G,A");
753 seq = loader.loadVCFContig("contig456");
754 assertEquals(seq.getLength(), 20);
755 assertEquals(seq.getSequenceAsString(), "CCCCCGGGGGTTTTTAAAAA");
756 features = seq.getSequenceFeatures();
757 SequenceFeatures.sortFeatures(features, true);
758 assertEquals(features.size(), 1);
759 sf = features.get(0);
760 assertEquals(sf.getBegin(), 15);
761 assertEquals(sf.getEnd(), 15);
762 assertEquals(sf.getDescription(), "T,C");