1 package jalview.io.vcf;
3 import static org.testng.Assert.assertEquals;
4 import static org.testng.Assert.assertTrue;
6 import jalview.datamodel.AlignmentI;
7 import jalview.datamodel.DBRefEntry;
8 import jalview.datamodel.Mapping;
9 import jalview.datamodel.Sequence;
10 import jalview.datamodel.SequenceFeature;
11 import jalview.datamodel.SequenceI;
12 import jalview.datamodel.features.SequenceFeatures;
13 import jalview.gui.AlignFrame;
14 import jalview.io.DataSourceType;
15 import jalview.io.FileLoader;
16 import jalview.io.gff.Gff3Helper;
17 import jalview.io.gff.SequenceOntologyI;
18 import jalview.util.MapList;
21 import java.io.IOException;
22 import java.io.PrintWriter;
23 import java.util.List;
25 import org.testng.annotations.Test;
27 public class VCFLoaderTest
29 private static final float DELTA = 0.00001f;
31 // columns 9717- of gene P30419 from Ensembl (much modified)
32 private static final String FASTA = ""
35 * forward strand 'gene' and 'transcript' with two exons
37 ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n"
38 + "CAAGCTGGCGGACGAGAGTGTGACA\n"
39 + ">transcript1/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
42 * reverse strand gene and transcript (reverse complement alleles!)
44 + ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n"
45 + "TGTCACACTCTCGTCCGCCAGCTTG\n"
46 + ">transcript2/1-18\n" + "-GTCACACTCT----CGCCAGCT--\n"
49 * 'gene' on chromosome 5 with two transcripts
51 + ">gene3/1-25 chromosome:GRCh38:5:45051610:45051634:1\n"
52 + "CAAGCTGGCGGACGAGAGTGTGACA\n"
53 + ">transcript3/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
54 + ">transcript4/1-18\n-----TGG-GGACGAGAGTGTGA-A\n";
56 private static final String[] VCF = { "##fileformat=VCFv4.2",
57 "##INFO=<ID=AF,Number=A,Type=Float,Description=\"Allele Frequency, for each ALT allele, in the same order as listed\">",
59 "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO",
60 // A/T,C variants in position 2 of gene sequence (precedes transcript)
61 // should create 2 variant features with respective scores
62 "17\t45051611\t.\tA\tT,C\t1666.64\tRF\tAC=15;AF=5.0e-03,4.0e-03",
63 // SNP G/C in position 4 of gene sequence, position 2 of transcript
64 // insertion G/GA is transferred to nucleotide but not to peptide
65 "17\t45051613\t.\tG\tGA,C\t1666.64\tRF\tAC=15;AF=3.0e-03,2.0e-03" };
67 @Test(groups = "Functional")
68 public void testDoLoad() throws IOException
70 AlignmentI al = buildAlignment();
71 VCFLoader loader = new VCFLoader(al);
75 loader.doLoad(f.getPath(), null);
78 * verify variant feature(s) added to gene
79 * NB alleles at a locus may not be processed, and features added,
80 * in the order in which they appear in the VCF record as method
81 * VariantContext.getAlternateAlleles() does not guarantee order
82 * - order of assertions here matches what we find (is not important)
84 List<SequenceFeature> geneFeatures = al.getSequenceAt(0)
85 .getSequenceFeatures();
86 SequenceFeatures.sortFeatures(geneFeatures, true);
87 assertEquals(geneFeatures.size(), 4);
88 SequenceFeature sf = geneFeatures.get(0);
89 assertEquals(sf.getFeatureGroup(), "VCF");
90 assertEquals(sf.getBegin(), 2);
91 assertEquals(sf.getEnd(), 2);
92 assertEquals(sf.getScore(), 4.0e-03, DELTA);
93 assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,C");
94 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
95 sf = geneFeatures.get(1);
96 assertEquals(sf.getFeatureGroup(), "VCF");
97 assertEquals(sf.getBegin(), 2);
98 assertEquals(sf.getEnd(), 2);
99 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
100 assertEquals(sf.getScore(), 5.0e-03, DELTA);
101 assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,T");
103 sf = geneFeatures.get(2);
104 assertEquals(sf.getFeatureGroup(), "VCF");
105 assertEquals(sf.getBegin(), 4);
106 assertEquals(sf.getEnd(), 4);
107 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
108 assertEquals(sf.getScore(), 2.0e-03, DELTA);
109 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
111 sf = geneFeatures.get(3);
112 assertEquals(sf.getFeatureGroup(), "VCF");
113 assertEquals(sf.getBegin(), 4);
114 assertEquals(sf.getEnd(), 4);
115 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
116 assertEquals(sf.getScore(), 3.0e-03, DELTA);
117 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
120 * verify variant feature(s) added to transcript
122 List<SequenceFeature> transcriptFeatures = al.getSequenceAt(1)
123 .getSequenceFeatures();
124 assertEquals(transcriptFeatures.size(), 2);
125 sf = transcriptFeatures.get(0);
126 assertEquals(sf.getFeatureGroup(), "VCF");
127 assertEquals(sf.getBegin(), 2);
128 assertEquals(sf.getEnd(), 2);
129 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
130 assertEquals(sf.getScore(), 2.0e-03, DELTA);
131 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
132 sf = transcriptFeatures.get(1);
133 assertEquals(sf.getFeatureGroup(), "VCF");
134 assertEquals(sf.getBegin(), 2);
135 assertEquals(sf.getEnd(), 2);
136 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
137 assertEquals(sf.getScore(), 3.0e-03, DELTA);
138 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
141 * verify SNP variant feature(s) computed and added to protein
142 * first codon AGC varies to ACC giving S/T
144 DBRefEntry[] dbRefs = al.getSequenceAt(1).getDBRefs();
145 SequenceI peptide = null;
146 for (DBRefEntry dbref : dbRefs)
148 if (dbref.getMap().getMap().getFromRatio() == 3)
150 peptide = dbref.getMap().getTo();
153 List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
154 assertEquals(proteinFeatures.size(), 1);
155 sf = proteinFeatures.get(0);
156 assertEquals(sf.getFeatureGroup(), "VCF");
157 assertEquals(sf.getBegin(), 1);
158 assertEquals(sf.getEnd(), 1);
159 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
160 assertEquals(sf.getDescription(), "p.Ser1Thr");
163 private File makeVcf() throws IOException
165 File f = File.createTempFile("Test", ".vcf");
167 PrintWriter pw = new PrintWriter(f);
168 for (String vcfLine : VCF)
177 * Make a simple alignment with one 'gene' and one 'transcript'
181 private AlignmentI buildAlignment()
183 AlignFrame af = new FileLoader().LoadFileWaitTillLoaded(FASTA,
184 DataSourceType.PASTE);
187 * map gene1 sequence to chromosome (normally done when the sequence is fetched
188 * from Ensembl and transcripts computed)
190 AlignmentI alignment = af.getViewport().getAlignment();
191 SequenceI gene1 = alignment.findName("gene1");
192 int[] to = new int[] { 45051610, 45051634 };
193 int[] from = new int[] { gene1.getStart(), gene1.getEnd() };
194 gene1.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, 1, 1));
197 * map 'transcript1' to chromosome via 'gene1'
198 * transcript1/1-18 is gene1/3-10,15-24
199 * which is chromosome 45051612-45051619,45051624-45051633
201 to = new int[] { 45051612, 45051619, 45051624, 45051633 };
202 SequenceI transcript1 = alignment.findName("transcript1");
203 from = new int[] { transcript1.getStart(), transcript1.getEnd() };
204 transcript1.setGeneLoci("human", "GRCh38", "17", new MapList(from, to,
208 * map gene2 to chromosome reverse strand
210 SequenceI gene2 = alignment.findName("gene2");
211 to = new int[] { 45051634, 45051610 };
212 from = new int[] { gene2.getStart(), gene2.getEnd() };
213 gene2.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, 1, 1));
216 * map 'transcript2' to chromosome via 'gene2'
217 * transcript2/1-18 is gene2/2-11,16-23
218 * which is chromosome 45051633-45051624,45051619-45051612
220 to = new int[] { 45051633, 45051624, 45051619, 45051612 };
221 SequenceI transcript2 = alignment.findName("transcript2");
222 from = new int[] { transcript2.getStart(), transcript2.getEnd() };
223 transcript2.setGeneLoci("human", "GRCh38", "17", new MapList(from, to,
227 * add a protein product as a DBRef on transcript1
229 SequenceI peptide1 = new Sequence("ENSP001", "SWRECD");
230 MapList mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 },
232 Mapping map = new Mapping(peptide1, mapList);
233 DBRefEntry product = new DBRefEntry("", "", "ENSP001", map);
234 transcript1.addDBRef(product);
237 * add a protein product as a DBRef on transcript2
239 SequenceI peptide2 = new Sequence("ENSP002", "VTLSPA");
240 mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
241 map = new Mapping(peptide2, mapList);
242 product = new DBRefEntry("", "", "ENSP002", map);
243 transcript2.addDBRef(product);
246 * map gene3 to chromosome
248 SequenceI gene3 = alignment.findName("gene3");
249 to = new int[] { 45051610, 45051634 };
250 from = new int[] { gene3.getStart(), gene3.getEnd() };
251 gene3.setGeneLoci("human", "GRCh38", "5", new MapList(from, to, 1, 1));
254 * map 'transcript3' to chromosome
256 SequenceI transcript3 = alignment.findName("transcript3");
257 to = new int[] { 45051612, 45051619, 45051624, 45051633 };
258 from = new int[] { transcript3.getStart(), transcript3.getEnd() };
259 transcript3.setGeneLoci("human", "GRCh38", "5", new MapList(from, to,
263 * map 'transcript4' to chromosome
265 SequenceI transcript4 = alignment.findName("transcript4");
266 to = new int[] { 45051615, 45051617, 45051619, 45051632, 45051634,
268 from = new int[] { transcript4.getStart(), transcript4.getEnd() };
269 transcript4.setGeneLoci("human", "GRCh38", "5", new MapList(from, to,
273 * add a protein product as a DBRef on transcript3
275 SequenceI peptide3 = new Sequence("ENSP003", "SWRECD");
276 mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
277 map = new Mapping(peptide3, mapList);
278 product = new DBRefEntry("", "", "ENSP003", map);
279 transcript3.addDBRef(product);
285 * Test with 'gene' and 'transcript' mapped to the reverse strand of the
286 * chromosome. The VCF variant positions (in forward coordinates) should get
287 * correctly located on sequence positions.
289 * @throws IOException
291 @Test(groups = "Functional")
292 public void testDoLoad_reverseStrand() throws IOException
294 AlignmentI al = buildAlignment();
296 VCFLoader loader = new VCFLoader(al);
300 loader.doLoad(f.getPath(), null);
303 * verify variant feature(s) added to gene2
304 * gene/1-25 maps to chromosome 45051634- reverse strand
305 * variants A/T, A/C at 45051611 and G/GA,G/C at 45051613 map to
306 * T/A, T/G and C/TC,C/G at gene positions 24 and 22 respectively
308 List<SequenceFeature> geneFeatures = al.getSequenceAt(2)
309 .getSequenceFeatures();
310 SequenceFeatures.sortFeatures(geneFeatures, true);
311 assertEquals(geneFeatures.size(), 4);
312 SequenceFeature sf = geneFeatures.get(0);
313 assertEquals(sf.getFeatureGroup(), "VCF");
314 assertEquals(sf.getBegin(), 22);
315 assertEquals(sf.getEnd(), 22);
316 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
317 assertEquals(sf.getScore(), 2.0e-03, DELTA);
318 assertEquals("C,G", sf.getValue(Gff3Helper.ALLELES));
320 sf = geneFeatures.get(1);
321 assertEquals(sf.getFeatureGroup(), "VCF");
322 assertEquals(sf.getBegin(), 22);
323 assertEquals(sf.getEnd(), 22);
324 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
325 assertEquals(sf.getScore(), 3.0e-03, DELTA);
326 assertEquals("C,TC", sf.getValue(Gff3Helper.ALLELES));
328 sf = geneFeatures.get(2);
329 assertEquals(sf.getFeatureGroup(), "VCF");
330 assertEquals(sf.getBegin(), 24);
331 assertEquals(sf.getEnd(), 24);
332 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
333 assertEquals(sf.getScore(), 4.0e-03, DELTA);
334 assertEquals("T,G", sf.getValue(Gff3Helper.ALLELES));
336 sf = geneFeatures.get(3);
337 assertEquals(sf.getFeatureGroup(), "VCF");
338 assertEquals(sf.getBegin(), 24);
339 assertEquals(sf.getEnd(), 24);
340 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
341 assertEquals(sf.getScore(), 5.0e-03, DELTA);
342 assertEquals("T,A", sf.getValue(Gff3Helper.ALLELES));
345 * verify variant feature(s) added to transcript2
346 * variants G/GA,G/C at position 22 of gene overlap and map to
347 * C/TC,C/G at position 17 of transcript
349 List<SequenceFeature> transcriptFeatures = al.getSequenceAt(3)
350 .getSequenceFeatures();
351 assertEquals(transcriptFeatures.size(), 2);
352 sf = transcriptFeatures.get(0);
353 assertEquals(sf.getFeatureGroup(), "VCF");
354 assertEquals(sf.getBegin(), 17);
355 assertEquals(sf.getEnd(), 17);
356 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
357 assertEquals(sf.getScore(), 2.0e-03, DELTA);
358 assertEquals("C,G", sf.getValue(Gff3Helper.ALLELES));
360 sf = transcriptFeatures.get(1);
361 assertEquals(sf.getFeatureGroup(), "VCF");
362 assertEquals(sf.getBegin(), 17);
363 assertEquals(sf.getEnd(), 17);
364 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
365 assertEquals(sf.getScore(), 3.0e-03, DELTA);
366 assertEquals("C,TC", sf.getValue(Gff3Helper.ALLELES));
369 * verify variant feature(s) computed and added to protein
370 * last codon GCT varies to GGT giving A/G in the last peptide position
372 DBRefEntry[] dbRefs = al.getSequenceAt(3).getDBRefs();
373 SequenceI peptide = null;
374 for (DBRefEntry dbref : dbRefs)
376 if (dbref.getMap().getMap().getFromRatio() == 3)
378 peptide = dbref.getMap().getTo();
381 List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
382 assertEquals(proteinFeatures.size(), 1);
383 sf = proteinFeatures.get(0);
384 assertEquals(sf.getFeatureGroup(), "VCF");
385 assertEquals(sf.getBegin(), 6);
386 assertEquals(sf.getEnd(), 6);
387 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
388 assertEquals(sf.getDescription(), "p.Ala6Gly");
392 * Tests that if VEP consequence (CSQ) data is present in the VCF data, then
393 * it is added to the variant feature, but restricted where possible to the
394 * consequences for a specific transcript
396 * @throws IOException
398 @Test(groups = "Functional")
399 public void testDoLoad_vepCsq() throws IOException
401 AlignmentI al = buildAlignment();
403 VCFLoader loader = new VCFLoader(al);
406 * VCF data file with variants at gene3 positions
411 * 17 A/AC (insertion), A/G
413 loader.doLoad("test/jalview/io/vcf/testVcf.dat", null);
416 * verify variant feature(s) added to gene3
418 List<SequenceFeature> geneFeatures = al.findName("gene3")
419 .getSequenceFeatures();
420 SequenceFeatures.sortFeatures(geneFeatures, true);
421 assertEquals(geneFeatures.size(), 7);
422 SequenceFeature sf = geneFeatures.get(0);
423 assertEquals(sf.getBegin(), 1);
424 assertEquals(sf.getEnd(), 1);
425 assertEquals(sf.getScore(), 0.1f, DELTA);
426 assertEquals(sf.getValue("alleles"), "C,A");
427 // gene features include Consequence for all transcripts
428 assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2);
430 sf = geneFeatures.get(1);
431 assertEquals(sf.getBegin(), 5);
432 assertEquals(sf.getEnd(), 5);
433 assertEquals(sf.getScore(), 0.2f, DELTA);
434 assertEquals(sf.getValue("alleles"), "C,T");
435 assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2);
437 sf = geneFeatures.get(2);
438 assertEquals(sf.getBegin(), 9);
439 assertEquals(sf.getEnd(), 11); // deletion over 3 positions
440 assertEquals(sf.getScore(), 0.3f, DELTA);
441 assertEquals(sf.getValue("alleles"), "CGG,C");
442 assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2);
444 sf = geneFeatures.get(3);
445 assertEquals(sf.getBegin(), 13);
446 assertEquals(sf.getEnd(), 13);
447 assertEquals(sf.getScore(), 0.5f, DELTA);
448 assertEquals(sf.getValue("alleles"), "C,T");
449 assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2);
451 sf = geneFeatures.get(4);
452 assertEquals(sf.getBegin(), 13);
453 assertEquals(sf.getEnd(), 13);
454 assertEquals(sf.getScore(), 0.4f, DELTA);
455 assertEquals(sf.getValue("alleles"), "C,G");
456 assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2);
458 sf = geneFeatures.get(5);
459 assertEquals(sf.getBegin(), 17);
460 assertEquals(sf.getEnd(), 17);
461 assertEquals(sf.getScore(), 0.7f, DELTA);
462 assertEquals(sf.getValue("alleles"), "A,G");
463 assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2);
465 sf = geneFeatures.get(6);
466 assertEquals(sf.getBegin(), 17);
467 assertEquals(sf.getEnd(), 17); // insertion
468 assertEquals(sf.getScore(), 0.6f, DELTA);
469 assertEquals(sf.getValue("alleles"), "A,AC");
470 assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2);
473 * verify variant feature(s) added to transcript3
474 * at columns 5 (1), 17 (2), positions 3, 11
475 * note the deletion at columns 9-11 is not transferred since col 11
476 * has no mapping to transcript 3
478 List<SequenceFeature> transcriptFeatures = al.findName("transcript3")
479 .getSequenceFeatures();
480 SequenceFeatures.sortFeatures(transcriptFeatures, true);
481 assertEquals(transcriptFeatures.size(), 3);
482 sf = transcriptFeatures.get(0);
483 assertEquals(sf.getBegin(), 3);
484 assertEquals(sf.getEnd(), 3);
485 assertEquals(sf.getScore(), 0.2f, DELTA);
486 assertEquals(sf.getValue("alleles"), "C,T");
487 // transcript features only have Consequence for that transcripts
488 assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1);
489 assertTrue(sf.getValue("CSQ").toString().contains("transcript3"));
491 sf = transcriptFeatures.get(1);
492 assertEquals(sf.getBegin(), 11);
493 assertEquals(sf.getEnd(), 11);
494 assertEquals(sf.getScore(), 0.7f, DELTA);
495 assertEquals(sf.getValue("alleles"), "A,G");
496 assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1);
497 assertTrue(sf.getValue("CSQ").toString().contains("transcript3"));
499 sf = transcriptFeatures.get(2);
500 assertEquals(sf.getBegin(), 11);
501 assertEquals(sf.getEnd(), 11);
502 assertEquals(sf.getScore(), 0.6f, DELTA);
503 assertEquals(sf.getValue("alleles"), "A,AC");
504 assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1);
505 assertTrue(sf.getValue("CSQ").toString().contains("transcript3"));
508 * verify variant feature(s) added to transcript4
509 * at columns 13 (2) and 17 (2), positions 7 and 11
511 transcriptFeatures = al.findName("transcript4").getSequenceFeatures();
512 SequenceFeatures.sortFeatures(transcriptFeatures, true);
513 assertEquals(transcriptFeatures.size(), 4);
514 sf = transcriptFeatures.get(0);
515 assertEquals(sf.getBegin(), 7);
516 assertEquals(sf.getEnd(), 7);
517 assertEquals(sf.getScore(), 0.5f, DELTA);
518 assertEquals(sf.getValue("alleles"), "C,T");
519 assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1);
520 assertTrue(sf.getValue("CSQ").toString().contains("transcript4"));
522 sf = transcriptFeatures.get(1);
523 assertEquals(sf.getBegin(), 7);
524 assertEquals(sf.getEnd(), 7);
525 assertEquals(sf.getScore(), 0.4f, DELTA);
526 assertEquals(sf.getValue("alleles"), "C,G");
527 assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1);
528 assertTrue(sf.getValue("CSQ").toString().contains("transcript4"));
530 sf = transcriptFeatures.get(2);
531 assertEquals(sf.getBegin(), 11);
532 assertEquals(sf.getEnd(), 11);
533 assertEquals(sf.getScore(), 0.7f, DELTA);
534 assertEquals(sf.getValue("alleles"), "A,G");
535 assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1);
536 assertTrue(sf.getValue("CSQ").toString().contains("transcript4"));
538 sf = transcriptFeatures.get(3);
539 assertEquals(sf.getBegin(), 11);
540 assertEquals(sf.getEnd(), 11);
541 assertEquals(sf.getScore(), 0.6f, DELTA);
542 assertEquals(sf.getValue("alleles"), "A,AC");
543 assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1);
544 assertTrue(sf.getValue("CSQ").toString().contains("transcript4"));