1 package jalview.io.vcf;
3 import static org.testng.Assert.assertEquals;
5 import jalview.bin.Cache;
6 import jalview.datamodel.AlignmentI;
7 import jalview.datamodel.DBRefEntry;
8 import jalview.datamodel.Mapping;
9 import jalview.datamodel.Sequence;
10 import jalview.datamodel.SequenceFeature;
11 import jalview.datamodel.SequenceI;
12 import jalview.datamodel.features.SequenceFeatures;
13 import jalview.gui.AlignFrame;
14 import jalview.io.DataSourceType;
15 import jalview.io.FileLoader;
16 import jalview.io.gff.Gff3Helper;
17 import jalview.io.gff.SequenceOntologyI;
18 import jalview.util.MapList;
21 import java.io.IOException;
22 import java.io.PrintWriter;
23 import java.util.List;
26 import org.testng.annotations.BeforeClass;
27 import org.testng.annotations.Test;
29 public class VCFLoaderTest
31 private static final float DELTA = 0.00001f;
33 // columns 9717- of gene P30419 from Ensembl (much modified)
34 private static final String FASTA = ""
37 * forward strand 'gene' and 'transcript' with two exons
39 ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n"
40 + "CAAGCTGGCGGACGAGAGTGTGACA\n"
41 + ">transcript1/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
44 * reverse strand gene and transcript (reverse complement alleles!)
46 + ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n"
47 + "TGTCACACTCTCGTCCGCCAGCTTG\n"
48 + ">transcript2/1-18\n" + "-GTCACACTCT----CGCCAGCT--\n"
51 * 'gene' on chromosome 5 with two transcripts
53 + ">gene3/1-25 chromosome:GRCh38:5:45051610:45051634:1\n"
54 + "CAAGCTGGCGGACGAGAGTGTGACA\n"
55 + ">transcript3/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
56 + ">transcript4/1-18\n-----TGG-GGACGAGAGTGTGA-A\n";
58 private static final String[] VCF = { "##fileformat=VCFv4.2",
59 "##INFO=<ID=AF,Number=A,Type=Float,Description=\"Allele Frequency, for each ALT allele, in the same order as listed\">",
60 "##reference=Homo_sapiens/GRCh38",
61 "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO",
62 // A/T,C variants in position 2 of gene sequence (precedes transcript)
63 // should create 2 variant features with respective scores
64 "17\t45051611\t.\tA\tT,C\t1666.64\tRF\tAC=15;AF=5.0e-03,4.0e-03",
65 // SNP G/C in position 4 of gene sequence, position 2 of transcript
66 // insertion G/GA is transferred to nucleotide but not to peptide
67 "17\t45051613\t.\tG\tGA,C\t1666.64\tRF\tAC=15;AF=3.0e-03,2.0e-03" };
73 * configure to capture all available VCF and VEP (CSQ) fields
75 Cache.loadProperties("test/jalview/io/testProps.jvprops");
76 Cache.setProperty("VCF_FIELDS", ".*");
77 Cache.setProperty("VEP_FIELDS", ".*");
81 @Test(groups = "Functional")
82 public void testDoLoad() throws IOException
84 AlignmentI al = buildAlignment();
87 VCFLoader loader = new VCFLoader(f.getPath());
89 loader.doLoad(al.getSequencesArray(), null);
92 * verify variant feature(s) added to gene
93 * NB alleles at a locus may not be processed, and features added,
94 * in the order in which they appear in the VCF record as method
95 * VariantContext.getAlternateAlleles() does not guarantee order
96 * - order of assertions here matches what we find (is not important)
98 List<SequenceFeature> geneFeatures = al.getSequenceAt(0)
99 .getSequenceFeatures();
100 SequenceFeatures.sortFeatures(geneFeatures, true);
101 assertEquals(geneFeatures.size(), 4);
102 SequenceFeature sf = geneFeatures.get(0);
103 assertEquals(sf.getFeatureGroup(), "VCF");
104 assertEquals(sf.getBegin(), 2);
105 assertEquals(sf.getEnd(), 2);
106 assertEquals(sf.getScore(), 4.0e-03, DELTA);
107 assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,C");
108 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
109 sf = geneFeatures.get(1);
110 assertEquals(sf.getFeatureGroup(), "VCF");
111 assertEquals(sf.getBegin(), 2);
112 assertEquals(sf.getEnd(), 2);
113 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
114 assertEquals(sf.getScore(), 5.0e-03, DELTA);
115 assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,T");
117 sf = geneFeatures.get(2);
118 assertEquals(sf.getFeatureGroup(), "VCF");
119 assertEquals(sf.getBegin(), 4);
120 assertEquals(sf.getEnd(), 4);
121 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
122 assertEquals(sf.getScore(), 2.0e-03, DELTA);
123 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
125 sf = geneFeatures.get(3);
126 assertEquals(sf.getFeatureGroup(), "VCF");
127 assertEquals(sf.getBegin(), 4);
128 assertEquals(sf.getEnd(), 4);
129 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
130 assertEquals(sf.getScore(), 3.0e-03, DELTA);
131 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
134 * verify variant feature(s) added to transcript
136 List<SequenceFeature> transcriptFeatures = al.getSequenceAt(1)
137 .getSequenceFeatures();
138 assertEquals(transcriptFeatures.size(), 2);
139 sf = transcriptFeatures.get(0);
140 assertEquals(sf.getFeatureGroup(), "VCF");
141 assertEquals(sf.getBegin(), 2);
142 assertEquals(sf.getEnd(), 2);
143 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
144 assertEquals(sf.getScore(), 2.0e-03, DELTA);
145 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
146 sf = transcriptFeatures.get(1);
147 assertEquals(sf.getFeatureGroup(), "VCF");
148 assertEquals(sf.getBegin(), 2);
149 assertEquals(sf.getEnd(), 2);
150 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
151 assertEquals(sf.getScore(), 3.0e-03, DELTA);
152 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
155 * verify SNP variant feature(s) computed and added to protein
156 * first codon AGC varies to ACC giving S/T
158 DBRefEntry[] dbRefs = al.getSequenceAt(1).getDBRefs();
159 SequenceI peptide = null;
160 for (DBRefEntry dbref : dbRefs)
162 if (dbref.getMap().getMap().getFromRatio() == 3)
164 peptide = dbref.getMap().getTo();
167 List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
168 assertEquals(proteinFeatures.size(), 1);
169 sf = proteinFeatures.get(0);
170 assertEquals(sf.getFeatureGroup(), "VCF");
171 assertEquals(sf.getBegin(), 1);
172 assertEquals(sf.getEnd(), 1);
173 assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
174 assertEquals(sf.getDescription(), "p.Ser1Thr");
177 private File makeVcf() throws IOException
179 File f = File.createTempFile("Test", ".vcf");
181 PrintWriter pw = new PrintWriter(f);
182 for (String vcfLine : VCF)
191 * Make a simple alignment with one 'gene' and one 'transcript'
195 private AlignmentI buildAlignment()
197 AlignFrame af = new FileLoader().LoadFileWaitTillLoaded(FASTA,
198 DataSourceType.PASTE);
201 * map gene1 sequence to chromosome (normally done when the sequence is fetched
202 * from Ensembl and transcripts computed)
204 AlignmentI alignment = af.getViewport().getAlignment();
205 SequenceI gene1 = alignment.findName("gene1");
206 int[] to = new int[] { 45051610, 45051634 };
207 int[] from = new int[] { gene1.getStart(), gene1.getEnd() };
208 gene1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
212 * map 'transcript1' to chromosome via 'gene1'
213 * transcript1/1-18 is gene1/3-10,15-24
214 * which is chromosome 45051612-45051619,45051624-45051633
216 to = new int[] { 45051612, 45051619, 45051624, 45051633 };
217 SequenceI transcript1 = alignment.findName("transcript1");
218 from = new int[] { transcript1.getStart(), transcript1.getEnd() };
219 transcript1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
224 * map gene2 to chromosome reverse strand
226 SequenceI gene2 = alignment.findName("gene2");
227 to = new int[] { 45051634, 45051610 };
228 from = new int[] { gene2.getStart(), gene2.getEnd() };
229 gene2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
233 * map 'transcript2' to chromosome via 'gene2'
234 * transcript2/1-18 is gene2/2-11,16-23
235 * which is chromosome 45051633-45051624,45051619-45051612
237 to = new int[] { 45051633, 45051624, 45051619, 45051612 };
238 SequenceI transcript2 = alignment.findName("transcript2");
239 from = new int[] { transcript2.getStart(), transcript2.getEnd() };
240 transcript2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
245 * add a protein product as a DBRef on transcript1
247 SequenceI peptide1 = new Sequence("ENSP001", "SWRECD");
248 MapList mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 },
250 Mapping map = new Mapping(peptide1, mapList);
251 DBRefEntry product = new DBRefEntry("", "", "ENSP001", map);
252 transcript1.addDBRef(product);
255 * add a protein product as a DBRef on transcript2
257 SequenceI peptide2 = new Sequence("ENSP002", "VTLSPA");
258 mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
259 map = new Mapping(peptide2, mapList);
260 product = new DBRefEntry("", "", "ENSP002", map);
261 transcript2.addDBRef(product);
264 * map gene3 to chromosome
266 SequenceI gene3 = alignment.findName("gene3");
267 to = new int[] { 45051610, 45051634 };
268 from = new int[] { gene3.getStart(), gene3.getEnd() };
269 gene3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(from, to,
273 * map 'transcript3' to chromosome
275 SequenceI transcript3 = alignment.findName("transcript3");
276 to = new int[] { 45051612, 45051619, 45051624, 45051633 };
277 from = new int[] { transcript3.getStart(), transcript3.getEnd() };
278 transcript3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
283 * map 'transcript4' to chromosome
285 SequenceI transcript4 = alignment.findName("transcript4");
286 to = new int[] { 45051615, 45051617, 45051619, 45051632, 45051634,
288 from = new int[] { transcript4.getStart(), transcript4.getEnd() };
289 transcript4.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
294 * add a protein product as a DBRef on transcript3
296 SequenceI peptide3 = new Sequence("ENSP003", "SWRECD");
297 mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
298 map = new Mapping(peptide3, mapList);
299 product = new DBRefEntry("", "", "ENSP003", map);
300 transcript3.addDBRef(product);
306 * Test with 'gene' and 'transcript' mapped to the reverse strand of the
307 * chromosome. The VCF variant positions (in forward coordinates) should get
308 * correctly located on sequence positions.
310 * @throws IOException
312 @Test(groups = "Functional")
313 public void testDoLoad_reverseStrand() throws IOException
315 AlignmentI al = buildAlignment();
319 VCFLoader loader = new VCFLoader(f.getPath());
321 loader.doLoad(al.getSequencesArray(), null);
324 * verify variant feature(s) added to gene2
325 * gene2/1-25 maps to chromosome 45051634- reverse strand
327 List<SequenceFeature> geneFeatures = al.getSequenceAt(2)
328 .getSequenceFeatures();
329 SequenceFeatures.sortFeatures(geneFeatures, true);
330 assertEquals(geneFeatures.size(), 4);
333 * variant A/T at 45051611 maps to T/A at gene position 24
335 SequenceFeature sf = geneFeatures.get(3);
336 assertEquals(sf.getFeatureGroup(), "VCF");
337 assertEquals(sf.getBegin(), 24);
338 assertEquals(sf.getEnd(), 24);
339 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
340 assertEquals(sf.getScore(), 5.0e-03, DELTA);
341 assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,A");
344 * variant A/C at 45051611 maps to T/G at gene position 24
346 sf = geneFeatures.get(2);
347 assertEquals(sf.getFeatureGroup(), "VCF");
348 assertEquals(sf.getBegin(), 24);
349 assertEquals(sf.getEnd(), 24);
350 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
351 assertEquals(sf.getScore(), 4.0e-03, DELTA);
352 assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,G");
355 * variant G/C at 45051613 maps to C/G at gene position 22
357 sf = geneFeatures.get(1);
358 assertEquals(sf.getFeatureGroup(), "VCF");
359 assertEquals(sf.getBegin(), 22);
360 assertEquals(sf.getEnd(), 22);
361 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
362 assertEquals(sf.getScore(), 2.0e-03, DELTA);
363 assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
366 * insertion G/GA at 45051613 maps to an insertion at
367 * the preceding position (21) on reverse strand gene
368 * reference: CAAGC -> GCTTG/21-25
369 * genomic variant: CAAGAC (G/GA)
370 * gene variant: GTCTTG (G/GT at 21)
372 sf = geneFeatures.get(0);
373 assertEquals(sf.getFeatureGroup(), "VCF");
374 assertEquals(sf.getBegin(), 21);
375 assertEquals(sf.getEnd(), 21);
376 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
377 assertEquals(sf.getScore(), 3.0e-03, DELTA);
378 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
381 * verify 2 variant features added to transcript2
383 List<SequenceFeature> transcriptFeatures = al.getSequenceAt(3)
384 .getSequenceFeatures();
385 assertEquals(transcriptFeatures.size(), 2);
388 * insertion G/GT at position 21 of gene maps to position 16 of transcript
390 sf = transcriptFeatures.get(0);
391 assertEquals(sf.getFeatureGroup(), "VCF");
392 assertEquals(sf.getBegin(), 16);
393 assertEquals(sf.getEnd(), 16);
394 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
395 assertEquals(sf.getScore(), 3.0e-03, DELTA);
396 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
399 * SNP C/G at position 22 of gene maps to position 17 of transcript
401 sf = transcriptFeatures.get(1);
402 assertEquals(sf.getFeatureGroup(), "VCF");
403 assertEquals(sf.getBegin(), 17);
404 assertEquals(sf.getEnd(), 17);
405 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
406 assertEquals(sf.getScore(), 2.0e-03, DELTA);
407 assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
410 * verify variant feature(s) computed and added to protein
411 * last codon GCT varies to GGT giving A/G in the last peptide position
413 DBRefEntry[] dbRefs = al.getSequenceAt(3).getDBRefs();
414 SequenceI peptide = null;
415 for (DBRefEntry dbref : dbRefs)
417 if (dbref.getMap().getMap().getFromRatio() == 3)
419 peptide = dbref.getMap().getTo();
422 List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
423 assertEquals(proteinFeatures.size(), 1);
424 sf = proteinFeatures.get(0);
425 assertEquals(sf.getFeatureGroup(), "VCF");
426 assertEquals(sf.getBegin(), 6);
427 assertEquals(sf.getEnd(), 6);
428 assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
429 assertEquals(sf.getDescription(), "p.Ala6Gly");
433 * Tests that if VEP consequence (CSQ) data is present in the VCF data, then
434 * it is added to the variant feature, but restricted where possible to the
435 * consequences for a specific transcript
437 * @throws IOException
439 @Test(groups = "Functional")
440 public void testDoLoad_vepCsq() throws IOException
442 AlignmentI al = buildAlignment();
444 VCFLoader loader = new VCFLoader("test/jalview/io/vcf/testVcf.vcf");
447 * VCF data file with variants at gene3 positions
452 * 17 A/AC (insertion), A/G
454 loader.doLoad(al.getSequencesArray(), null);
457 * verify variant feature(s) added to gene3
459 List<SequenceFeature> geneFeatures = al.findName("gene3")
460 .getSequenceFeatures();
461 SequenceFeatures.sortFeatures(geneFeatures, true);
462 assertEquals(geneFeatures.size(), 7);
463 SequenceFeature sf = geneFeatures.get(0);
464 assertEquals(sf.getBegin(), 1);
465 assertEquals(sf.getEnd(), 1);
466 assertEquals(sf.getScore(), 0.1f, DELTA);
467 assertEquals(sf.getValue("alleles"), "C,A");
468 // gene features include Consequence for all transcripts
469 Map map = (Map) sf.getValue("CSQ");
470 assertEquals(map.size(), 9);
472 sf = geneFeatures.get(1);
473 assertEquals(sf.getBegin(), 5);
474 assertEquals(sf.getEnd(), 5);
475 assertEquals(sf.getScore(), 0.2f, DELTA);
476 assertEquals(sf.getValue("alleles"), "C,T");
477 map = (Map) sf.getValue("CSQ");
478 assertEquals(map.size(), 9);
480 sf = geneFeatures.get(2);
481 assertEquals(sf.getBegin(), 9);
482 assertEquals(sf.getEnd(), 11); // deletion over 3 positions
483 assertEquals(sf.getScore(), 0.3f, DELTA);
484 assertEquals(sf.getValue("alleles"), "CGG,C");
485 map = (Map) sf.getValue("CSQ");
486 assertEquals(map.size(), 9);
488 sf = geneFeatures.get(3);
489 assertEquals(sf.getBegin(), 13);
490 assertEquals(sf.getEnd(), 13);
491 assertEquals(sf.getScore(), 0.5f, DELTA);
492 assertEquals(sf.getValue("alleles"), "C,T");
493 map = (Map) sf.getValue("CSQ");
494 assertEquals(map.size(), 9);
496 sf = geneFeatures.get(4);
497 assertEquals(sf.getBegin(), 13);
498 assertEquals(sf.getEnd(), 13);
499 assertEquals(sf.getScore(), 0.4f, DELTA);
500 assertEquals(sf.getValue("alleles"), "C,G");
501 map = (Map) sf.getValue("CSQ");
502 assertEquals(map.size(), 9);
504 sf = geneFeatures.get(5);
505 assertEquals(sf.getBegin(), 17);
506 assertEquals(sf.getEnd(), 17);
507 assertEquals(sf.getScore(), 0.7f, DELTA);
508 assertEquals(sf.getValue("alleles"), "A,G");
509 map = (Map) sf.getValue("CSQ");
510 assertEquals(map.size(), 9);
512 sf = geneFeatures.get(6);
513 assertEquals(sf.getBegin(), 17);
514 assertEquals(sf.getEnd(), 17); // insertion
515 assertEquals(sf.getScore(), 0.6f, DELTA);
516 assertEquals(sf.getValue("alleles"), "A,AC");
517 map = (Map) sf.getValue("CSQ");
518 assertEquals(map.size(), 9);
521 * verify variant feature(s) added to transcript3
522 * at columns 5 (1), 17 (2), positions 3, 11
523 * note the deletion at columns 9-11 is not transferred since col 11
524 * has no mapping to transcript 3
526 List<SequenceFeature> transcriptFeatures = al.findName("transcript3")
527 .getSequenceFeatures();
528 SequenceFeatures.sortFeatures(transcriptFeatures, true);
529 assertEquals(transcriptFeatures.size(), 3);
530 sf = transcriptFeatures.get(0);
531 assertEquals(sf.getBegin(), 3);
532 assertEquals(sf.getEnd(), 3);
533 assertEquals(sf.getScore(), 0.2f, DELTA);
534 assertEquals(sf.getValue("alleles"), "C,T");
535 // transcript features only have Consequence for that transcripts
536 map = (Map) sf.getValue("CSQ");
537 assertEquals(map.size(), 9);
538 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
540 sf = transcriptFeatures.get(1);
541 assertEquals(sf.getBegin(), 11);
542 assertEquals(sf.getEnd(), 11);
543 assertEquals(sf.getScore(), 0.7f, DELTA);
544 assertEquals(sf.getValue("alleles"), "A,G");
545 assertEquals(map.size(), 9);
546 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
548 sf = transcriptFeatures.get(2);
549 assertEquals(sf.getBegin(), 11);
550 assertEquals(sf.getEnd(), 11);
551 assertEquals(sf.getScore(), 0.6f, DELTA);
552 assertEquals(sf.getValue("alleles"), "A,AC");
553 assertEquals(map.size(), 9);
554 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
557 * verify variants computed on protein product for transcript3
559 * codon variants are AGC/AGT position 1 which is synonymous
560 * and GAG/GGG which is E/G in position 4
561 * the insertion variant is not transferred to the peptide
563 DBRefEntry[] dbRefs = al.findName("transcript3").getDBRefs();
564 SequenceI peptide = null;
565 for (DBRefEntry dbref : dbRefs)
567 if (dbref.getMap().getMap().getFromRatio() == 3)
569 peptide = dbref.getMap().getTo();
572 List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
573 SequenceFeatures.sortFeatures(proteinFeatures, true);
574 assertEquals(proteinFeatures.size(), 2);
575 sf = proteinFeatures.get(0);
576 assertEquals(sf.getFeatureGroup(), "VCF");
577 assertEquals(sf.getBegin(), 1);
578 assertEquals(sf.getEnd(), 1);
579 assertEquals(sf.getType(), SequenceOntologyI.SYNONYMOUS_VARIANT);
580 assertEquals(sf.getDescription(), "agC/agT");
581 sf = proteinFeatures.get(1);
582 assertEquals(sf.getFeatureGroup(), "VCF");
583 assertEquals(sf.getBegin(), 4);
584 assertEquals(sf.getEnd(), 4);
585 assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
586 assertEquals(sf.getDescription(), "p.Glu4Gly");
589 * verify variant feature(s) added to transcript4
590 * at columns 13 (2) and 17 (2), positions 7 and 11
592 transcriptFeatures = al.findName("transcript4").getSequenceFeatures();
593 SequenceFeatures.sortFeatures(transcriptFeatures, true);
594 assertEquals(transcriptFeatures.size(), 4);
595 sf = transcriptFeatures.get(0);
596 assertEquals(sf.getBegin(), 7);
597 assertEquals(sf.getEnd(), 7);
598 assertEquals(sf.getScore(), 0.5f, DELTA);
599 assertEquals(sf.getValue("alleles"), "C,T");
600 assertEquals(map.size(), 9);
601 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
603 sf = transcriptFeatures.get(1);
604 assertEquals(sf.getBegin(), 7);
605 assertEquals(sf.getEnd(), 7);
606 assertEquals(sf.getScore(), 0.4f, DELTA);
607 assertEquals(sf.getValue("alleles"), "C,G");
608 assertEquals(map.size(), 9);
609 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
611 sf = transcriptFeatures.get(2);
612 assertEquals(sf.getBegin(), 11);
613 assertEquals(sf.getEnd(), 11);
614 assertEquals(sf.getScore(), 0.7f, DELTA);
615 assertEquals(sf.getValue("alleles"), "A,G");
616 assertEquals(map.size(), 9);
617 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
619 sf = transcriptFeatures.get(3);
620 assertEquals(sf.getBegin(), 11);
621 assertEquals(sf.getEnd(), 11);
622 assertEquals(sf.getScore(), 0.6f, DELTA);
623 assertEquals(sf.getValue("alleles"), "A,AC");
624 assertEquals(map.size(), 9);
625 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
629 * A test that demonstrates loading a contig sequence from an indexed sequence
630 * database which is the reference for a VCF file
632 * @throws IOException
634 @Test(groups = "Functional")
635 public void testLoadVCFContig() throws IOException
637 VCFLoader loader = new VCFLoader(
638 "test/jalview/io/vcf/testVcf2.vcf");
640 SequenceI seq = loader.loadVCFContig("contig123");
641 assertEquals(seq.getLength(), 15);
642 assertEquals(seq.getSequenceAsString(), "AAAAACCCCCGGGGG");
643 List<SequenceFeature> features = seq.getSequenceFeatures();
644 SequenceFeatures.sortFeatures(features, true);
645 assertEquals(features.size(), 2);
646 SequenceFeature sf = features.get(0);
647 assertEquals(sf.getBegin(), 8);
648 assertEquals(sf.getEnd(), 8);
649 assertEquals(sf.getDescription(), "C,A");
650 sf = features.get(1);
651 assertEquals(sf.getBegin(), 12);
652 assertEquals(sf.getEnd(), 12);
653 assertEquals(sf.getDescription(), "G,T");
655 seq = loader.loadVCFContig("contig789");
656 assertEquals(seq.getLength(), 25);
657 assertEquals(seq.getSequenceAsString(), "GGGGGTTTTTAAAAACCCCCGGGGG");
658 features = seq.getSequenceFeatures();
659 SequenceFeatures.sortFeatures(features, true);
660 assertEquals(features.size(), 2);
661 sf = features.get(0);
662 assertEquals(sf.getBegin(), 2);
663 assertEquals(sf.getEnd(), 2);
664 assertEquals(sf.getDescription(), "G,T");
665 sf = features.get(1);
666 assertEquals(sf.getBegin(), 21);
667 assertEquals(sf.getEnd(), 21);
668 assertEquals(sf.getDescription(), "G,A");
670 seq = loader.loadVCFContig("contig456");
671 assertEquals(seq.getLength(), 20);
672 assertEquals(seq.getSequenceAsString(), "CCCCCGGGGGTTTTTAAAAA");
673 features = seq.getSequenceFeatures();
674 SequenceFeatures.sortFeatures(features, true);
675 assertEquals(features.size(), 1);
676 sf = features.get(0);
677 assertEquals(sf.getBegin(), 15);
678 assertEquals(sf.getEnd(), 15);
679 assertEquals(sf.getDescription(), "T,C");