"GAATTCGTTCATGTAGGTTGATTTTTATT");
seq.createDatasetSequence();
AlignmentI align = new Alignment(new SequenceI[] {});
-
+
// mapping from gi|68711 12923-13060 to gi|N37351 1-138
String[] gff = "gi|68711\tblat-pasa\tcDNA_match\t12923\t13060\t98.55\t+\t.\tID=align_68;Target=gi|N37351 1 138 +"
.split("\\t");
// (this is important for 'align cdna to genome' to work correctly)
assertEquals(1, align.getCodonFrames().size());
AlignedCodonFrame mapping = align.getCodonFrames().get(0);
-
+
/*
* 'dnaseqs' (map from) is here [gi|68711]
* 'aaseqs' (map to) is here [gi|N37351]
assertEquals(1, mapping.getdnaToProt().length);
assertEquals(2, mapping.getdnaToProt()[0].getFromRanges().size());
// the two spliced dna ranges are combined in one MapList
- assertArrayEquals(new int[] { 12923, 13060 },
- mapping.getdnaToProt()[0]
+ assertArrayEquals(new int[] { 12923, 13060 }, mapping.getdnaToProt()[0]
.getFromRanges().get(0));
assertArrayEquals(new int[] { 13411, 13550 }, mapping.getdnaToProt()[0]
.getFromRanges().get(1));