- </ul>
- </li>
- <li><strong>Pairwise Alignments</strong><br>
- <em>Applies Smith and Waterman algorithm to selected sequences. See <a href="../calculations/pairwise.html">pairwise
- alignments</a>.</em><br>
- </li>
- <li><strong>Principal Component Analysis</strong><br>
- <em>Shows a spatial clustering of the sequences based on the BLOSUM62 scores
- in the alignment. See <a href="../calculations/pca.html">Principal Component
- Analysis</a>.</em> <br>
- </li>
- <li><strong>Extract Scores ... (optional)</strong><br>
- <em>This option is only visible if Jalview detects one or more white-space separated values in the description line of the alignment sequences.<br>
- When selected, these numbers are parsed into sequence associated annotation which can
- then be used to sort the alignment via the Sort by→Score menu.</em> <br>
- </li>
-
- <li><strong>Autocalculate Consensus</strong><br>
- <em>For large alignments it can be useful to deselect "Autocalculate
- Consensus" when editing. This prevents the sometimes lengthy calculations
- performed after each sequence edit.</em> <br>
- </li>
-</ul>
- </body>
+ <li><strong>Average Distance Using Sequence
+ Feature Similarity</strong></li>
+ <li><strong>Average Distance Using Blosum62</strong></li>
+ <li><strong>Average Distance Using % Identity</strong></li>
+ </ul></li>
+ <li><strong>Pairwise Alignments</strong><br> <em>Applies
+ Smith and Waterman algorithm to selected sequences. See <a
+ href="../calculations/pairwise.html"
+ >pairwise alignments</a>.
+ </em><br></li>
+ <li><strong>Principal Component Analysis</strong><br> <em>Shows
+ a spatial clustering of the sequences based on similarity scores
+ calculated over the alignment.. See <a
+ href="../calculations/pca.html"
+ >Principal Component Analysis</a>.
+ </em> <br></li>
+ <li><strong>Extract Scores ... (optional)</strong><br> <em>This
+ option is only visible if Jalview detects one or more
+ white-space separated values in the description line of the
+ alignment sequences.<br> When selected, these numbers are
+ parsed into sequence associated annotation which can then be
+ used to sort the alignment via the Sort by→Score menu.
+ </em> <br></li>
+ <li><strong>Translate as cDNA</strong> (not applet)<br>
+ <em>This option is visible for nucleotide alignments. Selecting
+ this option shows the DNA's calculated protein product in a new
+ <a href="../features/splitView.html">split frame</a> window.
+ Note that the translation is not frame- or intron-aware; it
+ simply translates all codons in each sequence, using the
+ standard <a href="../misc/geneticCode.html">genetic code</a>
+ (any incomplete final codon is discarded). You can perform this
+ action on the whole alignment, or selected rows, columns, or
+ regions.
+ </em> <br></li>
+ <li><strong>Reverse, Reverse Complement</strong> (not applet)<br>
+ <em>These options are visible for nucleotide alignments. Selecting them adds the reverse (or reverse complement)
+ of the sequences (or selected region) as new sequences in the alignment. To try this out, add this sequence and
+ perform 'Reverse Complement' followed by 'Translate as cDNA':
+ <br><small>
+ Seq GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC
+ TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG</small>
+ </em> <br></li>
+ <li><strong>Get Cross-References</strong> (not applet)<br>
+ <em>This option is visible where sequences have
+ cross-references to other standard databases; for example, an
+ EMBL entry may have cross-references to one or more UNIPROT
+ entries. Select the database to view all cross-referenced
+ sequences in a new <a href="../features/splitView.html">split
+ frame</a> window.
+ </em> <br></li>
+ <li><strong>Autocalculate Consensus</strong><br> <em>For
+ large alignments it can be useful to deselect
+ "Autocalculate Consensus" when editing. This prevents
+ the sometimes lengthy calculations performed after each sequence
+ edit.</em> <br></li>
+ <li><strong>Sort Alignment With New Tree</strong><br> <em>If
+ this option is selected, the alignment will be automatically
+ sorted whenever a new tree is calculated or loaded.</em> <br></li>
+ <li><strong>Show Flanking Regions</strong><br> <em>Opens
+ a new alignment window showing any additional sequence data
+ either side of the current alignment. Useful in conjunction with
+ 'Fetch Database References' when the 'Trim Retrieved Sequences'
+ option is disabled to retrieve full length sequences for a set
+ of aligned peptides. </em></li>
+ </ul>
+</body>