+/*
+ VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases.
+ Copyright (C) 2008 Kevin Darty, Alain Denise and Yann Ponty.
+ electronic mail : Yann.Ponty@lri.fr
+ paper mail : LRI, bat 490 Université Paris-Sud 91405 Orsay Cedex France
+
+ This file is part of VARNA version 3.1.
+ VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License
+ as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+
+ VARNA version 3.1 is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY;
+ without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+ See the GNU General Public License for more details.
+
+ You should have received a copy of the GNU General Public License along with VARNA version 3.1.
+ If not, see http://www.gnu.org/licenses.
+ */
+package fr.orsay.lri.varna.applications;
+
+import java.awt.BorderLayout;
+import java.awt.Color;
+import java.awt.Dimension;
+import java.awt.Font;
+import java.awt.GridLayout;
+import java.awt.event.ActionEvent;
+import java.awt.event.ActionListener;
+
+import javax.swing.JButton;
+import javax.swing.JFrame;
+import javax.swing.JLabel;
+import javax.swing.JPanel;
+import javax.swing.JTextField;
+
+import fr.orsay.lri.varna.VARNAPanel;
+import fr.orsay.lri.varna.controlers.ControleurInterpolator;
+import fr.orsay.lri.varna.exceptions.ExceptionDrawingAlgorithm;
+import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax;
+import fr.orsay.lri.varna.exceptions.ExceptionModeleStyleBaseSyntaxError;
+import fr.orsay.lri.varna.exceptions.ExceptionNAViewAlgorithm;
+import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
+import fr.orsay.lri.varna.exceptions.ExceptionParameterError;
+import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses;
+import fr.orsay.lri.varna.exceptions.MappingException;
+import fr.orsay.lri.varna.models.VARNAConfig;
+import fr.orsay.lri.varna.models.rna.Mapping;
+import fr.orsay.lri.varna.models.rna.ModeleBase;
+import fr.orsay.lri.varna.models.rna.ModelBaseStyle;
+import fr.orsay.lri.varna.models.rna.RNA;
+
+import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener;;
+
+public class SuperpositionDemo extends JFrame implements InterfaceVARNAListener {
+
+ /**
+ *
+ */
+ private static final long serialVersionUID = -790155708306987257L;
+
+ private static final String DEFAULT_SEQUENCE1 = "CGCGCACGCGAUAUUUCGCGUCGCGCAUUUGCGCGUAGCGCG";
+ private static final String DEFAULT_SEQUENCE2 = "CGCGCACGCGAUAUUUCGCGUCGCGCAUUUGCGCGUAGCGCG";
+
+ private static final String DEFAULT_STRUCTURE1 = "(((((.(((((----....----))))).(((((....)))))..)))))";
+ private static final String DEFAULT_STRUCTURE2 = "(((((.(((((((((....))))))))).--------------..)))))";
+ // private static final String DEFAULT_STRUCTURE1 = "((((....))))";
+ // private static final String DEFAULT_STRUCTURE2 =
+ // "((((..(((....)))..))))";
+
+ private VARNAPanel _vpMaster;
+ private VARNAPanel _vpSlave;
+
+ private JPanel _tools = new JPanel();
+ private JPanel _input = new JPanel();
+
+ private JPanel _seqPanel = new JPanel();
+ private JPanel _struct1Panel = new JPanel();
+ private JPanel _struct2Panel = new JPanel();
+ private JLabel _info = new JLabel();
+ private JTextField _struct1 = new JTextField(DEFAULT_STRUCTURE1);
+ private JTextField _struct2 = new JTextField(DEFAULT_STRUCTURE2);
+ private JTextField _seq1 = new JTextField(DEFAULT_SEQUENCE1);
+ private JTextField _seq2 = new JTextField(DEFAULT_SEQUENCE2);
+ private JLabel _struct1Label = new JLabel(" Str1:");
+ private JLabel _struct2Label = new JLabel(" Str2:");
+ private JLabel _seqLabel = new JLabel(" Seq:");
+ private JButton _goButton = new JButton("Go");
+ private JButton _switchButton = new JButton("Switch");
+
+ private String _str1Backup = "";
+ private String _str2Backup = "";
+ private RNA _RNA1 = new RNA();
+ private RNA _RNA2 = new RNA();
+
+ private static String errorOpt = "error";
+ @SuppressWarnings("unused")
+ private boolean _error;
+
+ private Color _backgroundColor = Color.white;
+
+ @SuppressWarnings("unused")
+ private int _algoCode;
+
+ private int _currentDisplay = 1;
+
+ public static ModelBaseStyle createStyle(String txt)
+ {
+ ModelBaseStyle result = new ModelBaseStyle();
+ try {
+ result.assignParameters(txt);
+ } catch (ExceptionModeleStyleBaseSyntaxError e) {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ } catch (ExceptionParameterError e) {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ }
+ return result;
+ }
+
+ public void applyTo(VARNAPanel vp, ModelBaseStyle mb, int[] indices)
+ {
+ for(int i=0;i<indices.length;i++)
+ {
+ ModeleBase m = vp.getRNA().getBaseAt(indices[i]);
+ m.setStyleBase(mb);
+ if (m.getElementStructure()!=-1)
+ {
+ vp.getRNA().getBaseAt(m.getElementStructure()).setStyleBase(mb);
+ }
+ }
+ vp.repaint();
+ }
+
+
+ public SuperpositionDemo() {
+ super();
+ try {
+ _vpMaster = new VARNAPanel(getText1(), getStruct1());
+ _vpSlave = new VARNAPanel(getText2(), getStruct2());
+ } catch (ExceptionNonEqualLength e) {
+ _vpMaster.errorDialog(e);
+ }
+ _vpMaster.setPreferredSize(new Dimension(400, 400));
+ RNAPanelDemoInit();
+ }
+
+ private void RNAPanelDemoInit() {
+ int marginTools = 40;
+
+ setBackground(_backgroundColor);
+ _vpMaster.setBackground(_backgroundColor);
+ _vpMaster.addVARNAListener(this);
+ //_vpSlave.setModifiable(false);
+ _vpSlave.setBackground(Color.decode("#F0F0F0"));
+
+ _vpMaster.drawRNA(getRNA((_currentDisplay)%2));
+ _vpSlave.drawRNA(getRNA((_currentDisplay+1)%2));
+
+ /*ModeleStyleBase red = createStyle("label=#ff4d4d,fill=#ffdddd,outline=#ff4d4d");
+ int[] ired = {6,7,8,9,10};
+ applyTo(_vpMaster, red, ired);
+ applyTo(_vpSlave, red, ired);
+ ModeleStyleBase blue = createStyle("label=#0000ff,fill=#ddddff,outline=#0000ff");
+ int[] iblue = {0,1,2,3,4};
+ applyTo(_vpMaster, blue, iblue);
+ applyTo(_vpSlave, blue, iblue);
+ ModeleStyleBase purple = createStyle("label=#cc00cc,fill=#ffddff,outline=#cc00cc");
+ int[] ipurple = {21,22,23,24,25};
+ applyTo(_vpMaster, purple, ipurple);
+ ModeleStyleBase green = createStyle("label=#009900,fill=#aaeeaa,outline=#009900");
+ int[] igreen = {11,12,13,14};
+ applyTo(_vpSlave, green, igreen);*/
+
+ Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
+
+ _seqLabel.setHorizontalTextPosition(JLabel.LEFT);
+ _seqLabel.setPreferredSize(new Dimension(marginTools, 15));
+ _seq1.setFont(textFieldsFont);
+ _seq1.setText(getRNA1().getSeq());
+ _seq2.setFont(textFieldsFont);
+ _seq2.setText(getRNA2().getSeq());
+
+ _goButton.addActionListener(new ActionListener() {
+
+ public void actionPerformed(ActionEvent e) {
+ _currentDisplay = (_currentDisplay + 1) % 2;
+ _vpMaster.drawRNA(getRNA(_currentDisplay));
+ _vpSlave.drawRNA(getRNA((_currentDisplay + 1) % 2));
+ onStructureRedrawn();
+ }
+ });
+
+ _switchButton.addActionListener(new ActionListener() {
+ public void actionPerformed(ActionEvent e) {
+ try {
+ _currentDisplay = (_currentDisplay + 1) % 2;
+
+ Mapping m = Mapping.readMappingFromAlignment(
+ getStruct(_currentDisplay), getStruct((_currentDisplay+1)%2));
+ Mapping m2 = Mapping.readMappingFromAlignment(
+ getStruct((_currentDisplay+1)%2), getStruct(_currentDisplay));
+ _vpMaster.showRNAInterpolated(getRNA(_currentDisplay), m);
+ _vpSlave.showRNAInterpolated(getRNA((_currentDisplay+1)%2), m2);
+ onStructureRedrawn();
+ }
+ catch (MappingException e3)
+ {
+ try {
+ _vpMaster.drawRNAInterpolated(getText(_currentDisplay),getStruct(_currentDisplay));
+ } catch (ExceptionNonEqualLength e1) {
+ // TODO Auto-generated catch block
+ e1.printStackTrace();
+ }
+ }
+ _vpMaster.repaint();
+ _vpSlave.repaint();
+ }
+ });
+
+ _seqPanel.setLayout(new BorderLayout());
+ _seqPanel.add(_seqLabel, BorderLayout.WEST);
+ _seqPanel.add(_seq1, BorderLayout.CENTER);
+
+ _struct1Label.setPreferredSize(new Dimension(marginTools, 15));
+ _struct1Label.setHorizontalTextPosition(JLabel.LEFT);
+ _struct1.setFont(textFieldsFont);
+ _struct1Panel.setLayout(new BorderLayout());
+ _struct1Panel.add(_struct1Label, BorderLayout.WEST);
+ _struct1Panel.add(_struct1, BorderLayout.CENTER);
+
+ _struct2Label.setPreferredSize(new Dimension(marginTools, 15));
+ _struct2Label.setHorizontalTextPosition(JLabel.LEFT);
+ _struct2.setFont(textFieldsFont);
+ _struct2Panel.setLayout(new BorderLayout());
+ _struct2Panel.add(_struct2Label, BorderLayout.WEST);
+ _struct2Panel.add(_struct2, BorderLayout.CENTER);
+
+ _input.setLayout(new GridLayout(3, 0));
+ _input.add(_seqPanel);
+ _input.add(_struct1Panel);
+ _input.add(_struct2Panel);
+
+ JPanel goPanel = new JPanel();
+ goPanel.setLayout(new BorderLayout());
+
+ _tools.setLayout(new BorderLayout());
+ _tools.add(_input, BorderLayout.CENTER);
+ _tools.add(_info, BorderLayout.SOUTH);
+ _tools.add(goPanel, BorderLayout.EAST);
+
+ goPanel.add(_goButton, BorderLayout.CENTER);
+ goPanel.add(_switchButton, BorderLayout.SOUTH);
+
+ getContentPane().setLayout(new BorderLayout());
+ JPanel VARNAs = new JPanel();
+ VARNAs.setLayout(new GridLayout(1,2));
+ VARNAs.add(_vpMaster);
+ VARNAs.add(_vpSlave);
+ getContentPane().add(VARNAs, BorderLayout.CENTER);
+ getContentPane().add(_tools, BorderLayout.SOUTH);
+
+ setVisible(true);
+
+ _vpMaster.getVARNAUI().UIRadiate();
+ _vpSlave.getVARNAUI().UIRadiate();
+
+ onStructureRedrawn();
+ }
+
+ public RNA getMasterRNA()
+ {
+ return getRNA(_currentDisplay);
+ }
+
+ public RNA getSlaveRNA1()
+ {
+ return getRNA((_currentDisplay+1)%2);
+ }
+
+ public RNA getSlaveRNA2()
+ {
+ return getRNA((_currentDisplay+2)%2);
+ }
+
+
+ public RNA getRNA(int i) {
+ if (i==0)
+ { return getRNA1(); }
+ else
+ { return getRNA2(); }
+ }
+
+
+ public RNA getRNA1() {
+ if (!_str1Backup.equals(getStruct1())) {
+ try {
+ _RNA1.setRNA(getText1(), getStruct1());
+ _RNA1.drawRNA(_vpMaster.getDrawMode(),_vpMaster.getConfig());
+ } catch (ExceptionUnmatchedClosingParentheses e) {
+ e.printStackTrace();
+ } catch (ExceptionFileFormatOrSyntax e1) {
+ _vpMaster.errorDialog(e1);
+ } catch (ExceptionDrawingAlgorithm e) {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ }
+ _str1Backup = getStruct1();
+ }
+ return _RNA1;
+ }
+
+ public RNA getRNA2() {
+ if (!_str2Backup.equals(getStruct2())) {
+ try {
+ _RNA2.setRNA(getText2(), getStruct2());
+ _RNA2.drawRNA(_vpMaster.getDrawMode(),_vpMaster.getConfig());
+ } catch (ExceptionUnmatchedClosingParentheses e) {
+ e.printStackTrace();
+ } catch (ExceptionFileFormatOrSyntax e1) {
+ _vpMaster.errorDialog(e1);
+ } catch (ExceptionDrawingAlgorithm e) {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ }
+ _str2Backup = getStruct2();
+ }
+ return _RNA2;
+ }
+
+ public String getText(int i)
+ {
+ return "";
+ }
+
+ public String getStruct(int i)
+ {
+ if (i==0)
+ return _struct1.getText();
+ else
+ return _struct2.getText();
+ }
+
+
+ public String getText1()
+ {
+ return _seq1.getText();
+ }
+
+ public String getText2()
+ {
+ return _seq2.getText();
+ }
+
+ public String getStruct1() {
+ return cleanStruct(_struct1.getText());
+ }
+
+ public String getStruct2() {
+ return cleanStruct(_struct2.getText());
+ }
+
+ private String cleanStruct(String struct) {
+ struct = struct.replaceAll("[:-]", "");
+ return struct;
+ }
+
+ public String[][] getParameterInfo() {
+ String[][] info = {
+ // Parameter Name Kind of Value Description,
+ { "sequenceDBN", "String", "A raw RNA sequence" },
+ { "structureDBN", "String",
+ "An RNA structure in dot bracket notation (DBN)" },
+ { errorOpt, "boolean", "To show errors" }, };
+ return info;
+ }
+
+ public void init() {
+ _vpMaster.setBackground(_backgroundColor);
+ _error = true;
+ }
+
+ @SuppressWarnings("unused")
+ private Color getSafeColor(String col, Color def) {
+ Color result;
+ try {
+ result = Color.decode(col);
+ } catch (Exception e) {
+ try {
+ result = Color.getColor(col, def);
+ } catch (Exception e2) {
+ return def;
+ }
+ }
+ return result;
+ }
+
+ public VARNAPanel get_varnaPanel() {
+ return _vpMaster;
+ }
+
+ public void set_varnaPanel(VARNAPanel surface) {
+ _vpMaster = surface;
+ }
+
+ public JTextField get_struct() {
+ return _struct1;
+ }
+
+ public void set_struct(JTextField _struct) {
+ this._struct1 = _struct;
+ }
+
+ public JLabel get_info() {
+ return _info;
+ }
+
+ public void set_info(JLabel _info) {
+ this._info = _info;
+ }
+
+ public static void main(String[] args) {
+ SuperpositionDemo d = new SuperpositionDemo();
+ d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
+ d.pack();
+ d.setVisible(true);
+ }
+
+ public void onStructureRedrawn() {
+ try{
+ Mapping m = Mapping.readMappingFromAlignment(
+ this.getStruct((_currentDisplay+1)%2), getStruct((_currentDisplay)%2));
+ ControleurInterpolator.moveNearOtherRNA(getRNA((_currentDisplay)%2), getRNA((_currentDisplay+1)%2), m);
+ _vpSlave.repaint();
+ _vpMaster.repaint();
+ }
+ catch (MappingException e3) {System.out.println(e3.toString());}
+ }
+
+ public void onWarningEmitted(String s) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void onLoad(String path) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void onLoaded() {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void onUINewStructure(VARNAConfig v, RNA r) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void onZoomLevelChanged(){
+ // TODO Auto-generated method stub
+
+ }
+
+ public void onTranslationChanged() {
+ // TODO Auto-generated method stub
+
+ }
+}