+
+ /**
+ * Tests for the method that converts a series of [start, end] ranges to
+ * single positions, where the mapping is to a reverse strand i.e. start is
+ * greater than end point mapped to
+ */
+ @Test(groups = { "Functional" })
+ public void testFlattenRanges_reverseStrand()
+ {
+ assertEquals("[4, 3, 2, 1]",
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 4, 1 })));
+ assertEquals("[4, 3, 2, 1]",
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 4, 3, 2, 1 })));
+ assertEquals("[4, 3, 2, 1]",
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 4, 4, 3, 3, 2, 2, 1, 1 })));
+ assertEquals("[12, 9, 8, 7, 4, 3, 2, 1]",
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 12, 12, 9, 7, 4, 1 })));
+ // forwards and backwards anyone?
+ assertEquals("[4, 5, 6, 3, 2, 1]",
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 4, 6, 3, 1 })));
+ // backwards and forwards
+ assertEquals("[3, 2, 1, 4, 5, 6]",
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 3, 1, 4, 6 })));
+ // trailing unpaired start position is ignored:
+ assertEquals("[12, 9, 8, 7, 4, 3, 2]",
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 12, 12, 9, 7, 4, 2, 1 })));
+ }
+
+ /**
+ * Test mapping a column selection including hidden columns
+ *
+ * @throws IOException
+ */
+ @Test(groups = { "Functional" })
+ public void testMapColumnSelection_hiddenColumns() throws IOException
+ {
+ setupMappedAlignments();
+
+ ColumnSelection proteinSelection = new ColumnSelection();
+ HiddenColumns hiddenCols = new HiddenColumns();
+
+ /*
+ * Column 0 in protein picks up Seq2/L, Seq3/G which map to cols 0-4 and 0-3
+ * in dna respectively, overall 0-4
+ */
+ proteinSelection.hideSelectedColumns(0, hiddenCols);
+ ColumnSelection dnaSelection = new ColumnSelection();
+ HiddenColumns dnaHidden = new HiddenColumns();
+ MappingUtils.mapColumnSelection(proteinSelection, hiddenCols,
+ proteinView, dnaView, dnaSelection, dnaHidden);
+ assertEquals("[]", dnaSelection.getSelected().toString());
+ Iterator<int[]> regions = dnaHidden.iterator();
+ assertEquals(1, dnaHidden.getNumberOfRegions());
+ assertEquals("[0, 4]", Arrays.toString(regions.next()));
+
+ /*
+ * Column 1 in protein picks up Seq1/K which maps to cols 0-3 in dna
+ */
+ dnaSelection = new ColumnSelection();
+ dnaHidden = new HiddenColumns();
+ hiddenCols.revealAllHiddenColumns(proteinSelection);
+ // the unhidden columns are now marked selected!
+ assertEquals("[0]", proteinSelection.getSelected().toString());
+ // deselect these or hideColumns will be expanded to include 0
+ proteinSelection.clear();
+ proteinSelection.hideSelectedColumns(1, hiddenCols);
+ MappingUtils.mapColumnSelection(proteinSelection, hiddenCols,
+ proteinView, dnaView, dnaSelection, dnaHidden);
+ regions = dnaHidden.iterator();
+ assertEquals(1, dnaHidden.getNumberOfRegions());
+ assertEquals("[0, 3]", Arrays.toString(regions.next()));
+
+ /*
+ * Column 2 in protein picks up gaps only - no mapping
+ */
+ dnaSelection = new ColumnSelection();
+ dnaHidden = new HiddenColumns();
+ hiddenCols.revealAllHiddenColumns(proteinSelection);
+ proteinSelection.clear();
+ proteinSelection.hideSelectedColumns(2, hiddenCols);
+ MappingUtils.mapColumnSelection(proteinSelection, hiddenCols,
+ proteinView, dnaView, dnaSelection, dnaHidden);
+ assertEquals(0, dnaHidden.getNumberOfRegions());
+
+ /*
+ * Column 3 in protein picks up Seq1/P, Seq2/Q, Seq3/S which map to columns
+ * 6-9, 6-10, 5-8 respectively, overall to 5-10
+ */
+ dnaSelection = new ColumnSelection();
+ dnaHidden = new HiddenColumns();
+ hiddenCols.revealAllHiddenColumns(proteinSelection);
+ proteinSelection.clear();
+ proteinSelection.hideSelectedColumns(3, hiddenCols); // 5-10 hidden in dna
+ proteinSelection.addElement(1); // 0-3 selected in dna
+ MappingUtils.mapColumnSelection(proteinSelection, hiddenCols,
+ proteinView, dnaView, dnaSelection, dnaHidden);
+ assertEquals("[0, 1, 2, 3]", dnaSelection.getSelected().toString());
+ regions = dnaHidden.iterator();
+ assertEquals(1, dnaHidden.getNumberOfRegions());
+ assertEquals("[5, 10]", Arrays.toString(regions.next()));
+
+ /*
+ * Combine hiding columns 1 and 3 to get discontiguous hidden columns
+ */
+ dnaSelection = new ColumnSelection();
+ dnaHidden = new HiddenColumns();
+ hiddenCols.revealAllHiddenColumns(proteinSelection);
+ proteinSelection.clear();
+ proteinSelection.hideSelectedColumns(1, hiddenCols);
+ proteinSelection.hideSelectedColumns(3, hiddenCols);
+ MappingUtils.mapColumnSelection(proteinSelection, hiddenCols,
+ proteinView, dnaView, dnaSelection, dnaHidden);
+ regions = dnaHidden.iterator();
+ assertEquals(2, dnaHidden.getNumberOfRegions());
+ assertEquals("[0, 3]", Arrays.toString(regions.next()));
+ assertEquals("[5, 10]", Arrays.toString(regions.next()));
+ }
+
+ @Test(groups = { "Functional" })
+ public void testGetLength()
+ {
+ assertEquals(0, MappingUtils.getLength(null));
+
+ /*
+ * [start, end] ranges
+ */
+ List<int[]> ranges = new ArrayList<>();
+ assertEquals(0, MappingUtils.getLength(ranges));
+ ranges.add(new int[] { 1, 1 });
+ assertEquals(1, MappingUtils.getLength(ranges));
+ ranges.add(new int[] { 2, 10 });
+ assertEquals(10, MappingUtils.getLength(ranges));
+ ranges.add(new int[] { 20, 10 });
+ assertEquals(21, MappingUtils.getLength(ranges));
+
+ /*
+ * [start, end, start, end...] ranges
+ */
+ ranges.clear();
+ ranges.add(new int[] { 1, 5, 8, 4 });
+ ranges.add(new int[] { 8, 2 });
+ ranges.add(new int[] { 12, 12 });
+ assertEquals(18, MappingUtils.getLength(ranges));
+ }
+
+ @Test(groups = { "Functional" })
+ public void testContains()
+ {
+ assertFalse(MappingUtils.contains(null, 1));
+ List<int[]> ranges = new ArrayList<>();
+ assertFalse(MappingUtils.contains(ranges, 1));
+
+ ranges.add(new int[] { 1, 4 });
+ ranges.add(new int[] { 6, 6 });
+ ranges.add(new int[] { 8, 10 });
+ ranges.add(new int[] { 30, 20 });
+ ranges.add(new int[] { -16, -44 });
+
+ assertFalse(MappingUtils.contains(ranges, 0));
+ assertTrue(MappingUtils.contains(ranges, 1));
+ assertTrue(MappingUtils.contains(ranges, 2));
+ assertTrue(MappingUtils.contains(ranges, 3));
+ assertTrue(MappingUtils.contains(ranges, 4));
+ assertFalse(MappingUtils.contains(ranges, 5));
+
+ assertTrue(MappingUtils.contains(ranges, 6));
+ assertFalse(MappingUtils.contains(ranges, 7));
+
+ assertTrue(MappingUtils.contains(ranges, 8));
+ assertTrue(MappingUtils.contains(ranges, 9));
+ assertTrue(MappingUtils.contains(ranges, 10));
+
+ assertFalse(MappingUtils.contains(ranges, 31));
+ assertTrue(MappingUtils.contains(ranges, 30));
+ assertTrue(MappingUtils.contains(ranges, 29));
+ assertTrue(MappingUtils.contains(ranges, 20));
+ assertFalse(MappingUtils.contains(ranges, 19));
+
+ assertFalse(MappingUtils.contains(ranges, -15));
+ assertTrue(MappingUtils.contains(ranges, -16));
+ assertTrue(MappingUtils.contains(ranges, -44));
+ assertFalse(MappingUtils.contains(ranges, -45));
+ }
+
+ /**
+ * Test the method that drops positions from the start of a mapped range
+ */
+ @Test(groups = "Functional")
+ public void testRemoveStartPositions()
+ {
+ int[] ranges = new int[] { 1, 10 };
+ int[] adjusted = MappingUtils.removeStartPositions(0, ranges);
+ assertEquals("[1, 10]", Arrays.toString(adjusted));
+
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[2, 10]", Arrays.toString(adjusted));
+ assertEquals("[1, 10]", Arrays.toString(ranges));
+
+ ranges = adjusted;
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[3, 10]", Arrays.toString(adjusted));
+ assertEquals("[2, 10]", Arrays.toString(ranges));
+
+ ranges = new int[] { 2, 3, 10, 12 };
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[3, 3, 10, 12]", Arrays.toString(adjusted));
+ assertEquals("[2, 3, 10, 12]", Arrays.toString(ranges));
+
+ ranges = new int[] { 2, 2, 8, 12 };
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[8, 12]", Arrays.toString(adjusted));
+ assertEquals("[2, 2, 8, 12]", Arrays.toString(ranges));
+
+ ranges = new int[] { 2, 2, 8, 12 };
+ adjusted = MappingUtils.removeStartPositions(2, ranges);
+ assertEquals("[9, 12]", Arrays.toString(adjusted));
+ assertEquals("[2, 2, 8, 12]", Arrays.toString(ranges));
+
+ ranges = new int[] { 2, 2, 4, 4, 9, 12 };
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[4, 4, 9, 12]", Arrays.toString(adjusted));
+ assertEquals("[2, 2, 4, 4, 9, 12]", Arrays.toString(ranges));
+
+ ranges = new int[] { 2, 2, 4, 4, 9, 12 };
+ adjusted = MappingUtils.removeStartPositions(2, ranges);
+ assertEquals("[9, 12]", Arrays.toString(adjusted));
+ assertEquals("[2, 2, 4, 4, 9, 12]", Arrays.toString(ranges));
+
+ ranges = new int[] { 2, 3, 9, 12 };
+ adjusted = MappingUtils.removeStartPositions(3, ranges);
+ assertEquals("[10, 12]", Arrays.toString(adjusted));
+ assertEquals("[2, 3, 9, 12]", Arrays.toString(ranges));
+ }
+
+ /**
+ * Test the method that drops positions from the start of a mapped range, on
+ * the reverse strand
+ */
+ @Test(groups = "Functional")
+ public void testRemoveStartPositions_reverseStrand()
+ {
+ int[] ranges = new int[] { 10, 1 };
+ int[] adjusted = MappingUtils.removeStartPositions(0, ranges);
+ assertEquals("[10, 1]", Arrays.toString(adjusted));
+ assertEquals("[10, 1]", Arrays.toString(ranges));
+
+ ranges = adjusted;
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[9, 1]", Arrays.toString(adjusted));
+ assertEquals("[10, 1]", Arrays.toString(ranges));
+
+ ranges = adjusted;
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[8, 1]", Arrays.toString(adjusted));
+ assertEquals("[9, 1]", Arrays.toString(ranges));
+
+ ranges = new int[] { 12, 11, 9, 6 };
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[11, 11, 9, 6]", Arrays.toString(adjusted));
+ assertEquals("[12, 11, 9, 6]", Arrays.toString(ranges));
+
+ ranges = new int[] { 12, 12, 8, 4 };
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[8, 4]", Arrays.toString(adjusted));
+ assertEquals("[12, 12, 8, 4]", Arrays.toString(ranges));
+
+ ranges = new int[] { 12, 12, 8, 4 };
+ adjusted = MappingUtils.removeStartPositions(2, ranges);
+ assertEquals("[7, 4]", Arrays.toString(adjusted));
+ assertEquals("[12, 12, 8, 4]", Arrays.toString(ranges));
+
+ ranges = new int[] { 12, 12, 10, 10, 8, 4 };
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[10, 10, 8, 4]", Arrays.toString(adjusted));
+ assertEquals("[12, 12, 10, 10, 8, 4]", Arrays.toString(ranges));
+
+ ranges = new int[] { 12, 12, 10, 10, 8, 4 };
+ adjusted = MappingUtils.removeStartPositions(2, ranges);
+ assertEquals("[8, 4]", Arrays.toString(adjusted));
+ assertEquals("[12, 12, 10, 10, 8, 4]", Arrays.toString(ranges));
+
+ ranges = new int[] { 12, 11, 8, 4 };
+ adjusted = MappingUtils.removeStartPositions(3, ranges);
+ assertEquals("[7, 4]", Arrays.toString(adjusted));
+ assertEquals("[12, 11, 8, 4]", Arrays.toString(ranges));
+ }
+
+ @Test(groups = { "Functional" })
+ public void testRangeContains()
+ {
+ /*
+ * both forward ranges
+ */
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 1, 10 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 2, 10 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 1, 9 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 4, 5 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 0, 9 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { -10, -9 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 1, 11 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 11, 12 }));
+
+ /*
+ * forward range, reverse query
+ */
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 10, 1 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 9, 1 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 10, 2 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 5, 5 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 11, 1 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 10, 0 }));
+
+ /*
+ * reverse range, forward query
+ */
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 1, 10 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 1, 9 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 2, 10 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 6, 6 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 6, 11 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 11, 20 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { -3, -2 }));
+
+ /*
+ * both reverse
+ */
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 10, 1 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 9, 1 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 10, 2 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 3, 3 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 11, 1 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 10, 0 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 12, 11 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { -5, -8 }));
+
+ /*
+ * bad arguments
+ */
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10, 12 }, new int[] { 1, 10 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 1 }));
+ assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, null));
+ assertFalse(MappingUtils.rangeContains(null, new int[] { 1, 10 }));
+ }
+
+ @Test(groups = "Functional")
+ public void testRemoveEndPositions()
+ {
+ List<int[]> ranges = new ArrayList<>();
+
+ /*
+ * case 1: truncate last range
+ */
+ ranges.add(new int[] { 1, 10 });
+ ranges.add(new int[] { 20, 30 });
+ MappingUtils.removeEndPositions(5, ranges);
+ assertEquals(2, ranges.size());
+ assertEquals(25, ranges.get(1)[1]);
+
+ /*
+ * case 2: remove last range
+ */
+ ranges.clear();
+ ranges.add(new int[] { 1, 10 });
+ ranges.add(new int[] { 20, 22 });
+ MappingUtils.removeEndPositions(3, ranges);
+ assertEquals(1, ranges.size());
+ assertEquals(10, ranges.get(0)[1]);
+
+ /*
+ * case 3: truncate penultimate range
+ */
+ ranges.clear();
+ ranges.add(new int[] { 1, 10 });
+ ranges.add(new int[] { 20, 21 });
+ MappingUtils.removeEndPositions(3, ranges);
+ assertEquals(1, ranges.size());
+ assertEquals(9, ranges.get(0)[1]);
+
+ /*
+ * case 4: remove last two ranges
+ */
+ ranges.clear();
+ ranges.add(new int[] { 1, 10 });
+ ranges.add(new int[] { 20, 20 });
+ ranges.add(new int[] { 30, 30 });
+ MappingUtils.removeEndPositions(3, ranges);
+ assertEquals(1, ranges.size());
+ assertEquals(9, ranges.get(0)[1]);
+ }
+
+ /**
+ * Test mapping a sequence group where sequences in and outside the group
+ * share a dataset sequence (e.g. alternative CDS for the same gene)
+ * <p>
+ * This scenario doesn't arise after JAL-3763 changes, but test left as still valid
+ * @throws IOException
+ */
+ @Test(groups = { "Functional" })
+ public void testMapSequenceGroup_sharedDataset() throws IOException
+ {
+ /*
+ * Set up dna and protein Seq1/2/3 with mappings (held on the protein
+ * viewport). CDS sequences share the same 'gene' dataset sequence.
+ */
+ SequenceI dna = new Sequence("dna", "aaatttgggcccaaatttgggccc");
+ SequenceI cds1 = new Sequence("cds1/1-6", "aaattt");
+ SequenceI cds2 = new Sequence("cds1/4-9", "tttggg");
+ SequenceI cds3 = new Sequence("cds1/19-24", "gggccc");
+
+ cds1.setDatasetSequence(dna);
+ cds2.setDatasetSequence(dna);
+ cds3.setDatasetSequence(dna);
+
+ SequenceI pep1 = new Sequence("pep1", "KF");
+ SequenceI pep2 = new Sequence("pep2", "FG");
+ SequenceI pep3 = new Sequence("pep3", "GP");
+ pep1.createDatasetSequence();
+ pep2.createDatasetSequence();
+ pep3.createDatasetSequence();
+
+ /*
+ * add mappings from coding positions of dna to respective peptides
+ */
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ acf.addMap(dna, pep1,
+ new MapList(new int[]
+ { 1, 6 }, new int[] { 1, 2 }, 3, 1));
+ acf.addMap(dna, pep2,
+ new MapList(new int[]
+ { 4, 9 }, new int[] { 1, 2 }, 3, 1));
+ acf.addMap(dna, pep3,
+ new MapList(new int[]
+ { 19, 24 }, new int[] { 1, 2 }, 3, 1));
+
+ List<AlignedCodonFrame> acfList = Arrays
+ .asList(new AlignedCodonFrame[]
+ { acf });
+
+ AlignmentI cdna = new Alignment(new SequenceI[] { cds1, cds2, cds3 });
+ AlignmentI protein = new Alignment(
+ new SequenceI[]
+ { pep1, pep2, pep3 });
+ AlignViewportI cdnaView = new AlignViewport(cdna);
+ AlignViewportI peptideView = new AlignViewport(protein);
+ protein.setCodonFrames(acfList);
+
+ /*
+ * Select pep1 and pep3 in the protein alignment
+ */
+ SequenceGroup sg = new SequenceGroup();
+ sg.setColourText(true);
+ sg.setIdColour(Color.GREEN);
+ sg.setOutlineColour(Color.LIGHT_GRAY);
+ sg.addSequence(pep1, false);
+ sg.addSequence(pep3, false);
+ sg.setEndRes(protein.getWidth() - 1);
+
+ /*
+ * Verify the mapped sequence group in dna is cds1 and cds3
+ */
+ SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg,
+ peptideView, cdnaView);
+ assertTrue(mappedGroup.getColourText());
+ assertSame(sg.getIdColour(), mappedGroup.getIdColour());
+ assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
+ assertEquals(2, mappedGroup.getSequences().size());
+ assertSame(cds1, mappedGroup.getSequences().get(0));
+ assertSame(cds3, mappedGroup.getSequences().get(1));
+ // columns 1-6 selected (0-5 base zero)
+ assertEquals(0, mappedGroup.getStartRes());
+ assertEquals(5, mappedGroup.getEndRes());
+
+ /*
+ * Select mapping sequence group from dna to protein
+ */
+ sg.clear();
+ sg.addSequence(cds2, false);
+ sg.addSequence(cds1, false);
+ sg.setStartRes(0);
+ sg.setEndRes(cdna.getWidth() - 1);
+ mappedGroup = MappingUtils.mapSequenceGroup(sg, cdnaView, peptideView);
+ assertTrue(mappedGroup.getColourText());
+ assertSame(sg.getIdColour(), mappedGroup.getIdColour());
+ assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
+ assertEquals(2, mappedGroup.getSequences().size());
+ assertSame(protein.getSequenceAt(1), mappedGroup.getSequences().get(0));
+ assertSame(protein.getSequenceAt(0), mappedGroup.getSequences().get(1));
+ assertEquals(0, mappedGroup.getStartRes());
+ assertEquals(1, mappedGroup.getEndRes()); // two columns
+ }