<html>
<!--
- * Jalview - A Sequence Alignment Editor and Viewer (Version 2.9.0b1)
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.9.0b2)
* Copyright (C) 2015 The Jalview Authors
*
* This file is part of Jalview.
</ul></li>
<li><strong>Pairwise Alignments</strong><br> <em>Applies
Smith and Waterman algorithm to selected sequences. See <a
- href="../calculations/pairwise.html"
- >pairwise alignments</a>.
+ href="../calculations/pairwise.html">pairwise
+ alignments</a>.
</em><br></li>
<li><strong>Principal Component Analysis</strong><br> <em>Shows
a spatial clustering of the sequences based on similarity scores
calculated over the alignment.. See <a
- href="../calculations/pca.html"
- >Principal Component Analysis</a>.
+ href="../calculations/pca.html">Principal Component
+ Analysis</a>.
</em> <br></li>
<li><strong>Extract Scores ... (optional)</strong><br> <em>This
option is only visible if Jalview detects one or more
parsed into sequence associated annotation which can then be
used to sort the alignment via the Sort by→Score menu.
</em> <br></li>
- <li><strong>Translate as cDNA</strong> (not applet)<br>
- <em>This option is visible for nucleotide alignments. Selecting
- this option shows the DNA's calculated protein product in a new
- <a href="../features/splitView.html">split frame</a> window.
- Note that the translation is not frame- or intron-aware; it
- simply translates all codons in each sequence, using the
- standard <a href="../misc/geneticCode.html">genetic code</a>
- (any incomplete final codon is discarded). You can perform this
- action on the whole alignment, or selected rows, columns, or
- regions.
+ <li><strong>Translate as cDNA</strong> (not applet)<br> <em>This
+ option is visible for nucleotide alignments. Selecting this
+ option shows the DNA's calculated protein product in a new <a
+ href="../features/splitView.html">split frame</a> window. Note
+ that the translation is not frame- or intron-aware; it simply
+ translates all codons in each sequence, using the standard <a
+ href="../misc/geneticCode.html">genetic code</a> (any incomplete
+ final codon is discarded). You can perform this action on the
+ whole alignment, or selected rows, columns, or regions.
+ </em> <br></li>
+ <li><strong>Reverse, Reverse Complement</strong> (not applet)<br>
+ <em>These options are visible for nucleotide alignments.
+ Selecting them adds the reverse (or reverse complement) of the
+ sequences (or selected region) as new sequences in the
+ alignment. To try this out, add this sequence and perform
+ 'Reverse Complement' followed by 'Translate as cDNA': <br>
+ <small> Seq
+ GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC
+ TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG</small>
</em> <br></li>
<li><strong>Get Cross-References</strong> (not applet)<br>
- <em>This option is visible where sequences have
+ <em>This option is visible where sequences have
cross-references to other standard databases; for example, an
EMBL entry may have cross-references to one or more UNIPROT
entries. Select the database to view all cross-referenced