<html>
<!--
- * Jalview - A Sequence Alignment Editor and Viewer (Version 2.8)
- * Copyright (C) 2012 J Procter, AM Waterhouse, LM Lui, J Engelhardt, G Barton, M Clamp, S Searle
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
*
* This file is part of Jalview.
*
* Jalview is free software: you can redistribute it and/or
* modify it under the terms of the GNU General Public License
- * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
*
* Jalview is distributed in the hope that it will be useful, but
* WITHOUT ANY WARRANTY; without even the implied warranty
* of MERCHANTABILITY or FITNESS FOR A PARTICULAR
* PURPOSE. See the GNU General Public License for more details.
*
- * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
--->
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ -->
<head>
<title>Alignment Window Menus</title>
</head>
<body>
- <p>
- <strong>Alignment Window Calculate Menu</strong>
- </p>
- <ul>
- <li><strong>Sort </strong>
- <ul>
- <li><strong>by ID</strong><em><br> This will sort the
- sequences according to sequence name. If the sort is repeated, the
- order of the sorted sequences will be inverted. </em>
- </li>
- <li><strong>by Length</strong><em><br> This will sort
- the sequences according to their length (excluding gap
- characters). If the sort is repeated, the order of the sorted
- sequences will be inverted. </em>
- </li>
- <li><strong>by Group</strong><strong><br> </strong><em>This
- will sort the sequences according to sequence name. If the sort is
- repeated, the order of the sorted sequences will be inverted. </em><strong></strong>
- </li>
- <li><strong>by Pairwise Identity<br> </strong><em>This
- will sort the selected sequences by their percentage identity to
- the consensus sequence. The most similar sequence is put at the
- top. </em>
- </li>
- <li><em>The <a href="../calculations/sorting.html">Sort
- menu</a> will have some additional options if the alignment has any
- associated score annotation, or you have just done a multiple
- alignment calculation or opened a tree viewer window.</em><br></li>
- </ul></li>
- <li><strong>Calculate Tree </strong> <br> <em>Functions
- for calculating trees on the alignment or the currently selected
- region. See <a href="../calculations/tree.html">calculating
- trees</a>.</em>
- <ul>
- <li><strong>Average Distance Using % Identity</strong>
- </li>
- <li><strong>Neighbour Joining Using % Identity</strong>
- </li>
- <li><strong>Average Distance Using Blosum62</strong>
- </li>
- <li><strong>Neighbour Joining Using Blosum62<br>
- </strong>
- </li>
- </ul></li>
- <li><strong>Pairwise Alignments</strong><br> <em>Applies
- Smith and Waterman algorithm to selected sequences. See <a
- href="../calculations/pairwise.html">pairwise alignments</a>.</em><br>
- </li>
- <li><strong>Principal Component Analysis</strong><br> <em>Shows
- a spatial clustering of the sequences based on the BLOSUM62 scores
- in the alignment. See <a href="../calculations/pca.html">Principal
- Component Analysis</a>.</em> <br></li>
- <li><strong>Extract Scores ... (optional)</strong><br> <em>This
- option is only visible if Jalview detects one or more white-space
- separated values in the description line of the alignment sequences.<br>
- When selected, these numbers are parsed into sequence associated
- annotation which can then be used to sort the alignment via the Sort
- by→Score menu.</em> <br></li>
-
- <li><strong>Autocalculate Consensus</strong><br> <em>For
- large alignments it can be useful to deselect "Autocalculate
- Consensus" when editing. This prevents the sometimes lengthy
- calculations performed after each sequence edit.</em> <br></li>
- <li><strong>Sort Alignment With New Tree</strong><br> <em>If
- this option is selected, the alignment will be automatically sorted
- whenever a new tree is calculated or loaded.</em> <br>
- </li>
- </ul>
+ <p>
+ <strong>Alignment Window Calculate Menu</strong>
+ </p>
+ <ul>
+ <li><strong>Sort </strong>
+ <ul>
+ <li><strong>By ID</strong><em><br> This will sort
+ the sequences according to sequence name. If the sort is
+ repeated, the order of the sorted sequences will be
+ inverted. </em></li>
+ <li><strong>By Length</strong><em><br> This will
+ sort the sequences according to their length (excluding gap
+ characters). If the sort is repeated, the order of the
+ sorted sequences will be inverted. </em></li>
+ <li><strong>By Group</strong><strong><br> </strong><em>This
+ will sort the sequences according to sequence name. If the
+ sort is repeated, the order of the sorted sequences will be
+ inverted. </em><strong></strong></li>
+ <li><strong>By Pairwise Identity<br>
+ </strong><em>This will sort the selected sequences by their
+ percentage identity to the consensus sequence. The most
+ similar sequence is put at the top. </em></li>
+ <li><em>The <a href="../calculations/sorting.html">Sort
+ menu</a> will have some additional options if the alignment
+ has any associated score annotation, or you have just done a
+ multiple alignment calculation or opened a tree viewer
+ window.
+ </em><br></li>
+ </ul></li>
+ <li><strong>Calculate Tree or PCA ...</strong> <br> <em>Opens the
+ <a href="../calculations/calculations.html">calculations dialog</a> for
+ for calculating <a href="../calculations/tree.html">trees</a> or
+ <a href="../calculations/pca.html">principle component analysis
+ plots</a> on the alignment or the currently selected
+ region.
+ </em><br>
+ </li>
+ <li><strong>Pairwise Alignments</strong><br> <em>Applies
+ Smith and Waterman algorithm to selected sequences. See <a
+ href="../calculations/pairwise.html">pairwise
+ alignments</a>.
+ </em><br></li>
+ <li><strong>Extract Scores ... (optional)</strong><br> <em>This
+ option is only visible if Jalview detects one or more
+ white-space separated values in the description line of the
+ alignment sequences.<br> When selected, these numbers are
+ parsed into sequence associated annotation which can then be
+ used to sort the alignment via the Sort by→Score menu.
+ </em> <br></li>
+ <li><strong>Translate as cDNA</strong><br> <em>This
+ option is visible for nucleotide alignments. Selecting this
+ option shows the DNA's calculated protein product in a new <a
+ href="../features/splitView.html">split frame</a> window. Note
+ that the translation is not frame- or intron-aware; it simply
+ translates all codons in each sequence. You can use the standard <a
+ href="../misc/geneticCode.html">genetic code</a>, or choose an
+ alternative code table (any incomplete final codon is discarded).
+ You can perform this action on the whole alignment, or selected
+ rows, columns, or regions. Alternative code tables were added in
+ Jalview 2.11.
+ </em> <br></li>
+ <li><strong>Reverse, Reverse Complement</strong> (not applet)<br>
+ <em>These options are visible for nucleotide alignments.
+ Selecting them adds the reverse (or reverse complement) of the
+ sequences (or selected region) as new sequences in the
+ alignment. To try this out, add this sequence and perform
+ 'Reverse Complement' followed by 'Translate as cDNA': <br>
+ <small> Seq
+ GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC
+ TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG</small>
+ </em> <br></li>
+ <li><strong>Get Cross-References</strong> (not applet)<br>
+ <em>This option is visible where sequences have
+ cross-references to other standard databases; for example, an
+ EMBL entry may have cross-references to one or more UNIPROT
+ entries. Select the database to view all cross-referenced
+ sequences in a new <a href="../features/splitView.html">split
+ frame</a> window.
+ </em> <br></li>
+ <li><strong>Autocalculate Consensus</strong><br> <em>For
+ large alignments it can be useful to deselect
+ "Autocalculate Consensus" when editing. This prevents
+ the sometimes lengthy calculations performed after each sequence
+ edit.</em> <br></li>
+ <li><strong>Sort Alignment With New Tree</strong><br> <em>If
+ this option is selected, the alignment will be automatically
+ sorted whenever a new tree is calculated or loaded.</em> <br></li>
+ <li><strong>Show Flanking Regions</strong><br> <em>Opens
+ a new alignment window showing any additional sequence data
+ either side of the current alignment. Useful in conjunction with
+ 'Fetch Database References' when the 'Trim Retrieved Sequences'
+ option is disabled to retrieve full length sequences for a set
+ of aligned peptides. </em></li>
+ </ul>
</body>
</html>